ID: 927615871

View in Genome Browser
Species Human (GRCh38)
Location 2:24594585-24594607
Sequence CTTTTGGTTTGTTGTGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 651
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 611}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927615871 Original CRISPR CTTTTGGTTTGTTGTGCAGA TGG Intronic
900136727 1:1120896-1120918 CTTTTTGTTTGTTTTTGAGACGG - Intergenic
900675626 1:3883928-3883950 GTTTTGTTTTGTTTTGTAGATGG + Exonic
901015586 1:6227993-6228015 CTTTTTGTTTTTTGTAGAGATGG - Intronic
901021656 1:6259088-6259110 TTTTTTATTTGTTGTACAGATGG - Intronic
901581727 1:10249979-10250001 CTTTTTATTTTTTGTGGAGATGG + Intronic
902468976 1:16635040-16635062 CTTTTTGTTTCTTTTTCAGATGG + Intergenic
903091109 1:20918377-20918399 TTTTTGTTTTTTTGTACAGATGG + Intronic
903488233 1:23707421-23707443 CTTTTGTTTTGTTTTTGAGATGG - Intergenic
903547919 1:24138420-24138442 CTTTATGTTTCTTTTGCAGAGGG - Intronic
903609431 1:24599580-24599602 TTTTTGGTTTGTTTTTGAGAAGG + Intronic
904739197 1:32659558-32659580 CTTTTGTTTTGTTTTTGAGACGG - Intronic
904902915 1:33871619-33871641 CTTTTGTTTTGTTTTTGAGATGG + Intronic
905637679 1:39565821-39565843 GTTTTGTTTTGTTTTGGAGATGG - Intronic
906385895 1:45368377-45368399 CTTTTGTTTTGTTTTTCAGACGG + Intronic
906637949 1:47422303-47422325 GTTTTGTTTTGTTTTGTAGATGG - Intergenic
906643854 1:47458690-47458712 CTCTTGGATAGTTATGCAGAGGG + Intergenic
906786187 1:48618065-48618087 CTATTGTTTTGTTTTACAGATGG - Intronic
907181007 1:52570125-52570147 GTTTTGTTTTGTTTTGGAGACGG + Intergenic
907327330 1:53647519-53647541 TTTTATGTTTGGTGTGCAGAAGG - Intronic
907604127 1:55799444-55799466 TTTTTTTTTTGCTGTGCAGAAGG + Intergenic
907674195 1:56503673-56503695 TTTTTGGTTTTTTTTGGAGATGG - Intronic
909656748 1:78041461-78041483 CTTTTGATTTTTTGTGGAGATGG - Intronic
910095263 1:83514478-83514500 TTTTTTGTTTCATGTGCAGATGG + Intergenic
910138675 1:84001288-84001310 CTTATGATTTGTGGTGCGGATGG + Intergenic
910205005 1:84741289-84741311 CTTTTGATTTTTTGTGGAGACGG + Intergenic
910396689 1:86800996-86801018 GTTTTGTTTTGTTTTGCTGATGG + Intergenic
910768720 1:90809380-90809402 CTTTTTGCTTGTTGTGCAAATGG + Intergenic
911716318 1:101137541-101137563 GTTTTGTTTTGTTTTGCAGAGGG + Intergenic
911938664 1:104013590-104013612 TGTTTTCTTTGTTGTGCAGAAGG + Intergenic
913367105 1:118050913-118050935 TGTTTTCTTTGTTGTGCAGAAGG - Intronic
915298542 1:154938887-154938909 CTTTTGTTTCTTTATGCAGACGG + Intergenic
915959089 1:160249183-160249205 TTTTTGGTTTGTTTTTGAGATGG - Intronic
917213865 1:172658123-172658145 CTTTTTTTTTTTTGTACAGATGG - Intergenic
917497796 1:175557117-175557139 CTTCTGGCTTGTTGGGCTGAAGG - Intronic
917727625 1:177842487-177842509 CTTTTGGGTTGATGTGGAGCTGG - Intergenic
917806926 1:178622222-178622244 TTTTTGTTTTGTTTTGGAGATGG + Intergenic
917865783 1:179193734-179193756 TTTTTGGTTTTTTTTGGAGACGG + Intronic
918799089 1:188948417-188948439 GTTTTGTTTTGTTTTGCAAAAGG - Intergenic
918956121 1:191210030-191210052 ATTTTTGTTTTTTGTGGAGATGG - Intergenic
919077326 1:192829569-192829591 AGTTTGTTTTGCTGTGCAGAAGG - Intergenic
920282172 1:204852493-204852515 GTTTTGTTTTGTTTTTCAGACGG - Intronic
920397259 1:205656321-205656343 CTTTTTATTTTTTGTGGAGATGG + Intergenic
920561678 1:206943211-206943233 CTCTTGGGTTGTTGTGCTGATGG - Intronic
920592859 1:207238749-207238771 TGTTTTGTTTGCTGTGCAGAAGG - Intergenic
922263665 1:223964534-223964556 TTTTTGTTTTGTTGTAGAGATGG - Intergenic
922707916 1:227800023-227800045 CTTTTTGTTTGTTTTTGAGATGG + Intergenic
923551581 1:234968487-234968509 CTTTTTTTTTGTTTTTCAGATGG - Intergenic
924051637 1:240085335-240085357 GTTTTGTTTTGTTTTGGAGACGG - Intronic
924492381 1:244551377-244551399 TTTTTGGTTAGTTTTCCAGAAGG - Intronic
1062766960 10:73637-73659 GTTTTGTTTTGTTTTGGAGACGG - Intergenic
1063037684 10:2303257-2303279 CTTTTGGTATCTTGAGCAGGAGG + Intergenic
1063591885 10:7403167-7403189 CTTTTTGTTTTTCGTTCAGATGG - Intronic
1064062399 10:12149092-12149114 TTTTTGGTTTGTTTTTGAGATGG + Intronic
1064172443 10:13046084-13046106 GTTTTGTTTTGTTTTGGAGATGG - Intronic
1064632161 10:17327579-17327601 GTTTTGTTTTGTTTTGGAGACGG - Intronic
1064674963 10:17751247-17751269 TTTTTCGTTTTTTGTGCAGATGG + Intergenic
1065919663 10:30381450-30381472 CTTGTGCTTTGCTCTGCAGATGG + Intergenic
1066466420 10:35654257-35654279 ATTTTGCTTTGTTTTTCAGACGG + Intergenic
1066796231 10:39124461-39124483 GTTTTGGTTTTTTGTAGAGATGG - Intergenic
1069227385 10:65960518-65960540 CTTTTTTTTTGTTGTTGAGACGG - Intronic
1070187504 10:74079328-74079350 TTTTTGGTTTGTTTTTCAGGGGG - Intronic
1070437823 10:76410939-76410961 GTTTTGTTTTGTTTTGGAGATGG - Intronic
1071003630 10:80858738-80858760 CTTTTGTTTTGTTGTGGGGAAGG - Intergenic
1071557109 10:86612986-86613008 TTTTTGGATTTTTGTGGAGACGG + Intergenic
1071947604 10:90664209-90664231 CGTTTTCTTTGCTGTGCAGAAGG - Intergenic
1072065419 10:91865040-91865062 CTTTTTGTTTGTTGGGAAGTTGG + Exonic
1072701436 10:97644344-97644366 CTTTTGTTTTGTTTTTGAGACGG - Intronic
1072825581 10:98603061-98603083 CTTTTTATTTATTGTTCAGAAGG - Intronic
1073255847 10:102150822-102150844 TTTTTGTTTTGTTTTGGAGATGG + Intergenic
1073334108 10:102692418-102692440 CTTTTGTTTTTTTGTTGAGACGG + Intronic
1073359295 10:102884548-102884570 CTTTTTGTTTGTTTTTGAGATGG + Intronic
1073553555 10:104426231-104426253 GTTTTGTTTTGTTTTTCAGATGG - Intronic
1073713867 10:106079332-106079354 TTTGTGGTTTGTGGTGCTGATGG - Intergenic
1075107764 10:119553268-119553290 ATTTTGTTTTGTTTTTCAGATGG + Intergenic
1075149502 10:119914154-119914176 GTTTTGTTTTGTTTTGGAGATGG - Intronic
1075307150 10:121378118-121378140 CATTTTGTTTGTTGCCCAGAGGG - Intergenic
1075314792 10:121444073-121444095 CTTTTTGTTTGTTTTTGAGATGG - Intergenic
1076356807 10:129859222-129859244 CTTTTTTTTTGTTTTGGAGATGG + Intronic
1077240131 11:1506478-1506500 CTTTTGATTTGTGTTGCCGATGG - Intergenic
1077593236 11:3509069-3509091 CTTTTTGTTTGTTTTTGAGATGG - Intergenic
1077620320 11:3716044-3716066 CTTGTCTTTTGCTGTGCAGAAGG + Intronic
1077640075 11:3873445-3873467 CTTTTTTTTTTTTGTGGAGATGG + Intronic
1078608539 11:12798922-12798944 CTTTTGTTTTGTTTTCCAGGTGG - Intronic
1078792451 11:14558240-14558262 TTTTTTTTTTTTTGTGCAGATGG - Intronic
1079815675 11:25054222-25054244 CTTTTTGCTTGTTGTGAAGGTGG + Intronic
1079976567 11:27099068-27099090 CTTTTGTTGTCTTGTTCAGATGG - Intronic
1082020465 11:47528709-47528731 CTTTTGTTTTTTTGTGGAGATGG - Intronic
1082102121 11:48181384-48181406 CTTTTGTTTTGTTTTTGAGACGG + Intergenic
1083565101 11:63707831-63707853 CTTTTGTTTTGTTTTTGAGACGG - Intronic
1083848673 11:65352492-65352514 CTTTTGGTTTTGTGGGGAGAGGG + Exonic
1084199691 11:67547832-67547854 TTGTTTGTTTGTTTTGCAGATGG + Intergenic
1084249072 11:67881787-67881809 CTTTTTGTTTGTTTTTGAGATGG - Intergenic
1084540521 11:69783433-69783455 CTTTTTGTTTTTTGTAGAGATGG + Intergenic
1084823740 11:71713683-71713705 CTTTTTGTTTGTTTTTGAGATGG + Intergenic
1085210952 11:74777796-74777818 TTTTTAATTTTTTGTGCAGATGG + Intronic
1085656492 11:78320042-78320064 CTTTTGCATTTTTGTGGAGATGG + Intronic
1086093814 11:83030625-83030647 CTTTTGTTTTTTAGTGGAGATGG - Intronic
1086457272 11:86971791-86971813 CTTTTTCTTTTTTGTGCAGATGG + Intergenic
1086592508 11:88532896-88532918 TTTTAGGTATGTTTTGCAGATGG - Intronic
1087483231 11:98728655-98728677 TGTTTCCTTTGTTGTGCAGAAGG - Intergenic
1087720686 11:101662195-101662217 ATTGTGGTTTGCTGTACAGATGG + Intronic
1088256777 11:107910734-107910756 GTTTTGTTTTGTTTTGGAGATGG + Intronic
1088278436 11:108113498-108113520 TTTTTGTTTTGTTTTTCAGACGG - Intergenic
1088350248 11:108879007-108879029 TTTTTGTTTTGTTTTGGAGACGG + Intronic
1088648045 11:111933130-111933152 CTTTTGGTTTTTTTTTGAGACGG + Intronic
1089052058 11:115554356-115554378 TTTATGATTTGTTGTGGAGATGG + Intergenic
1089731362 11:120521241-120521263 ATTTTGATTTTTTGTGGAGATGG + Intronic
1090454120 11:126832849-126832871 GTTTCTGTTTGGTGTGCAGACGG + Intronic
1090925943 11:131250613-131250635 TTTTTGTTTTATTATGCAGAAGG - Intergenic
1091017080 11:132061413-132061435 TTTTAGGTTTCTTGTGAAGAAGG + Intronic
1092419358 12:8317209-8317231 CTTTTTGTTTGTTTTTCAGATGG - Intergenic
1092639372 12:10486825-10486847 AGTTTGTTTTGCTGTGCAGAAGG - Intergenic
1093739675 12:22669797-22669819 CTTTTTGTTTTTTGTAGAGACGG - Intronic
1094202701 12:27809668-27809690 CTTTTGATTTTTTGTAGAGATGG + Intergenic
1096439258 12:51625626-51625648 CTTTTGTTTTTTTGGACAGAGGG + Intronic
1096740068 12:53686714-53686736 CTGTTGGCCTGTAGTGCAGATGG - Intergenic
1096806800 12:54145852-54145874 CAGTTGGTTTGGTGTGGAGAAGG - Intergenic
1097009487 12:55942032-55942054 ATTTTGGTGTGTGGTGGAGACGG + Exonic
1097120623 12:56728806-56728828 GTTTTATTTTGTTGTGGAGACGG - Intronic
1097466685 12:59934675-59934697 GTTTTTCTTTGCTGTGCAGAAGG - Intergenic
1097792855 12:63833004-63833026 GTTTTGTTTTGTTGTTGAGATGG - Intergenic
1098248413 12:68544088-68544110 CCTTTTGTTTAATGTGCAGATGG - Intergenic
1098267267 12:68735212-68735234 CCTTGTGTTTGTTTTGCAGATGG + Exonic
1098316598 12:69199723-69199745 CTTTTGGGCTGTTCTGCATATGG - Intergenic
1098884905 12:75951068-75951090 TTTTTGTTTTGTTTTGGAGACGG + Intergenic
1098889100 12:75990569-75990591 CTTTTTGTTTGATTTGGAGAAGG - Intergenic
1101545379 12:105707318-105707340 GTTTTGTTTTGTTTTGCAGAGGG + Intergenic
1101808007 12:108081811-108081833 CTTTTGGGCTGCTGTGAAGATGG - Intergenic
1102109027 12:110349951-110349973 GTCTTGGTTAGTGGTGCAGAGGG - Intronic
1102284474 12:111644450-111644472 CTTTTAGCTTGTTCTGCAGGAGG + Exonic
1102370131 12:112376249-112376271 TTTTTGTTTTGTTTTGGAGATGG + Intronic
1102542708 12:113634183-113634205 CTTATTGGTTGTTGTGAAGAGGG + Intergenic
1102966245 12:117129948-117129970 CTTTTGTTTTGTTTTTGAGACGG + Intergenic
1103385551 12:120529451-120529473 CTCTTGTTGTCTTGTGCAGAAGG + Intronic
1104026653 12:125032451-125032473 TTTTTTGTTTGTTTTTCAGACGG - Intergenic
1104209391 12:126673035-126673057 TGTTTGTTTTGCTGTGCAGAAGG + Intergenic
1104325529 12:127792748-127792770 CTTTTTTTTTTTTGTGGAGATGG - Intergenic
1104631226 12:130404302-130404324 CTTTTTGTTTGTTTTTGAGACGG + Intronic
1105035426 12:132917020-132917042 CTTTTGTTTTGTTTTAGAGATGG + Intronic
1105225325 13:18426333-18426355 CTTTTGGTTTGTGGGGTAAAGGG + Intergenic
1105524753 13:21166724-21166746 GTTTTGTTTTGTTTTTCAGATGG - Intronic
1105570879 13:21602098-21602120 CTTTTTTTTTGTTGTTGAGATGG - Intronic
1106883916 13:34162011-34162033 CTTTTGGTTTATACTGTAGAGGG + Intergenic
1107114859 13:36735565-36735587 CTTTGTGTTTGTAGTACAGAGGG + Intergenic
1107463122 13:40624163-40624185 CTTTTGGCTTCTTCTGCAGAGGG - Intronic
1107546436 13:41437807-41437829 CTTTTGTTTTGTTTTTCAGATGG - Intergenic
1108077531 13:46696896-46696918 CTTTTGTTTTTTTGTAGAGATGG - Intronic
1109153409 13:58873485-58873507 GTTTTGTTTTGTTTTGGAGATGG + Intergenic
1109676220 13:65677926-65677948 GTTTTGGGTTGTCTTGCAGAGGG + Intergenic
1110223874 13:73099422-73099444 GTTTTGTTTTGTTTTGGAGATGG - Intergenic
1110717807 13:78727720-78727742 CTTTTGTTTTGTTTTGGGGATGG - Intergenic
1110848163 13:80213318-80213340 TTTTTGATTTTTTGTGGAGATGG - Intergenic
1110923766 13:81123957-81123979 ATGTTTATTTGTTGTGCAGAAGG + Intergenic
1111067764 13:83120260-83120282 ATTGTGGTATGTTGTACAGATGG + Intergenic
1111124594 13:83898098-83898120 CTTTTGTTTTGTTTTTGAGACGG + Intergenic
1111256721 13:85679296-85679318 GTTTTGTTTTGTTTTGGAGATGG + Intergenic
1112080483 13:95964476-95964498 TTTTTCCTTTGCTGTGCAGAAGG - Intronic
1113935719 13:113994661-113994683 ATTTTGGTTTTTTGTAGAGACGG - Intronic
1114009793 14:18354681-18354703 CTTTTGGTTTGTGGGGTAAATGG + Intergenic
1114675003 14:24434408-24434430 TTTTTGGTTTGTTTTTGAGACGG + Intronic
1116082127 14:40187324-40187346 GTTTTGTTTTGTTTTGGAGACGG - Intergenic
1116406727 14:44575428-44575450 TTTTTGTTTTGTTTTTCAGATGG - Intergenic
1116752426 14:48903053-48903075 CTTTTGTTTTGTTTTTGAGATGG - Intergenic
1116835266 14:49764126-49764148 CTTTTTGTTTGTTGTTAGGATGG + Intergenic
1117079964 14:52141747-52141769 GTTTTGTTTTGTTTTGGAGACGG + Intergenic
1117483656 14:56172769-56172791 TTTTTGCTTTGTTTTGAAGATGG + Intronic
1117745764 14:58867818-58867840 CTTTTAGTTTGTTGTAAAGATGG + Intergenic
1120053397 14:79894858-79894880 CTTTTGTATTTTTGTGGAGATGG + Intergenic
1121020946 14:90579782-90579804 GTTTTGTTTTGTTTTTCAGACGG - Intronic
1121295221 14:92815411-92815433 CTTTTAGTTTGTAAGGCAGAGGG + Intronic
1121762233 14:96455564-96455586 TTTCTGGTTTGGTGTGCAAAGGG - Intronic
1121772096 14:96554958-96554980 CTTTTGGTTGGTTGTTAAGTAGG + Intronic
1124231670 15:27951592-27951614 CTTTTGGTTTCCTGGGCAGGAGG - Intronic
1124916749 15:33982822-33982844 CTTTAGGGGTGTTGTCCAGATGG - Intronic
1126504482 15:49388656-49388678 TATTTCTTTTGTTGTGCAGAAGG - Intronic
1127802939 15:62493377-62493399 CTGTAGGTTTGTTGTGCGGTGGG + Intronic
1128873943 15:71186654-71186676 CATTTGCTTTGTCCTGCAGATGG + Intronic
1128890445 15:71327160-71327182 TTTTTGTTTTGTTTTTCAGATGG - Intronic
1129370481 15:75090629-75090651 GTTTTGTTTTGTTTTTCAGATGG + Intronic
1129789345 15:78330523-78330545 CTGTTCGTTTATTGTACAGAAGG - Intergenic
1130119332 15:81033687-81033709 CTTTTCCTTTTCTGTGCAGAAGG + Intronic
1130267066 15:82415988-82416010 CTTTTTCTTTTTTGTTCAGATGG - Intergenic
1130585788 15:85180812-85180834 CTTGTGCTTTGCTCTGCAGATGG - Intergenic
1131187096 15:90283976-90283998 CTTGTGCTTTGCTTTGCAGATGG - Intronic
1131912476 15:97223731-97223753 TATTTGATTTGTTGTGGAGAGGG - Intergenic
1132532079 16:456750-456772 TTTTTTGTTTGTTGTTGAGATGG - Intronic
1132890536 16:2202128-2202150 CTTTTGTTTTGTTTTTCAGACGG - Intergenic
1133151446 16:3835152-3835174 GTTTTGTTTTGTTTTGGAGAAGG - Intronic
1133280396 16:4661824-4661846 CTTGTGGTTTGTTCAGCAGATGG + Intronic
1133968385 16:10548330-10548352 CTTTTGCTTTGTTATGAAGTAGG - Intronic
1134204992 16:12229960-12229982 TTTTGGCTTTGTTGTCCAGATGG + Intronic
1134219392 16:12341777-12341799 CTTGTGCCCTGTTGTGCAGAGGG + Intronic
1134784560 16:16929920-16929942 CTTTAGATTTGTAGTCCAGAGGG + Intergenic
1134875353 16:17693306-17693328 CTTTTGGTTTGTTTTGGATGAGG - Intergenic
1135333753 16:21583665-21583687 GTTTTGTTTTGTTTTGGAGATGG - Intergenic
1135653814 16:24230027-24230049 CCTTAGGTTTGTTGTGGGGATGG + Intergenic
1136399156 16:30008510-30008532 CTTTTGTTTTGTTTTTGAGATGG + Intronic
1137487230 16:48901782-48901804 CCTCTGGTTTGTTGTGATGAAGG - Intergenic
1137780486 16:51094196-51094218 GTTTTGTTTTGTTTTGGAGATGG + Intergenic
1139628185 16:68208711-68208733 TTTTTGGTTTGTTTTTGAGACGG - Intronic
1139719122 16:68838656-68838678 TTTTTGTTTTGTTTTGGAGATGG - Intergenic
1140641234 16:76975868-76975890 CTTTTGTTTTGTATTTCAGAAGG + Intergenic
1141407059 16:83804057-83804079 CTATTTGTTTTTTGTGCAGCGGG + Intergenic
1141842938 16:86585990-86586012 CTTTTGGTTTCGTGTTCAAACGG - Intergenic
1141919840 16:87128280-87128302 CTTGTGCTATGTTGTGCATATGG + Intronic
1142054901 16:87987552-87987574 TTTTTATTTTTTTGTGCAGATGG - Intronic
1142372288 16:89689687-89689709 CTTTTTGTTTGTTTTTGAGATGG + Intronic
1143211646 17:5192203-5192225 CTTTTGTTTTGTTTTTGAGATGG + Intergenic
1144275827 17:13667376-13667398 ATTTTGGTTCTTTGTGGAGAAGG - Intergenic
1145374774 17:22337415-22337437 CTTTTGTTTTGTGGTGGAGGTGG + Intergenic
1145449390 17:23223495-23223517 TTTTTGGTTTGTTGTGGAAAAGG + Intergenic
1145513510 17:24156218-24156240 TTTGTGGTTTGTGGTGCAAAAGG + Intergenic
1145555357 17:24765054-24765076 TTTGTGGTTTGTGGTGCAAAAGG + Intergenic
1145599820 17:25412075-25412097 TTTGTGGTTTGTGGTGGAGAAGG + Intergenic
1145614837 17:25630793-25630815 TTTTTGGTTTGTGGTGGAAAAGG + Intergenic
1146010460 17:29190416-29190438 ATTTTGATTTTTTGTGGAGATGG - Intergenic
1146115624 17:30135476-30135498 GTTTTGTTTTGTTTTTCAGACGG + Intronic
1146329907 17:31918269-31918291 CTTTTTTGTTGTTGTGGAGACGG + Intergenic
1147775463 17:42897775-42897797 CTTTTTATTTTTTGTGGAGATGG - Intergenic
1147806833 17:43137868-43137890 GTTTTGTTTTGTTTTGGAGATGG - Intergenic
1148089070 17:45011890-45011912 TTTTTCTTTTTTTGTGCAGATGG - Intergenic
1148230128 17:45927626-45927648 GTTTTGTTTTGTTGTAAAGAGGG - Intronic
1148258075 17:46154450-46154472 CTTGTGGTTTATTGTACAGATGG + Intronic
1148285409 17:46386267-46386289 TTTTTTATTTTTTGTGCAGATGG + Intergenic
1148307572 17:46603867-46603889 TTTTTTATTTTTTGTGCAGATGG + Intronic
1148681650 17:49477608-49477630 ATTTTGGTTCTTTTTGCAGAGGG - Intergenic
1149144526 17:53474385-53474407 GTTTTGTTTTGTTTTGGAGATGG + Intergenic
1150283747 17:63944143-63944165 CTTTTTTTTTGTTGTTGAGATGG + Intronic
1150978269 17:70112984-70113006 ATTCTGGGTTGTTGAGCAGAAGG - Intronic
1151051914 17:70987810-70987832 CTTTTGGTTTGCTAAGAAGAAGG + Intergenic
1151794598 17:76335357-76335379 TTTTTGTTTTGTTTTGGAGATGG + Intronic
1152202557 17:78955614-78955636 CTTTTGTTTTGTTTTTGAGACGG - Intergenic
1152428054 17:80229434-80229456 TTTTTGGTTTTTTTTGGAGACGG + Intronic
1152972466 18:176321-176343 TTTTTGGTTTGTTTTAGAGATGG + Intronic
1154026705 18:10714606-10714628 CTTATAGTTTGTTGTACAGATGG + Intronic
1154528046 18:15313188-15313210 CTTTTGGTTTGTGGGGTAAAGGG - Intergenic
1154961231 18:21310961-21310983 CTTTGGGTTTGGTGAGTAGAGGG + Intronic
1155000354 18:21680016-21680038 CTTTTTGTTTGTTTTTGAGATGG + Intronic
1155334585 18:24751006-24751028 CTTTATGTTTCTGGTGCAGAAGG - Intergenic
1155727626 18:29108378-29108400 CATTTTGTTTGCTGTGCAGAAGG + Intergenic
1158858317 18:61566837-61566859 ATTTTGTTTTGTTTTGCATATGG + Intergenic
1158889900 18:61863091-61863113 CATTTGGTTTGTTTTGGACATGG - Intronic
1159075389 18:63675347-63675369 CTTTTGCTTTGGTTTGCAGAGGG - Intronic
1159219251 18:65438348-65438370 GTTTTGTTTTGTTTTTCAGACGG - Intergenic
1159458971 18:68698031-68698053 TTTTTGTTTTGTTGTGCAACAGG - Exonic
1159552264 18:69907319-69907341 TTTTTTGTTTGTTTTTCAGATGG + Intronic
1160774070 19:846745-846767 CTTTTTGTTTGTTTTTGAGACGG + Intronic
1161369419 19:3902140-3902162 TTTTTGGTTTTTTGTAGAGATGG - Intronic
1161391471 19:4023453-4023475 GTTTTGTTTTGTTTTGGAGATGG - Intronic
1161630503 19:5352797-5352819 TTTTTGGTTTGTTTTTAAGACGG + Intergenic
1161727534 19:5938686-5938708 CTTTTTGTGTGTTTTGGAGACGG - Intronic
1161863658 19:6818122-6818144 CTTTTTATTTTTTGTGGAGATGG + Intronic
1162117427 19:8439372-8439394 GTTTTGTTTTGTTTTGGAGATGG - Intronic
1162357864 19:10197632-10197654 CTTTTTGTTTGTTTTTGAGACGG - Intronic
1162443247 19:10706375-10706397 CTTTTGTTTTGTTTTTGAGACGG + Intronic
1162603054 19:11684405-11684427 CTTTTAGATTTTTGTACAGATGG - Intergenic
1162611808 19:11761226-11761248 CTCTTGCTTTGTTGCCCAGATGG + Intergenic
1163131718 19:15277783-15277805 GTTTTGTTTTGTTTTGGAGACGG - Intronic
1163924931 19:20331404-20331426 GTTTTGTTTTGTTTTGTAGACGG - Intergenic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164134431 19:22400578-22400600 CTATGGGTTTGTAGTGGAGAGGG - Intronic
1164164381 19:22656195-22656217 CTATGGGTTTGTAGTGGAGAGGG + Intronic
1164204835 19:23049545-23049567 CTGTTGGCTGGTTGTGCATACGG + Intergenic
1164245221 19:23422320-23422342 GTTTTGTTTTGTTTTTCAGATGG + Intergenic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164308843 19:24029221-24029243 GTTTTGTTTTGTTTTTCAGATGG - Intergenic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164369202 19:27627413-27627435 CTTTTGGTAGGATTTGCAGAGGG + Intergenic
1164852761 19:31498506-31498528 CTTTCTGTTTGTTTTGCAGGAGG + Intergenic
1165297864 19:34942651-34942673 CTTTTGGTTCCATGTGCAGGTGG - Intronic
1165303284 19:34986701-34986723 CTTTTTATTTTTTGTGGAGATGG - Intergenic
1165837147 19:38765721-38765743 GTTTTGTTTTGTTTTGGAGACGG + Intronic
1166008888 19:39926758-39926780 CTGTTGGTTTGTTCTGGAAAGGG - Intronic
1166024001 19:40063032-40063054 CTTTTTGTTTGTTTTTTAGACGG + Intergenic
1167236302 19:48318066-48318088 CTTTTGTTTTGTTTTTGAGACGG - Intronic
1167355427 19:49000843-49000865 CTTTTTGTTTGTTTTTGAGATGG - Intronic
1168210577 19:54887137-54887159 TTTTTGATTTTTTGTACAGATGG - Intronic
925851398 2:8085666-8085688 GTTTTGCTTTTTTGTTCAGATGG + Intergenic
926210228 2:10863796-10863818 TTTTTGGTTTTTTGTAGAGATGG - Intergenic
926213864 2:10891489-10891511 CACTTGGTGTGGTGTGCAGATGG + Intergenic
926519305 2:13890335-13890357 TTGTTGGTTTGTTTTTCAGAGGG - Intergenic
926723649 2:15981360-15981382 GTTTTGTTTTGTTTTTCAGACGG + Intergenic
927615871 2:24594585-24594607 CTTTTGGTTTGTTGTGCAGATGG + Intronic
927896715 2:26787218-26787240 TTTTTGTTTTGTTTTGGAGACGG + Intronic
927941352 2:27104859-27104881 CTTTTGATTTGTTCTTCAGTGGG - Intronic
927957294 2:27216823-27216845 TTTTTGGTCTGTTGTTCACAGGG + Exonic
928442665 2:31305039-31305061 CTTTGGGTTTTTTGTGCCAAGGG + Intergenic
928523601 2:32116464-32116486 ATTTTGTTTTGTTTTGGAGACGG + Intronic
928538260 2:32260768-32260790 CTTATGTTTTATTATGCAGATGG - Intronic
929002187 2:37358240-37358262 TTTTTGGTTTTTTGTAGAGATGG - Intronic
929298322 2:40272945-40272967 CTTTTGTTTTGTTTTTGAGATGG + Intronic
930934599 2:56932434-56932456 CATTTGGTTTTTTGTGGAGAAGG + Intergenic
931258163 2:60592982-60593004 TATTTCCTTTGTTGTGCAGAAGG - Intergenic
932088219 2:68781383-68781405 CTTTTGGTTTCTTTTTGAGACGG - Intronic
932327604 2:70873407-70873429 TTTTAAGTTTTTTGTGCAGATGG + Intergenic
932556424 2:72828869-72828891 TTTTTGGTTTGTTTTTGAGATGG - Intergenic
932914756 2:75844637-75844659 CTTTTGTTTTGTTTTGCAAATGG + Intergenic
932988145 2:76752540-76752562 CTATTGGTCTGCTGTGCAGGAGG - Intronic
933068232 2:77825770-77825792 TGTTTACTTTGTTGTGCAGAAGG + Intergenic
933233823 2:79841766-79841788 CTTTTCCTTTGCTCTGCAGAGGG - Intronic
933666452 2:84969163-84969185 CATTTGCTTGGTTTTGCAGAGGG - Intergenic
935393072 2:102574297-102574319 TTTTTCCTTTGCTGTGCAGAAGG + Intergenic
935428883 2:102951438-102951460 CTTGTGGTTTGTTGGGCTGCAGG + Intergenic
935861059 2:107330056-107330078 CTTTTGTCTTGCTGTGAAGATGG + Intergenic
936382175 2:111995941-111995963 GTTTTGTTTTGTTTTGGAGATGG - Intronic
937049685 2:118878429-118878451 GGTGTGGTTTGCTGTGCAGATGG - Intergenic
937417818 2:121730849-121730871 TTTGTGGTTTGTTGTGGGGAGGG - Intronic
937642214 2:124226573-124226595 CTTTTTCTTTTTTGTACAGAAGG + Intronic
938231061 2:129659540-129659562 ATTTTTCTTTGTTGTTCAGATGG + Intergenic
938254480 2:129845026-129845048 ATTTTTGTATGTTGTGCAGAGGG + Intergenic
938527149 2:132144647-132144669 CTTTTGGTTTGTGGGGTAAAGGG - Intergenic
938596439 2:132792054-132792076 GTTTTGTTTTGTTTTTCAGATGG + Intronic
938596523 2:132793006-132793028 GTTTTGTTTTGTTTTTCAGACGG + Intronic
938768606 2:134480937-134480959 ATTCTGTTTTGTTTTGCAGATGG - Intronic
939217438 2:139257214-139257236 CTTTTTGTTTGTTTTGCCTATGG - Intergenic
939833815 2:147103897-147103919 TTTTTGGTTTTTTGTAGAGATGG - Intergenic
940730267 2:157381124-157381146 TGTTTCCTTTGTTGTGCAGAAGG - Intergenic
941091975 2:161187254-161187276 TTTTTGTTTTTTTGTACAGATGG - Intronic
941364557 2:164594208-164594230 CCTTTTTTTTGTTGAGCAGAGGG - Intronic
941760738 2:169239999-169240021 CTATTGGGTTGTAGTGAAGAAGG - Intronic
941999323 2:171630386-171630408 TCATTGGTTTGTTATGCAGATGG - Intergenic
942245945 2:174008327-174008349 CCTTAGGTTTGATGTGGAGATGG - Intergenic
942286838 2:174426765-174426787 GTTTTGTTTTGTTTTGGAGATGG - Intronic
942737707 2:179134947-179134969 TTTTTTGTTTGTTTTGGAGATGG + Intronic
943138819 2:183951481-183951503 CTTTTAGTTTTTTGTAGAGATGG + Intergenic
943279205 2:185910059-185910081 GTTTTGTTTTGTTTTTCAGACGG + Intergenic
943639026 2:190338996-190339018 TTTTTAATTTTTTGTGCAGATGG - Intronic
944076644 2:195739985-195740007 GTTTTGTTTTGTTTTGGAGATGG + Intronic
944702204 2:202255826-202255848 TTTTTGGTTTTTTTTGGAGATGG - Intergenic
944785403 2:203065085-203065107 TTTTTTGTTTTTTGTGAAGATGG - Intronic
945280801 2:208033679-208033701 GTTTTGTTTTGTTTTCCAGATGG - Intergenic
945339616 2:208637550-208637572 GTTTTGTTTTGTTTTTCAGATGG - Intronic
945647405 2:212515129-212515151 CTTTTGGTTATGTGTGCATATGG + Intronic
946324651 2:218978922-218978944 ATTTTTGTGTGTTTTGCAGAGGG - Intergenic
946624569 2:221596854-221596876 TTTTTGGTTTGTTTTTGAGATGG + Intergenic
946904429 2:224402669-224402691 GTTTTGTTTTGTTTTGGAGATGG + Intergenic
947848676 2:233266286-233266308 GTTTTTGTTTTTTGTACAGATGG - Intronic
947863055 2:233376154-233376176 CCTTTGGTGTGTAGTGGAGATGG + Intronic
947875167 2:233462867-233462889 CATTTGGTTTGTTGTGCGGCTGG + Intronic
948163134 2:235841456-235841478 CTGTTTATTTGTTGTACAGATGG - Intronic
948310031 2:236978365-236978387 GTTTTGTTTTGTTTTTCAGATGG + Intergenic
948412013 2:237771056-237771078 CTTTTGGTTTGTTGTTAATCAGG + Intronic
1168830576 20:843223-843245 CCTGTGGGTCGTTGTGCAGATGG - Intronic
1169096964 20:2909573-2909595 GTTTTGGTTTTTTTTGGAGATGG - Intronic
1169434801 20:5577028-5577050 CTTTTTTTTTGTTGTTGAGATGG - Intronic
1170411984 20:16101970-16101992 GTTTTGTTTTGTTTTGGAGATGG - Intergenic
1171766363 20:29284410-29284432 CTTTTTGTGTTATGTGCAGAGGG - Intergenic
1171956499 20:31467921-31467943 CTTTTTGTTTTTTGTAGAGATGG + Intronic
1172473295 20:35217229-35217251 CTTTTTGTTTGTTTTTAAGATGG - Intergenic
1172556264 20:35844105-35844127 TTTTTGGTTTGTTTTTGAGACGG + Intronic
1174240763 20:49132753-49132775 GTTTTGTTTTGTTTTGGAGATGG - Intronic
1174608106 20:51776029-51776051 CTTTTATTTTTTTGTACAGACGG - Intergenic
1175196465 20:57246982-57247004 CTTTTGGTTTTTTTTTGAGATGG - Intronic
1175315850 20:58046013-58046035 CTCTGGGGTTGTTGTGAAGATGG + Intergenic
1176054499 20:63136617-63136639 CTTTTGGTTTGTCTAACAGATGG - Intergenic
1177356528 21:20015194-20015216 CTTTTGCTTCCTTGTGAAGAAGG + Intergenic
1177386666 21:20418148-20418170 ATTTTTTTTTGTTGTGGAGAGGG - Intergenic
1177698285 21:24602729-24602751 CTTTTTGTTTGTTTTTAAGATGG + Intergenic
1178225087 21:30707306-30707328 GTTTTGTTTTGTTTTTCAGACGG - Intergenic
1178532430 21:33386644-33386666 TTTTTGGTTTGTTTTTAAGATGG + Intergenic
1178891240 21:36522734-36522756 CTTTGGCTTTTTTGTGCTGAAGG + Intronic
1178981557 21:37268969-37268991 GTTTTGTTTTGTTGTTGAGACGG + Intergenic
1179136927 21:38687845-38687867 CTCTTCCTTTGTTCTGCAGATGG - Intergenic
1179424567 21:41264811-41264833 CTTTTGATTTTTTGTGGACAGGG - Intronic
1179609870 21:42543414-42543436 CTTCTGTTTTGTTGTGCTGCAGG + Exonic
1179634474 21:42698590-42698612 CTTTTGCTCTGTTGAGCTGATGG - Intronic
1180434293 22:15285490-15285512 CTTTTGGTTTGTGGGGTAAATGG + Intergenic
1180516480 22:16149300-16149322 CTTTTGGTTTGTGGGGTAAAGGG + Intergenic
1180740846 22:18052359-18052381 TTTTTGGTTTTTTTTGGAGATGG - Intergenic
1180792453 22:18583371-18583393 TTTTTTTTTTTTTGTGCAGATGG + Intergenic
1181229285 22:21411944-21411966 TTTTTTTTTTTTTGTGCAGATGG - Intergenic
1181249366 22:21522919-21522941 TTTTTTTTTTTTTGTGCAGATGG + Intergenic
1181796442 22:25314988-25315010 TTTTTTGTTTGTTTTTCAGATGG - Intergenic
1182062855 22:27410377-27410399 GTATTGGTTTGTTGAGCAGGTGG - Intergenic
1182488712 22:30655259-30655281 GTTTTGCTATGTTGTCCAGATGG - Intronic
1182926300 22:34128635-34128657 CTTTTGGTTATTTGTGTACATGG + Intergenic
1182945977 22:34322433-34322455 TTTTTTGTTTGTTTTGGAGACGG - Intergenic
1183161746 22:36118311-36118333 TTTTTGGTTTGTTTTTCTGAGGG + Intergenic
1183554028 22:38511127-38511149 CTGTTTGTTTGTTTTACAGATGG - Intergenic
1184055974 22:42049683-42049705 GTTTTGTTTTGTTTTGGAGACGG - Intronic
1184068663 22:42135304-42135326 CTTTTCTTTTGTTTTGGAGATGG + Intergenic
949122499 3:403540-403562 TTTTTGTTTTGTTGTTGAGATGG - Intronic
949652871 3:6181007-6181029 ATTTTGTTTTGTTTTGGAGAGGG + Intergenic
949703991 3:6794261-6794283 CTTTTGTTTTGTTTTTGAGATGG - Intronic
949958760 3:9293510-9293532 AGTTTCTTTTGTTGTGCAGAAGG - Intronic
950837613 3:15935819-15935841 GTTTTGTTTTGTTTTGTAGAGGG + Intergenic
951207356 3:19938909-19938931 CTTTTGTTTTGTTTTTGAGAAGG + Intronic
951468210 3:23025519-23025541 CATTTCTTTTGCTGTGCAGAAGG - Intergenic
953155092 3:40362812-40362834 CTGTTGGTTGCTTTTGCAGAGGG + Intergenic
953808643 3:46093383-46093405 GTTTTGGGGTGTTGTTCAGATGG + Intergenic
954019762 3:47728898-47728920 TTTTTGTTTTGTTTTGAAGATGG - Intronic
954093071 3:48301040-48301062 CTTTTTTTTTGTTTTGGAGACGG - Intronic
955336581 3:58091477-58091499 CTTTTGTTTTGTTTTGCCTAGGG - Intronic
955693169 3:61609685-61609707 TTTTTGGTATTTTGTGTAGAGGG - Intronic
957866071 3:86025058-86025080 GTTTTGTTTTGTTTTGGAGACGG + Intronic
958837993 3:99169605-99169627 AGTTTCTTTTGTTGTGCAGAAGG + Intergenic
959029617 3:101283022-101283044 CTTTTTGTTTGTTTTTGAGATGG + Intronic
959060448 3:101611783-101611805 GTTTTGTTTTGTTTTTCAGATGG + Intergenic
959698440 3:109274593-109274615 TTTTTGTTTTTTTGTGCAGATGG - Intergenic
960020110 3:112940341-112940363 TTATTGTTTTGCTGTGCAGAAGG - Intronic
960642115 3:119835407-119835429 CTTTTGGTTTGTGTCGAAGATGG - Intronic
961113697 3:124309554-124309576 CTTTTTGTTTGTTTTAAAGATGG - Intronic
961761206 3:129169280-129169302 GTTTTGTTTTGTTTTGGAGACGG - Intergenic
961897042 3:130176405-130176427 CTTTTTGTTTGTTTTTCAGATGG - Intergenic
962780007 3:138704959-138704981 CTTTTTGTTTGTTTTTGAGATGG + Intronic
963046069 3:141103603-141103625 TTTGTGGTTTGTTGTGCGGAGGG - Intronic
964165583 3:153700997-153701019 CATTTGGATTGATGTGCAGAAGG - Intergenic
964289045 3:155155165-155155187 GTTTTGTTTTGTTTTCCAGAGGG + Intronic
964306944 3:155351588-155351610 GTTTTGTTTTGTTTTGTAGATGG - Intergenic
964851763 3:161103730-161103752 TTTTTTGTTTGTTTTGGAGATGG + Intronic
964888101 3:161507981-161508003 TCTTTTGTTTGATGTGCAGAGGG + Intergenic
965170765 3:165261117-165261139 ATTCTGTTTTGTTGTGCATAGGG + Intergenic
965479652 3:169202168-169202190 CTTTTTGTTTTTTGAGCACATGG - Intronic
965824350 3:172715857-172715879 TTTTTGGTTTTTTTTGGAGATGG + Intergenic
966189234 3:177256681-177256703 TTTTTGGTTTTTTGTAGAGATGG + Intergenic
968000419 3:195201849-195201871 CTCTTGGTTTCCTGTGCGGATGG - Intronic
968119345 3:196113658-196113680 TTTTTGGTATGTGGGGCAGAGGG + Intergenic
970558546 4:17260016-17260038 CTTTGGGGTTGGTGTGCTGATGG - Intergenic
971142247 4:23936861-23936883 CTTTTGTTTTGTTTTTGAGATGG - Intergenic
971624618 4:28902667-28902689 ATTTTGGTTAGTTCAGCAGAGGG + Intergenic
972108740 4:35527463-35527485 TGTTTCGTTTGCTGTGCAGAAGG + Intergenic
973149650 4:46871510-46871532 AGTTTGCTTTGCTGTGCAGAAGG - Intronic
973931267 4:55795072-55795094 GTTTTGTTTTGTTTTGGAGATGG + Intergenic
974377094 4:61092810-61092832 CTTTTGTTTTGTTTTACAGCAGG - Intergenic
974395187 4:61324658-61324680 CTATTTGCTTGTTGAGCAGAAGG - Intronic
974681690 4:65172362-65172384 GTTTTGTTTTGTTTTTCAGACGG - Intergenic
975160307 4:71117174-71117196 ATTTTGCTATGTTGTGCAGGCGG + Intergenic
975168505 4:71205653-71205675 CTTTTGTTTTGTGGTCCATAAGG - Intronic
975312872 4:72923056-72923078 CTTTTTGCTTGTTATGCAAACGG - Intergenic
976441358 4:85079142-85079164 CTTTGGGTATATTGTACAGAAGG - Intergenic
976512552 4:85928460-85928482 GTTTTGTTTTGTTTTGGAGACGG + Intronic
976623973 4:87158246-87158268 CTTTTGGTTTTTTTTTGAGATGG - Intergenic
977444807 4:97117332-97117354 GTTTTCTTTTATTGTGCAGAAGG + Intergenic
978135451 4:105252617-105252639 CTTTCTGTTTGTTCTGCAAATGG - Intronic
978435180 4:108676465-108676487 TTTTTGGTTTGTTTTTGAGACGG + Intergenic
979142240 4:117191627-117191649 TGTTTACTTTGTTGTGCAGAAGG + Intergenic
979991898 4:127384781-127384803 GTTTTCCTTTGCTGTGCAGAAGG - Intergenic
980786829 4:137566845-137566867 GTTTTGTTTTGTTGTAGAGATGG - Intergenic
981109879 4:140923141-140923163 GGTTTGTTTTGCTGTGCAGAAGG - Intronic
981164303 4:141539542-141539564 GTTTTGTTTTGTTTTGTAGATGG + Intergenic
982251379 4:153410484-153410506 CTTTTTGTTTGTTGTGAAGGTGG - Intronic
982761364 4:159288451-159288473 TTTTAAGTTTGTTGTCCAGATGG + Intronic
983763166 4:171439909-171439931 CTTTTGATTTGTTGTTAGGATGG + Intergenic
983792508 4:171814393-171814415 CTGTGCGTTTGTTCTGCAGATGG + Exonic
984803064 4:183732155-183732177 CTTTTTTTTTGTTGTTGAGACGG - Intergenic
984983031 4:185301394-185301416 CCTTTGTTTTGTTTTGGAGACGG + Intronic
985936286 5:3100707-3100729 CTTGTGGTTTTCTGTGAAGACGG - Intergenic
986000049 5:3623283-3623305 CGTTTGGTCTATTGTGAAGAAGG - Intergenic
986929397 5:12798719-12798741 CTTTTGTTTTGTTGTTGAAACGG + Intergenic
988490629 5:31702276-31702298 GTTTTCCTTTGCTGTGCAGATGG + Intronic
989448340 5:41557234-41557256 CATTTCCTTTGCTGTGCAGAAGG + Intergenic
990075943 5:51845840-51845862 CTGTTTGTTTGTTTTGTAGATGG - Intergenic
990567718 5:57046329-57046351 GTTTTGTTTTGTTTTGGAGATGG - Intergenic
991334917 5:65536441-65536463 TTTTTGGTTTTTTGTAGAGATGG - Intronic
991595305 5:68298368-68298390 CTTCTGTTTTGTTTTGCTGAAGG + Exonic
991978629 5:72208971-72208993 CTTTTGGTGTATTGTTCAGTTGG - Exonic
992305555 5:75433689-75433711 TTTTTGATTTGTTGTAGAGATGG + Intronic
992459631 5:76948352-76948374 CATTTCCTTTGCTGTGCAGAAGG - Intergenic
994913932 5:105948381-105948403 GTTTTGTTTTGTTTTTCAGATGG + Intergenic
995115892 5:108478537-108478559 TATTTCTTTTGTTGTGCAGAAGG - Intergenic
996035542 5:118754473-118754495 CTTTTATTTTTTTGTGGAGAGGG - Intergenic
996073687 5:119163591-119163613 GTTTTGTTTTGTTTTGAAGACGG + Intronic
997527501 5:134562757-134562779 GTTTTGTTTTGTTTTTCAGACGG - Intronic
997567505 5:134900670-134900692 CTTTTTGTTTGTTTTTGAGATGG - Exonic
998589465 5:143462014-143462036 CTTTTTTTTTGTTTTTCAGATGG + Intergenic
998865820 5:146500835-146500857 TTTTTGTTTTGTTGTAGAGATGG - Intronic
1001943295 5:175755952-175755974 GTTTTGTTTTGTTTTGGAGATGG - Intergenic
1002326532 5:178413172-178413194 GTTTTGTTTTGTTGTTGAGATGG - Intronic
1002378209 5:178804056-178804078 TTTTTGTATTTTTGTGCAGACGG - Intergenic
1004335075 6:14756959-14756981 CTTTTGTTTTGTTTTTGAGACGG - Intergenic
1004469375 6:15915719-15915741 CTTCAGGTTCTTTGTGCAGACGG + Intergenic
1005522385 6:26612550-26612572 CTTTTTGTTTGTTTTTGAGAGGG + Intergenic
1005623521 6:27642259-27642281 TTTTTTTTTTGCTGTGCAGAAGG - Intergenic
1006229590 6:32571887-32571909 TTTTTGTTTTGTTTTTCAGATGG - Intronic
1006496750 6:34428750-34428772 CTTTTTGTTTGTTTTTGAGACGG - Intergenic
1006681704 6:35801612-35801634 CTTTTTGTTTGTTTTTGAGATGG - Intergenic
1007471261 6:42092071-42092093 ATTTTGTTTTGTTCTGCAGTGGG + Intergenic
1007979340 6:46134517-46134539 TTTTTGGTCTGTTTTGCACATGG + Intronic
1008066513 6:47055132-47055154 AGTTTCTTTTGTTGTGCAGAAGG + Intergenic
1008700186 6:54089632-54089654 CTTTTGTTTTGTTTTTGAGATGG - Intronic
1008806800 6:55439556-55439578 GGTTTGGTTTGTTTTCCAGATGG - Exonic
1009252186 6:61316947-61316969 CTTTTTGTTTATTCTGCAAAGGG + Intergenic
1009924389 6:70102393-70102415 CTCTTGGTTTGTGGTGATGATGG - Intronic
1009930269 6:70169061-70169083 CTTTTTTTTTGTTGGGGAGATGG - Intronic
1010026693 6:71226753-71226775 TTTTTGATTTTCTGTGCAGAGGG + Intergenic
1010231816 6:73541618-73541640 CTTTTTTTTTGTTGTTGAGACGG + Intergenic
1010587846 6:77676352-77676374 TTTTTTATTTGTTGTACAGATGG - Intergenic
1010864293 6:80954438-80954460 CTTTTGGTTCTTTGGACAGAAGG - Intergenic
1011982049 6:93391330-93391352 CTTTTGGTTTGTTTCTTAGATGG - Intronic
1012233714 6:96788781-96788803 TTTTTGGTTTTTTTTGGAGATGG + Intergenic
1012801172 6:103830778-103830800 GTTTTGTTTTGTAGAGCAGAGGG + Intergenic
1012975310 6:105774949-105774971 TTTTTGCTTTGTTTTGCATATGG - Intergenic
1012992626 6:105941426-105941448 TTTTTTGTTTTTTGTGCAGGTGG - Intergenic
1013450280 6:110274095-110274117 CTTTTGTTTTGTTTTTGAGATGG + Intronic
1013951450 6:115787311-115787333 CTTTTGGTTTCTGGTTCAGTAGG + Intergenic
1014464638 6:121740385-121740407 CTTATGTTTTATTATGCAGATGG - Intergenic
1014552536 6:122805627-122805649 TTTTTGTTTTGTTGTTGAGACGG + Intronic
1014657578 6:124127609-124127631 CTGATGGTTTGGTGAGCAGAGGG + Intronic
1014850865 6:126338298-126338320 GTTTTGTTTTGTTCTGTAGAAGG + Intergenic
1015187301 6:130432813-130432835 CTGTAGGATTGTTGTGAAGAGGG - Intronic
1015503664 6:133959484-133959506 TTTTTGTTTTGTTTTGGAGATGG + Intronic
1017462445 6:154664179-154664201 CTTTTTATTTTTTGTACAGATGG + Intergenic
1018278441 6:162158434-162158456 CTTTTGGTTTGTTTTTGAGATGG + Intronic
1018485412 6:164236589-164236611 GTTTTGTTTTGTTTTTCAGACGG - Intergenic
1020121026 7:5503528-5503550 CTTTTTTTTTTTTGTACAGATGG + Intronic
1020121414 7:5506034-5506056 TTTTTGGTTTTTTGTAGAGACGG + Intronic
1020327725 7:6988080-6988102 CTTTTTGTTTGTTTTTGAGATGG - Intergenic
1020898052 7:13967330-13967352 TTTTTGGTTTGTTTTGCTGTGGG - Intronic
1021374758 7:19892446-19892468 TTTTTCCTTTGCTGTGCAGAAGG + Intergenic
1021608957 7:22438077-22438099 CGTTTCTTTTGCTGTGCAGAAGG + Intronic
1021640427 7:22730840-22730862 GTTTTGGTTTTTTGTAGAGATGG - Intronic
1022784862 7:33627870-33627892 CTTTTATTTTTTTGTACAGATGG - Intergenic
1022786056 7:33638286-33638308 CTTTTCGTTTATTTGGCAGATGG + Intergenic
1022958769 7:35404972-35404994 CTTTTGGTTTGTTTTGTTTAAGG - Intergenic
1023156187 7:37254948-37254970 CTTTTGGACTGTTCTGCAGGTGG + Intronic
1023579818 7:41669889-41669911 TTTGTGTTTTATTGTGCAGAAGG + Intergenic
1023632955 7:42181598-42181620 TTTTTTGTTTGTTGTTGAGATGG - Intronic
1024124965 7:46284295-46284317 ATGTTGTTTTGTTGTTCAGATGG - Intergenic
1024133712 7:46384774-46384796 ATTTTTTTTTGTTGTGAAGAAGG + Intergenic
1024853641 7:53750792-53750814 CTTTTTGTTTTGTTTGCAGATGG + Intergenic
1025141418 7:56469805-56469827 CTGTTTGTTTGTTTTTCAGATGG - Intergenic
1025269733 7:57498390-57498412 GTTTTGTTTTGTTTTCCAGATGG + Intergenic
1025535406 7:61941623-61941645 CTTTTGGTTTGATCTGCAAAGGG + Intergenic
1025704683 7:63852320-63852342 TTTTTGTTTTGTTTTGGAGATGG + Intergenic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1026052871 7:66961511-66961533 CTTTTGTTTTGTTTTTGAGACGG + Intergenic
1026346146 7:69475859-69475881 ATTTTTGTTTGTTGTGGAGATGG - Intergenic
1026708345 7:72714910-72714932 TTTTTGGTTTTTTTTGGAGACGG - Intronic
1026915095 7:74115416-74115438 CTTTTGTTTTTTTTTTCAGACGG - Intronic
1027270787 7:76517459-76517481 GTTTTGTTTTGTTTTGGAGACGG - Intergenic
1027320549 7:77007284-77007306 GTTTTGTTTTGTTTTGAAGACGG - Intergenic
1027727190 7:81822401-81822423 TTTTTTTTTTTTTGTGCAGACGG + Intergenic
1028043018 7:86081300-86081322 CTTTTGTTTTGTTTTTGAGATGG + Intergenic
1028208457 7:88044449-88044471 CTTTTTGTTTGTTTTTGAGATGG + Intronic
1028551799 7:92076367-92076389 CATGTGGTTTGTTAAGCAGAAGG - Intronic
1028621783 7:92834862-92834884 CTGGCGCTTTGTTGTGCAGAGGG - Intronic
1028694927 7:93698422-93698444 CTTTTGTTTTGTTTTTAAGATGG + Intronic
1028792412 7:94867604-94867626 TTTTTGGTTTGTTTTTGAGATGG + Intergenic
1029300945 7:99582028-99582050 CTTTTTTTTTGTGGGGCAGAGGG - Intronic
1030153641 7:106430099-106430121 CTTTTGGTTATTTGTTTAGAAGG + Intergenic
1030634187 7:111930055-111930077 GTTTAGGTTTGTTGAGCAAATGG - Intronic
1030647609 7:112080961-112080983 CTTTTATATTGTTGAGCAGATGG - Intronic
1031081268 7:117259287-117259309 CTTGTGGTAGGTTGTACAGAGGG + Intergenic
1032022683 7:128418444-128418466 CTTTTTGTTTGTTTTTGAGATGG - Intergenic
1032548816 7:132765711-132765733 GTTTTGTTTTGTTTTGGAGATGG - Intergenic
1034130265 7:148709910-148709932 CTTTTCATTTTTTGTACAGATGG - Intronic
1034287728 7:149900178-149900200 TTTTTGGTTTGTTTTTGAGATGG + Intergenic
1034328503 7:150260444-150260466 TTTTTTGTTTGTTTTGTAGAGGG + Intronic
1034515519 7:151574762-151574784 TTTTTGGTATGGTGTGCTGATGG - Intronic
1034663402 7:152792741-152792763 TTTTTGGTTTGTTTTTGAGATGG - Intronic
1034764707 7:153708944-153708966 TTTTTTGTTTGTTTTGTAGAGGG - Intergenic
1034778105 7:153850295-153850317 CTGGTGGTTTGTTGGGCTGAGGG + Intergenic
1035209465 7:157317135-157317157 CTTTTGTTTTGTTTTTGAGACGG - Intergenic
1035512342 8:201352-201374 CTTTTGTTTTGTTTTTGAGATGG - Intergenic
1036189398 8:6656621-6656643 CTGTAGGTCTGTTGTGCAAAAGG - Intergenic
1036205366 8:6801790-6801812 CTTTTTGTTTGTTTTGTAGATGG - Intergenic
1036710149 8:11073043-11073065 CTTTTTGTTTGTTTTTGAGATGG - Intronic
1037039088 8:14208620-14208642 CTTTTTTTTTGGTGTGAAGATGG + Intronic
1037478532 8:19281281-19281303 TATTTGTTTTGCTGTGCAGAAGG + Intergenic
1037862948 8:22419187-22419209 GTTTTGTTTTGTTTTGGAGATGG + Intronic
1038343981 8:26715151-26715173 GTTTTGGTTTTTTGGGGAGAGGG - Intergenic
1038367231 8:26948554-26948576 CCTTTGGTTTGTTGGGGAGCTGG - Intergenic
1038550623 8:28465442-28465464 TTTTTATTTTTTTGTGCAGATGG - Intronic
1038590971 8:28837516-28837538 CTTTGGGTTAGTTGTTCAGAAGG + Intronic
1038903726 8:31873552-31873574 GTTTTGTTTTGTTTTTCAGACGG - Intronic
1040039749 8:42903949-42903971 GTTTTGTTTTGTTTTTCAGACGG - Intronic
1041168806 8:55119449-55119471 CTTCTGCTGTGTTGTGTAGAGGG + Intronic
1041294958 8:56346318-56346340 TGTTTCCTTTGTTGTGCAGAAGG + Intergenic
1041494931 8:58475552-58475574 CTTTTCCTTTGCTGTGCAGAAGG + Intergenic
1042091481 8:65164436-65164458 CTTGTGGTGGTTTGTGCAGAAGG + Intergenic
1043159052 8:76822611-76822633 GTTTTTGTTTGTTGTAGAGATGG + Intronic
1043250507 8:78066937-78066959 CTTTTGTTTTGTTTTTGAGACGG - Intergenic
1043492053 8:80759644-80759666 CTTTTGGGTTGTTGGTCTGAGGG - Intronic
1044792922 8:95866122-95866144 GTTTTTGTTTTTTGTGGAGATGG - Intergenic
1045509403 8:102802815-102802837 TATTTTGTTTGCTGTGCAGAAGG - Intergenic
1046166329 8:110441322-110441344 AGTTTCTTTTGTTGTGCAGAAGG - Intergenic
1046392719 8:113597628-113597650 ATATTGCTTTGTTGTGAAGATGG + Intergenic
1046735643 8:117773832-117773854 CTTTTGGTTTTTATTGAAGAAGG - Intergenic
1047361788 8:124175772-124175794 GTTTTGGTTTGTTTTAGAGATGG + Intergenic
1047431129 8:124793231-124793253 ACTTTGTTTTGCTGTGCAGAAGG + Intergenic
1047498399 8:125424969-125424991 GTTTAGTTTTGTTGTGGAGATGG - Intergenic
1048621309 8:136135526-136135548 CTTTATGTTTGGTATGCAGAGGG + Intergenic
1049858388 8:144879560-144879582 CTTTTTGTTTGTTTTAAAGACGG - Exonic
1050326382 9:4501758-4501780 GTTTTGTTTTGTTTTGGAGATGG - Intronic
1050358938 9:4809819-4809841 CTTTTTGTTTGTTTTCAAGATGG + Intronic
1050689222 9:8206358-8206380 CTTTTGTTTCGTTGTTCAGCTGG + Intergenic
1050836883 9:10093123-10093145 CTTTTCTTTTCGTGTGCAGAAGG - Intronic
1050850464 9:10278777-10278799 GTTTTGTTTTGTTTTTCAGATGG + Intronic
1051455534 9:17252736-17252758 TTTTTCTTTTGCTGTGCAGAAGG + Intronic
1053705838 9:40751980-40752002 CTTTTGGTTTGTGGGGTAAAGGG - Intergenic
1054415915 9:64875584-64875606 CTTTTGGTTTGTGGGGTAAAGGG - Intergenic
1055082924 9:72284938-72284960 CTTTTTATTTTTTGTGGAGATGG + Intergenic
1055111664 9:72566192-72566214 TTGTTTGTTTGTTGTGGAGATGG + Intronic
1055588853 9:77788070-77788092 CATTTTGTTTATTTTGCAGAAGG - Intronic
1057270543 9:93648170-93648192 CTGTTGGTTTGTTGGAGAGAAGG + Intronic
1058171303 9:101684282-101684304 TTTTTTTTTTTTTGTGCAGACGG + Intronic
1058335468 9:103822947-103822969 CATTTTGTTTGTTGTATAGATGG + Intergenic
1058581470 9:106462843-106462865 GTTTTGTTTTGTTTTTCAGATGG - Intergenic
1059084459 9:111285007-111285029 CTATTGTTTTCTTGTGAAGATGG - Intergenic
1061333791 9:129915532-129915554 TTTTTGGTTTTTTGTAGAGATGG + Intronic
1061812189 9:133168670-133168692 TTTTTTGTTTGTTTTGGAGATGG - Intergenic
1062181337 9:135192761-135192783 CTTCTGGTTGGTGGCGCAGATGG + Intergenic
1062738287 9:138150680-138150702 GTTTTGTTTTGTTTTGGAGACGG + Intergenic
1185606186 X:1368257-1368279 CTTTTGTTTTGTTGTTGAGATGG - Intronic
1186179110 X:6955389-6955411 CTTTTTGTTTTTTGTAGAGATGG + Intergenic
1186432424 X:9516315-9516337 CTTTTGTTTTATTTTGGAGAAGG - Intronic
1187172455 X:16865212-16865234 TTTTTTGTTTTTTGTGGAGATGG - Intronic
1187478992 X:19638070-19638092 GTTTTGTTTTGTTTTGGAGATGG - Intronic
1188944742 X:36285610-36285632 GTTTTGTTTTGTTTTTCAGATGG + Exonic
1189244919 X:39555885-39555907 TTTTTGTTTTGCTTTGCAGATGG - Intergenic
1189718758 X:43893299-43893321 GTTTTGTTTTGTTTTGCGGAAGG - Intergenic
1190190392 X:48272149-48272171 GTTTTGTTTTGTTTTTCAGATGG - Intronic
1190200400 X:48356005-48356027 CTTTTTGTTTATTTTGTAGACGG - Intronic
1190432598 X:50392393-50392415 ATTCTGGTTTGTGGTGGAGATGG - Exonic
1190659126 X:52638642-52638664 GTTTTGTTTTGTTTTTCAGATGG - Intergenic
1190969143 X:55332094-55332116 TCTTTGGTTTGCTGGGCAGATGG - Intergenic
1191224080 X:58022400-58022422 TTTTTTTTTTGCTGTGCAGAAGG - Intergenic
1191818828 X:65279742-65279764 AGTTTGTTTTGCTGTGCAGAAGG - Intergenic
1192197470 X:69038220-69038242 AGTTTGGTTTGGTGTGCAGTAGG - Intergenic
1192551133 X:72054635-72054657 TTTTTGGTTTGTTGTGCTTTGGG + Intergenic
1192582123 X:72292610-72292632 CTTTTTGTTTTTTGTAGAGATGG + Intronic
1193020567 X:76787935-76787957 CGTTTCTTTTGCTGTGCAGAAGG - Intergenic
1193110264 X:77722348-77722370 TTTTTTTTTTGCTGTGCAGAAGG - Intronic
1193327640 X:80199591-80199613 TTTTTCCTTTGTTGTACAGAAGG + Intergenic
1193456566 X:81738327-81738349 CTTTTCCTTCGCTGTGCAGAAGG + Intergenic
1194225199 X:91247740-91247762 TTTTTCCTTTGCTGTGCAGAAGG + Intergenic
1194768057 X:97865818-97865840 GTTTTGTTTTGTTTTGGAGATGG - Intergenic
1194964450 X:100271385-100271407 AGTTTCTTTTGTTGTGCAGAGGG - Intergenic
1195267357 X:103195717-103195739 CATTTAGTTTGTTGTGCAGATGG - Intergenic
1196247272 X:113414922-113414944 GTTTTTGTGTGTTGTGGAGAGGG + Intergenic
1196514374 X:116552092-116552114 CTTTTGGTATGTTGAGGTGAAGG - Intergenic
1196565655 X:117201623-117201645 CTGTTGTTTTGCTCTGCAGAAGG + Intergenic
1196682102 X:118479736-118479758 ATTTTTATTTTTTGTGCAGAAGG + Intergenic
1197141929 X:123126904-123126926 TTTTTTTTTTGCTGTGCAGAAGG - Intergenic
1197177070 X:123497519-123497541 AGTTTATTTTGTTGTGCAGAAGG + Intergenic
1197798847 X:130328271-130328293 CTGTTTGGTTGTTGTGAAGAAGG - Intergenic
1198683824 X:139207011-139207033 CCTTGGGGTTGTTGTGAAGATGG - Intronic
1199893666 X:152112700-152112722 CTTTTAGTATGTTGTGCTCAAGG + Intergenic
1200561666 Y:4711045-4711067 TTTTTCCTTTGCTGTGCAGAAGG + Intergenic
1200941298 Y:8784597-8784619 GTTTTGATTTTTTGTGGAGAGGG + Intergenic
1202340808 Y:23864305-23864327 CTGAAAGTTTGTTGTGCAGAGGG + Intergenic
1202529958 Y:25805781-25805803 CTGAAAGTTTGTTGTGCAGAGGG - Intergenic