ID: 927610250

View in Genome Browser
Species Human (GRCh38)
Location 2:24531725-24531747
Sequence TGATAGTTTGCTGAGAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33134
Summary {0: 3456, 1: 11192, 2: 10129, 3: 4750, 4: 3607}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927610244_927610250 21 Left 927610244 2:24531681-24531703 CCACCTGTGAATGAGAACATACG 0: 1
1: 20
2: 632
3: 7318
4: 18326
Right 927610250 2:24531725-24531747 TGATAGTTTGCTGAGAATGATGG 0: 3456
1: 11192
2: 10129
3: 4750
4: 3607
927610246_927610250 18 Left 927610246 2:24531684-24531706 CCTGTGAATGAGAACATACGGTG 0: 1
1: 17
2: 572
3: 6443
4: 13689
Right 927610250 2:24531725-24531747 TGATAGTTTGCTGAGAATGATGG 0: 3456
1: 11192
2: 10129
3: 4750
4: 3607
927610243_927610250 22 Left 927610243 2:24531680-24531702 CCCACCTGTGAATGAGAACATAC 0: 1
1: 35
2: 1035
3: 10674
4: 20583
Right 927610250 2:24531725-24531747 TGATAGTTTGCTGAGAATGATGG 0: 3456
1: 11192
2: 10129
3: 4750
4: 3607

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927610250 Original CRISPR TGATAGTTTGCTGAGAATGA TGG Intronic