ID: 927615180

View in Genome Browser
Species Human (GRCh38)
Location 2:24586777-24586799
Sequence TTTTCTACACATATGCAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927615176_927615180 15 Left 927615176 2:24586739-24586761 CCACCATGCCTGGCCAGCTTGCT 0: 3
1: 12
2: 158
3: 1255
4: 7341
Right 927615180 2:24586777-24586799 TTTTCTACACATATGCAACTTGG 0: 1
1: 0
2: 2
3: 19
4: 188
927615178_927615180 7 Left 927615178 2:24586747-24586769 CCTGGCCAGCTTGCTATACTTCT 0: 1
1: 0
2: 3
3: 14
4: 234
Right 927615180 2:24586777-24586799 TTTTCTACACATATGCAACTTGG 0: 1
1: 0
2: 2
3: 19
4: 188
927615179_927615180 2 Left 927615179 2:24586752-24586774 CCAGCTTGCTATACTTCTTTATG 0: 1
1: 0
2: 0
3: 15
4: 191
Right 927615180 2:24586777-24586799 TTTTCTACACATATGCAACTTGG 0: 1
1: 0
2: 2
3: 19
4: 188
927615177_927615180 12 Left 927615177 2:24586742-24586764 CCATGCCTGGCCAGCTTGCTATA 0: 1
1: 0
2: 10
3: 97
4: 852
Right 927615180 2:24586777-24586799 TTTTCTACACATATGCAACTTGG 0: 1
1: 0
2: 2
3: 19
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927615180 Original CRISPR TTTTCTACACATATGCAACT TGG Intronic
905563771 1:38947184-38947206 TTTCCTAAAAATTTGCAACTGGG + Intergenic
905935152 1:41817543-41817565 TTTTCTTCACATATTCATCTTGG + Intronic
907594038 1:55703525-55703547 TTTTCTACCCATATGCCCCAGGG + Intergenic
910566535 1:88649893-88649915 TATTTTACACATAAGCAAATGGG + Intergenic
911623831 1:100097873-100097895 GATTCTACTCATATGAAACTTGG + Intronic
912016636 1:105046061-105046083 TTTTCTACATATATTTTACTAGG + Intergenic
913127012 1:115800850-115800872 TTTTCTTTGCATTTGCAACTTGG + Intergenic
917206440 1:172577093-172577115 TATTCTACACATATACATATTGG - Intronic
917669473 1:177259090-177259112 TTTTCTTTGCATTTGCAACTTGG - Intronic
917825958 1:178820610-178820632 TATTCTAGAAATATGCAAATTGG + Intronic
920545588 1:206814114-206814136 TTTTTTAAATATATGCAAATAGG - Intronic
921303936 1:213777176-213777198 TTTTCTTCACATTCGCAAATTGG + Intergenic
924248736 1:242109627-242109649 TTTTCTCTACATGTGAAACTTGG + Intronic
1064275231 10:13899470-13899492 TTTTCTACAGACAAGGAACTTGG + Intronic
1065601047 10:27368976-27368998 TTTCCTACACAAATGCAAGTGGG - Intergenic
1065617178 10:27539825-27539847 CTTCCTACACAAATGCATCTAGG - Exonic
1065690840 10:28331965-28331987 ATTTCTAAACATCTGCAACCTGG - Intronic
1067411202 10:46066131-46066153 TTTTCTGTACATGTGAAACTAGG + Intergenic
1069129415 10:64680664-64680686 TTTTCTTCATTTATGAAACTTGG + Intergenic
1073869624 10:107848418-107848440 TTCTCTTCACATATGGTACTAGG + Intergenic
1074245109 10:111681910-111681932 TTTGCTACACATACTCAAATGGG + Intergenic
1074312809 10:112336811-112336833 CTACCTACAAATATGCAACTTGG - Intergenic
1075186124 10:120259515-120259537 TTTTCTTCACCTCTACAACTGGG + Intergenic
1075220088 10:120577087-120577109 TTTACTACACACATGCAAAGTGG + Intronic
1078205916 11:9229282-9229304 TTTTCCCCACATTTGTAACTTGG - Intronic
1078307089 11:10200107-10200129 TTTTATATACATATGAAACAGGG + Intronic
1078550771 11:12279226-12279248 TTCTCTATACATATCCGACTGGG - Intronic
1078618095 11:12883294-12883316 TTTTCTACAAATCTGCCAATAGG - Intronic
1078725636 11:13928335-13928357 TTGTGTATACATATGCACCTAGG + Intergenic
1079817456 11:25079536-25079558 TTTTCAAAAAATATGCATCTGGG - Exonic
1088514533 11:110615994-110616016 GTTTCTACATCTATGAAACTGGG + Intronic
1090213963 11:124943932-124943954 TTTCCTTCACATTTGCAAGTTGG + Intergenic
1090582202 11:128172666-128172688 TTGTCTACACATAATCAACAAGG - Intergenic
1093109413 12:15131541-15131563 TTTCCTACACTTATGTTACTAGG + Intronic
1093419321 12:18956656-18956678 TTTTCTAACCATATCCTACTTGG + Intergenic
1098800086 12:74945647-74945669 TTTTCTACACAAAGGCAGCCAGG + Intergenic
1099415736 12:82383890-82383912 TTTTCTACAAATATGAGACCAGG - Intronic
1099988510 12:89697771-89697793 TTTTCTACTCTGAAGCAACTAGG + Intronic
1100516835 12:95336217-95336239 TTTTATACACATGTGCATCCAGG - Intergenic
1100797769 12:98200319-98200341 TTTTCTACATATTAGAAACTCGG - Intergenic
1101249802 12:102921339-102921361 TTTTCTACCCATTTTCTACTAGG + Intronic
1104385499 12:128347967-128347989 TTTTCTACAAAAAGGCAGCTGGG + Intronic
1105235481 13:18547883-18547905 ATTTCTACACATATGCCCCTCGG - Intergenic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1109581915 13:64351052-64351074 TTTTCTACTCTCATGCCACTAGG - Intergenic
1109689779 13:65870902-65870924 TTTTCTACATTTATGTCACTAGG + Intergenic
1111602124 13:90487941-90487963 TTTTTTGCACATATTTAACTAGG + Intergenic
1113210317 13:107970620-107970642 TTATCTACACTGATGCAATTAGG + Intergenic
1113695052 13:112339450-112339472 TTTTCTTTGCATTTGCAACTTGG - Intergenic
1115429899 14:33304538-33304560 TTTTCTAAACATAAGAAATTTGG + Intronic
1115581640 14:34765161-34765183 TTTTCTTCACCTATCCACCTTGG - Exonic
1119636651 14:76278789-76278811 TTTTTTACAGATAAGGAACTTGG + Intergenic
1120848895 14:89150819-89150841 TTTTCTAGACATAAGCATGTTGG - Intronic
1121508277 14:94492986-94493008 TGTTCTACACACATGTAAGTTGG + Intronic
1122191041 14:100043907-100043929 ATATCTATACATATACAACTGGG - Intronic
1125860269 15:42992623-42992645 TATTCTGCACATGTGCAGCTTGG + Intronic
1126262579 15:46711567-46711589 TTTTCTATTAATATGCAAGTTGG - Intergenic
1126932934 15:53675017-53675039 TTTTCAACACATTTTAAACTAGG + Intronic
1129131248 15:73498814-73498836 TTTTATACACATATGCAACAAGG - Intronic
1131376540 15:91928888-91928910 TTCACTGCACTTATGCAACTTGG + Intronic
1131700672 15:94932223-94932245 TTCACTACATATCTGCAACTAGG - Intergenic
1135819521 16:25670182-25670204 TTTTCTTCACATACACAGCTTGG - Intergenic
1137067806 16:35867501-35867523 TTTGATACACAGAAGCAACTTGG + Intergenic
1140062568 16:71583589-71583611 TTTTCTCCACCTATGCAGATTGG + Intergenic
1140116665 16:72047677-72047699 TTTACTACACATATGCAGAATGG + Intronic
1142816813 17:2432976-2432998 TTTTCCACACCTATGCAAGAAGG + Intronic
1145980588 17:29008981-29009003 TTTTAAAAACATATTCAACTTGG - Intronic
1148197209 17:45722599-45722621 ATTTCAACACATATAGAACTTGG - Intergenic
1149811837 17:59682257-59682279 TTTTCTATACTTAGGAAACTGGG + Exonic
1150730079 17:67685016-67685038 TTCTCTACACATATGTCATTAGG - Intronic
1150736417 17:67744080-67744102 TTTTTTAAAAATATGTAACTGGG + Exonic
1153581599 18:6579431-6579453 TTTTCTAGGTATATGAAACTAGG + Intronic
1153941635 18:9983277-9983299 TTTTATAAGAATATGCAACTGGG - Intergenic
1154514061 18:15142121-15142143 ATTTCTACACATATGCCCCTCGG + Intergenic
1155943178 18:31820221-31820243 TTTCCCAAACATATTCAACTAGG - Intergenic
1158442242 18:57486826-57486848 TTTTCTACATTTGTGCCACTTGG + Exonic
1159201968 18:65198110-65198132 CTTTCTACACTTATGCCAGTAGG - Intergenic
1159535714 18:69712338-69712360 TTTTCTACACAAATGTGATTCGG - Intronic
925658266 2:6173711-6173733 TTTCCTTCACATTTACAACTTGG - Intergenic
926485520 2:13451213-13451235 TTTTCTCCAAATATGTACCTTGG + Intergenic
927615180 2:24586777-24586799 TTTTCTACACATATGCAACTTGG + Intronic
928763673 2:34615177-34615199 AGTTCTACATATATGCAACTGGG + Intergenic
929344878 2:40869939-40869961 TTTTGTAAACATATGCTCCTTGG + Intergenic
929840750 2:45460296-45460318 TTGTCAACACATATCCGACTAGG + Intronic
930314702 2:49783862-49783884 TTTTAAAGACTTATGCAACTAGG + Intergenic
933157442 2:78991819-78991841 TGTTTTACATATATGCAATTTGG + Intergenic
934961261 2:98676639-98676661 TTTTCTACAGTTATTCAAATGGG - Intronic
935366781 2:102301537-102301559 TTTTTTTCACATATGGAATTTGG + Intergenic
936759725 2:115761957-115761979 TTTTCTACACATATTTAACGAGG + Intronic
938127332 2:128684074-128684096 TTTTCCACACATAGGCTGCTGGG - Intergenic
938514298 2:131986729-131986751 ATTTCTACACATATGCCCCTCGG + Intergenic
938574995 2:132595488-132595510 TCTTCTACACACCTCCAACTAGG - Intronic
939296949 2:140278778-140278800 TTCTCTACAGATATTCAAATGGG + Intronic
941252273 2:163180566-163180588 TTATCTCCACATATTCAAATTGG - Intergenic
942193672 2:173496148-173496170 TTATTTACACATACTCAACTGGG + Intergenic
943085807 2:183309739-183309761 TTTACTACAGATATGAAACCTGG + Intergenic
944483322 2:200178976-200178998 TTTTCTATTCTTCTGCAACTGGG - Intergenic
945453243 2:210017684-210017706 TTTTGTTCACATGTACAACTAGG + Intronic
948337065 2:237217869-237217891 TTTGCTTCACATATCCAACTTGG + Intergenic
948913297 2:241017149-241017171 TGTTCTAGAAAAATGCAACTTGG - Intronic
1172710156 20:36915763-36915785 TTTTATACAGATTTTCAACTAGG + Intronic
1176779480 21:13176168-13176190 ATTTCTACACATATGCCCCTCGG - Intergenic
1176953966 21:15078929-15078951 TTTTCTACTCATAGTCAATTAGG + Intergenic
1177292184 21:19128063-19128085 TGTATTTCACATATGCAACTTGG - Intergenic
1177977113 21:27865205-27865227 ATTTCTATACATATGCCCCTCGG - Intergenic
1179021354 21:37643731-37643753 TTTGCCACACATTTGCATCTGGG + Intronic
1181784907 22:25220042-25220064 TTTCCTCCACATCTGCAATTAGG + Intronic
1182327838 22:29527473-29527495 TTTTTTACACAAATGGAAATAGG - Intronic
1184211390 22:43037694-43037716 TTTTCAACACAAATGGTACTTGG - Intergenic
1185169175 22:49282443-49282465 TTTTATATAAATGTGCAACTGGG + Intergenic
949365470 3:3275945-3275967 TTTCCTACACATCTGGACCTTGG + Intergenic
951288932 3:20851767-20851789 TTTTCTACAAAATTGCAATTAGG + Intergenic
956111348 3:65872663-65872685 TTTTCTATTCATATGCATCTGGG - Intronic
958839214 3:99183191-99183213 TTTTATACACAAATGCATCTAGG - Intergenic
960735936 3:120780780-120780802 TCTTCTACACACAAGCATCTTGG - Intronic
961937120 3:130596955-130596977 CTTTCTATACGTATACAACTGGG - Intronic
962041679 3:131713865-131713887 TTTTCTGCTCATAGGCAGCTGGG - Intronic
962337583 3:134549892-134549914 TTCAGTACAGATATGCAACTTGG + Intronic
962388807 3:134954656-134954678 TTTTCTGCATATGTGAAACTGGG + Intronic
962658692 3:137577928-137577950 TTTTCTACATATATGTACATAGG + Intergenic
966134663 3:176684606-176684628 CTTTCTCCACCTAGGCAACTGGG + Intergenic
969218334 4:5741396-5741418 TTTTCTTCACACATGGAAATGGG + Intronic
969910236 4:10437807-10437829 TTTTCTATATATCTGAAACTAGG - Intergenic
970334161 4:15016229-15016251 GTGTATACACATATGTAACTGGG + Intronic
970827793 4:20298032-20298054 TTTTCTGCACATATGCCTTTAGG - Intronic
970971778 4:21992473-21992495 TTTTCTACTCATCTGAAAATGGG - Intergenic
972040336 4:34587348-34587370 TTTTCTACACATTTGTAAACAGG - Intergenic
975186179 4:71406127-71406149 TATTCAACACATTTGCAGCTTGG + Intronic
975337859 4:73201782-73201804 TTTTCTAAACATAAGCTGCTTGG + Intronic
977334617 4:95681059-95681081 TCTTCTACAAAATTGCAACTTGG + Intergenic
979378644 4:119981159-119981181 TGTTTTACAGATATGAAACTGGG - Intergenic
979435837 4:120689057-120689079 TTTACTGCACTGATGCAACTCGG + Intronic
979928596 4:126600432-126600454 TTTTTTACACATTTCCAAGTAGG + Intergenic
980064270 4:128166678-128166700 TATCCTACATATCTGCAACTTGG + Intronic
980640649 4:135574242-135574264 TTTTCTTGACATTTACAACTTGG + Intergenic
981014592 4:139960721-139960743 TTTTCTGCACATCTGAAAATCGG + Intronic
982309814 4:153973178-153973200 TTTTCAACACATATTAAACTTGG + Intergenic
982912651 4:161164280-161164302 AATTCTACATATATGCAACAAGG + Intergenic
983839715 4:172442072-172442094 TTTTAAACACATATGAAACAAGG + Intronic
984612995 4:181862245-181862267 TTTTCTACAAATATGAAACTAGG + Intergenic
984897519 4:184554575-184554597 TATTCTACAAAAATTCAACTGGG + Intergenic
985045273 4:185934398-185934420 TTTTCTAAACAAAAGCAAATTGG - Intronic
985144705 4:186884111-186884133 CTGTCTACACATATGCAAAATGG - Intergenic
985485013 5:143546-143568 TTTGCCACACACATGCAGCTGGG - Intronic
986018861 5:3782076-3782098 CTGTATACACATTTGCAACTTGG + Intergenic
986946205 5:13024600-13024622 TTTTCTATGCATTTGCAACTTGG - Intergenic
992006423 5:72482862-72482884 CTTTCTACACATGTGATACTTGG - Intronic
993414723 5:87612346-87612368 TTTACCTCCCATATGCAACTGGG + Intergenic
995377005 5:111485389-111485411 TTTTCTAAATATTTGCAACTTGG - Exonic
996240215 5:121189756-121189778 TTTACATCACATAAGCAACTAGG + Intergenic
996437497 5:123451621-123451643 TTTTCTTCACATATGTACCTTGG + Intergenic
999791870 5:154947564-154947586 TCTCATACAAATATGCAACTTGG - Intronic
1003996157 6:11541655-11541677 TTTTCTTTGCATTTGCAACTTGG + Intronic
1005637137 6:27763021-27763043 TTTTAAACACATATGAAAATGGG - Intergenic
1005787320 6:29258060-29258082 TTTTCTAAACATTTGCAACATGG - Intergenic
1006315893 6:33291441-33291463 TTTTATACACATTTGCAGCAAGG + Intronic
1007147966 6:39656422-39656444 TTTTCTATACACATATAACTGGG + Intronic
1010267260 6:73880866-73880888 TTTTCTAAAGATATACAAATCGG - Intergenic
1011100887 6:83720887-83720909 TTATCTTCATATATGCAATTTGG - Intergenic
1011150124 6:84262898-84262920 TTTTCTACGAATATGAAACATGG - Intergenic
1014506005 6:122257369-122257391 TTTTCAAAATATATGAAACTTGG + Intergenic
1015472514 6:133621611-133621633 TTTTGTTCAAATATGCATCTGGG + Intergenic
1016364436 6:143300448-143300470 TTTTCTACCTGTGTGCAACTGGG - Intronic
1016840400 6:148519412-148519434 TTTTCTGTACATATGTAAGTGGG + Intronic
1017802783 6:157912883-157912905 TTTTCTAATTATTTGCAACTTGG + Intronic
1020351452 7:7223685-7223707 TTATCTACAAATCTGCAAATAGG + Intronic
1020528511 7:9296597-9296619 TTTCCTGCAAATATGCAACTAGG - Intergenic
1021185929 7:17564820-17564842 TTTCCTACACATTTAAAACTAGG - Intergenic
1021481940 7:21127841-21127863 TTTTCTTCACATTCTCAACTGGG - Intergenic
1021901333 7:25288692-25288714 ATCTCTACACCTCTGCAACTTGG - Intergenic
1022764972 7:33401769-33401791 TTTTCTAGACAGAATCAACTGGG - Intronic
1023556398 7:41427677-41427699 TTTTGGACACATATCCAAATGGG + Intergenic
1024712360 7:52030710-52030732 TCTTCAACACATATGCACCTGGG + Intergenic
1024843508 7:53615441-53615463 TATTCTACACATATTCAAGGAGG + Intergenic
1026021634 7:66712103-66712125 TTTTGTAGACATATGCAAGCTGG - Intronic
1026082583 7:67235302-67235324 TTTTCTAAATGTATGTAACTGGG + Intronic
1026694485 7:72578700-72578722 TTTTCTAAATGTATGTAACTGGG - Intronic
1030619761 7:111776000-111776022 TGTTCTACACTTGTGCACCTTGG - Intronic
1031200555 7:118679152-118679174 ATTTCTACACAGAGGCAAGTTGG - Intergenic
1031250688 7:119376436-119376458 TTTCCCACACATTTGCAATTTGG - Intergenic
1034484736 7:151352205-151352227 TTTTCTCCGGATGTGCAACTAGG + Intronic
1037587658 8:20289002-20289024 TTTTTTAGACATATGGGACTTGG + Intronic
1038239394 8:25794556-25794578 TTTTGTACAAATATAAAACTGGG - Intergenic
1039864294 8:41487885-41487907 TTTTCTACATATTTGTTACTAGG - Intergenic
1040379539 8:46858893-46858915 TTTGATAAAAATATGCAACTTGG - Intergenic
1040891430 8:52321136-52321158 TTTTCTGCACACATGCATATAGG - Intronic
1042113285 8:65404430-65404452 TTTTCCACACATATGACACTAGG + Intergenic
1042653814 8:71072869-71072891 TTTTGTATAGAAATGCAACTGGG + Intergenic
1043711013 8:83419251-83419273 TTTTCCACACTGAAGCAACTAGG - Intergenic
1045291345 8:100835362-100835384 TTTTCTACACATCTCTACCTCGG - Intergenic
1045300281 8:100904912-100904934 TTTTATTCACATCTTCAACTTGG + Intergenic
1046461768 8:114547785-114547807 TGTTTTACATTTATGCAACTTGG - Intergenic
1052100276 9:24437697-24437719 TTATCTACAAATATATAACTTGG - Intergenic
1058195998 9:101976643-101976665 ATTTCTGAACATCTGCAACTGGG + Intergenic
1058456445 9:105142172-105142194 TTTACTCCACAGATGCAACCAGG + Intergenic
1059420060 9:114185251-114185273 TATTATACACAGATGCAAATGGG - Intronic
1059917512 9:119119838-119119860 TTTTCTTTGCATTTGCAACTTGG - Intergenic
1061360661 9:130140125-130140147 TATTTTACACATTTGCAACACGG - Exonic
1185828783 X:3278475-3278497 TATTCAACACATATTCAAGTGGG + Intronic
1186573647 X:10742391-10742413 TTTTCTACATATTTGCACCAAGG + Intronic
1188397168 X:29699178-29699200 TTTTCTCCACAAAAGCAACCAGG + Intronic
1188830626 X:34892454-34892476 TTTTATACATATATGCCACAGGG - Intergenic
1193194085 X:78609459-78609481 TTTTCTACCTCTGTGCAACTGGG - Intergenic
1194432530 X:93827321-93827343 TTTTCTACAAAAATTCATCTGGG + Intergenic
1195197542 X:102514427-102514449 TTATCTATCCATATACAACTAGG + Intronic
1197152815 X:123238581-123238603 TTTACTACAAAGATGCACCTTGG + Intronic
1198977798 X:142356695-142356717 TCTTCTGTACATATGCAAATAGG - Intergenic
1199667946 X:150116745-150116767 TTTTTTAAAAATATGTAACTGGG + Intergenic
1201250364 Y:12051595-12051617 TATTCAACACATATTCAAGTGGG - Intergenic
1201532271 Y:15005019-15005041 TTTTCTCCAGATATGCAAGAAGG - Intergenic