ID: 927613988

View in Genome Browser
Species Human (GRCh38)
Location 2:24571122-24571144
Sequence TACTATCTCGAGTACAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927613982_927613988 -5 Left 927613982 2:24571104-24571126 CCTGGGCTCCTGCTTCCTTACTA 0: 1
1: 0
2: 2
3: 28
4: 292
Right 927613988 2:24571122-24571144 TACTATCTCGAGTACAGGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927613988 Original CRISPR TACTATCTCGAGTACAGGGG AGG Intronic
907721047 1:56972506-56972528 TACTATCACGAGTACAGCATGGG - Intergenic
909121523 1:71609897-71609919 CACTATCACGAGAACAGGGTGGG - Intronic
910199400 1:84683103-84683125 TACTATCTTTAGTACAGGAGAGG + Intronic
917167558 1:172129671-172129693 TACTATCACGAGAACAGTGCAGG + Intronic
917406726 1:174714633-174714655 TAGTAGCTCCAGTACAGTGGGGG + Intronic
919664477 1:200279001-200279023 AACTATCACGAGAACAGGGTGGG + Intergenic
1073843683 10:107527772-107527794 AACTATCTCTAGGACAGAGGTGG + Intergenic
1076625597 10:131819772-131819794 AACTAACTCCAGTACAGGGCAGG - Intergenic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1082946763 11:58769567-58769589 TACTATCACGAGAACAGTGTGGG - Intergenic
1090032935 11:123222881-123222903 CACTATCTCGAGAACAGGAAAGG - Intergenic
1107315183 13:39123455-39123477 TACTATCTCTAGTAGTGGTGAGG + Intergenic
1112581610 13:100680846-100680868 TTCTATCTGGTGAACAGGGGTGG - Intergenic
1120492966 14:85200115-85200137 CACTATCACGAGAACAGGGTGGG + Intergenic
1129746582 15:78025957-78025979 TACTATCTAGAATGCAGTGGGGG - Intronic
1150387434 17:64773211-64773233 GACTATGTCCAGTACAGGGAAGG - Intergenic
1156209828 18:34927628-34927650 TACTATATCCTGTACAGGAGAGG + Intergenic
1157509599 18:48261274-48261296 TAATATCTCGAGTGCTGGGCAGG + Intronic
1158020730 18:52838018-52838040 CACTATCACGAGAACAGGGTGGG + Intronic
927613988 2:24571122-24571144 TACTATCTCGAGTACAGGGGAGG + Intronic
933386225 2:81613991-81614013 TACTATCACAAGAACAGGGAAGG + Intergenic
948367784 2:237469677-237469699 TACTATCACGAGAACAGGATAGG + Intergenic
1177736700 21:25099554-25099576 TATTATTTCAAGTCCAGGGGAGG + Intergenic
1179472270 21:41619574-41619596 TACTATCATGAGAACAGGGCAGG - Intergenic
950316848 3:12009415-12009437 TACTATCTCAAGGACTGGTGGGG + Intronic
950932134 3:16800533-16800555 TAGTATCTGAAGTACAGAGGAGG + Intergenic
951467907 3:23021665-23021687 TACTATCACAAGAACAGCGGAGG + Intergenic
954951956 3:54482860-54482882 TCCTATCTAAAGTACAGGAGAGG - Intronic
971919384 4:32917219-32917241 TACTATCTCCAGGACAGAGGTGG - Intergenic
973695109 4:53483137-53483159 TACTATCTCGAGAACAGCATGGG - Intronic
974555711 4:63445377-63445399 TACTATCACGAGTACAGCATAGG + Intergenic
976444676 4:85116973-85116995 TACTATCACGAGAACAGAGTGGG - Intergenic
978708467 4:111746829-111746851 TATTATCTCGAGTAGAAAGGAGG + Intergenic
981285053 4:143006680-143006702 TACTATCACGAGAACAGGCAAGG - Intergenic
982311698 4:153992815-153992837 TACTATCTTGAGTACAAGTGGGG + Intergenic
986649571 5:9949703-9949725 TACTATCACGAGAACAGGATGGG - Intergenic
986715895 5:10523435-10523457 CACTATCTCGAGAACAGCAGGGG + Intergenic
986907739 5:12516037-12516059 CACTATCACGAGAACAGGAGGGG - Intergenic
989032688 5:37135880-37135902 TACTATCACGAGAACAGGATGGG + Intronic
991183973 5:63786164-63786186 TACTATCACGAGAACAGTAGGGG - Intergenic
991972179 5:72151783-72151805 TACTATCTAAAGAACAGGGAGGG - Intronic
992060722 5:73044005-73044027 TACTATCACGAGAACAGCGAGGG - Intronic
1004585724 6:16997988-16998010 GAATATTTCGAGTACAGGGCTGG - Intergenic
1011587327 6:88940648-88940670 TACTCTGGCGAGTACAGGGACGG + Intronic
1020635791 7:10694407-10694429 TACCATTTGGAGTCCAGGGGAGG - Intergenic
1028630892 7:92932623-92932645 TACTATCACGAGAACAGGATGGG - Intergenic
1029984879 7:104914071-104914093 TACTATCACGAGAACAGCGCAGG + Intergenic
1030250822 7:107442143-107442165 GACTATCACAAGAACAGGGGGGG - Intronic
1030810490 7:113966681-113966703 TATAATCTCAAGTACTGGGGAGG + Intronic
1031180221 7:118404706-118404728 TACTATCACGAGAACAGCGTGGG - Intergenic
1031967167 7:128034780-128034802 TACTAACTGGACTACAGAGGAGG + Intronic
1042100484 8:65271055-65271077 TACTATCCCAAGTTCTGGGGAGG + Intergenic
1044304063 8:90617425-90617447 TACTATCACGAGTACAGCACAGG - Intergenic
1045008358 8:97935990-97936012 TACAATCTTGAGCACAGTGGAGG + Intronic
1049863967 8:144921358-144921380 TACTTTCTGGAGGACAGGTGTGG - Intergenic
1060130326 9:121091034-121091056 TACTATCACGAGAACAGTAGGGG + Intronic
1186714146 X:12232444-12232466 TACTATCTCGAGAACAGCATGGG + Intronic
1189925915 X:45954586-45954608 TACTTTCTCTAGTACTGGGAAGG + Intergenic
1198888056 X:141361349-141361371 TACTATCACAAGAACAGCGGAGG + Intergenic