ID: 927615932

View in Genome Browser
Species Human (GRCh38)
Location 2:24595741-24595763
Sequence ACCTCTATGCAGAGGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927615932_927615936 4 Left 927615932 2:24595741-24595763 CCTTGCAGCCTCTGCATAGAGGT 0: 1
1: 0
2: 2
3: 23
4: 214
Right 927615936 2:24595768-24595790 GAGCTCTCAACTAGGCAAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 74
927615932_927615935 -4 Left 927615932 2:24595741-24595763 CCTTGCAGCCTCTGCATAGAGGT 0: 1
1: 0
2: 2
3: 23
4: 214
Right 927615935 2:24595760-24595782 AGGTTATGGAGCTCTCAACTAGG 0: 1
1: 0
2: 0
3: 2
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927615932 Original CRISPR ACCTCTATGCAGAGGCTGCA AGG (reversed) Intronic
900783293 1:4631700-4631722 ACCTCTGAGCAGAGGCTTGATGG - Intergenic
901453017 1:9347652-9347674 ACCACTTTGGAGGGGCTGCATGG + Intronic
902070062 1:13726872-13726894 ACTTCTATTCAGGGGCAGCAAGG + Intronic
903353547 1:22732347-22732369 ACCTGGAGGCAGAGGCAGCAGGG + Intronic
904294469 1:29508952-29508974 ACCTCCATTCAGAGGCAACAGGG + Intergenic
904997867 1:34645232-34645254 ACCTCTCAGAAGAGCCTGCATGG + Intergenic
906156147 1:43615213-43615235 CCCTATAGGCAGAGGCAGCACGG - Intronic
908757221 1:67479964-67479986 ACCACTATGGAGAAGTTGCAAGG + Intergenic
911011598 1:93287130-93287152 ATCTCCAGGCAGAGGCTGCATGG + Intergenic
911293479 1:96085120-96085142 TCCTCTGTGCAGTGGCGGCATGG - Intergenic
912498923 1:110108960-110108982 GCCTCTCTGCAGAGGGAGCAGGG - Intergenic
913441150 1:118899027-118899049 ACCACCATGCAGAAGCAGCAAGG - Exonic
914784183 1:150813518-150813540 AACTCTATGGAAAGGCTGCCTGG - Intronic
915886485 1:159727725-159727747 AGCTCAATCCAGAGTCTGCAAGG - Intergenic
916602340 1:166305341-166305363 ACCTTTCAGCAGAGGCTGGAAGG + Intergenic
917740754 1:177960077-177960099 TCCATTATGCAGAGGCTGCATGG - Intronic
918632339 1:186732619-186732641 ATCTTTATGCTGAGGCTGCCTGG - Intergenic
918670253 1:187205754-187205776 AGATCTCTGCACAGGCTGCAGGG - Intergenic
919277471 1:195439656-195439678 ATGTCCAGGCAGAGGCTGCATGG - Intergenic
920302338 1:204996749-204996771 ACCTCTAGGCTGGGGCTCCAGGG + Intronic
922509712 1:226153970-226153992 AGCCCTATGGAGAGGCTTCATGG + Intronic
923861660 1:237897911-237897933 ACCTATATGCAGGTTCTGCAGGG - Intergenic
924583028 1:245337805-245337827 ACCTTTATGCAGCCACTGCATGG - Intronic
924627034 1:245704148-245704170 TCCTCGATGCGAAGGCTGCAGGG - Intronic
1062813511 10:482782-482804 ATCTCTCTGAAGAGGCTGCCAGG + Intronic
1063221164 10:3969545-3969567 AGCTCTCTGCAGAGGCTGATTGG + Intergenic
1063863704 10:10341161-10341183 ACCTTTCTGGAGAGACTGCATGG - Intergenic
1065356295 10:24845431-24845453 ACCAGGAGGCAGAGGCTGCAGGG - Intergenic
1067844979 10:49712448-49712470 ACCTCAGTCCAGAGGCAGCATGG + Intergenic
1068728006 10:60324906-60324928 ACCTCAATCTAGAGGCTGCTGGG - Intronic
1069708145 10:70472162-70472184 CCCTTTATGAAGATGCTGCAGGG - Intergenic
1070772127 10:79088609-79088631 GGCTTTAAGCAGAGGCTGCAAGG + Intronic
1072712639 10:97726815-97726837 ACCTATAAGCAGAGGATGCTGGG + Intergenic
1073915238 10:108396008-108396030 AACTGTATGCTGAGGCTGCATGG + Intergenic
1074007740 10:109445510-109445532 ACCTGTCTGCTGAGGCTCCAAGG + Intergenic
1074922095 10:118024926-118024948 CCATCTCTGCAGAGGCTTCAAGG + Intronic
1075119491 10:119653937-119653959 ACCTCTGTGCTGAGGTTGCTTGG + Intronic
1075270048 10:121041751-121041773 ACCAAAATGCAGAGGCTACAGGG + Intergenic
1076359324 10:129875809-129875831 TCCTCCAGGCAGAGGCTGCCAGG - Intronic
1080007436 11:27424822-27424844 ACCGGGAGGCAGAGGCTGCAGGG - Intronic
1081018781 11:37916378-37916400 AGCTCTATGGAGAGGCTCAAGGG + Intergenic
1081416740 11:42824380-42824402 ACCTCTATGCTGAGTCTGATAGG - Intergenic
1081827426 11:46070404-46070426 CCCTGGAGGCAGAGGCTGCAGGG - Intronic
1082973933 11:59053829-59053851 ACCTCTATGTTGAGGATGCCTGG - Intergenic
1083362033 11:62116339-62116361 GCCTCTATGAATAGACTGCATGG - Intergenic
1083540277 11:63507421-63507443 ACATCTATGCAGAGCCCTCACGG + Intronic
1083839287 11:65294567-65294589 CCGTTTATGGAGAGGCTGCAGGG - Exonic
1086566837 11:88236681-88236703 GCATCTATGCAAAGGCTGCAAGG - Intergenic
1087009451 11:93499564-93499586 AACTCCATGCAGGGGCTGCTTGG - Intronic
1087487411 11:98773135-98773157 TCGCCTATGCAGAGGCTGCAAGG + Intergenic
1088289596 11:108222288-108222310 TCCTCTCTTCAGAGGCTGCGTGG - Intronic
1088469460 11:110177542-110177564 AGATCTATTCAGAGGCTGAATGG - Intronic
1090196246 11:124818948-124818970 ACCCCTATACAAAGGCTGGAGGG + Intergenic
1091850909 12:3696222-3696244 ACCTTTATGAAAAGGCTGCCGGG + Intronic
1091992798 12:4970189-4970211 ACCTCACTGCAGAGGGGGCATGG - Intergenic
1092010331 12:5104877-5104899 AGCTCCATTCAGAAGCTGCATGG + Intergenic
1093135083 12:15440011-15440033 CCCTGTGTGCAGAGGCTACAGGG + Intronic
1094487891 12:30939326-30939348 ACCACTGTGCTGAAGCTGCAGGG + Intronic
1094829475 12:34293456-34293478 ACCCATATGCAGTGGCTGCTGGG + Intergenic
1096614455 12:52823912-52823934 CGCACTATCCAGAGGCTGCAGGG - Exonic
1097357272 12:58615777-58615799 ACCCCAAGGCAGATGCTGCAGGG + Intronic
1099321418 12:81154922-81154944 ACATCTAAGCAGAGTCTACAAGG - Intronic
1102007813 12:109599629-109599651 GCCTCTTTGCAGAGGAAGCAGGG - Intergenic
1103009943 12:117450317-117450339 ACCTCTGTGCACAGGCTTCAGGG - Intronic
1103842145 12:123873813-123873835 ACCTCTGTGCAATGTCTGCAGGG + Intronic
1105787050 13:23759856-23759878 ACCTCTACACAGTGGCTGCAGGG + Intronic
1105885278 13:24636762-24636784 AGCTCCATGAAGAGGCAGCATGG - Intergenic
1107451959 13:40517780-40517802 ACCTCTATGGAGAGGCTTCAGGG - Intergenic
1107974517 13:45676418-45676440 ACATGAATGCATAGGCTGCAGGG - Intergenic
1109721670 13:66283338-66283360 AAATATAGGCAGAGGCTGCATGG + Intergenic
1109948011 13:69463375-69463397 ACTTCTGTGCAGAGGATGTATGG + Intergenic
1111703737 13:91722302-91722324 ACCACCAGGCTGAGGCTGCAGGG - Intronic
1114079886 14:19194686-19194708 ATCTCTTTCCAGAGGCTGCATGG - Intergenic
1115896210 14:38090595-38090617 ATGTCTAGGCAGAAGCTGCAGGG - Intergenic
1118997392 14:70848940-70848962 ACTTGGAGGCAGAGGCTGCAGGG + Intergenic
1119205995 14:72793907-72793929 ACCTCCATCCAGAAGCAGCAAGG - Intronic
1121877292 14:97464875-97464897 CCCACTATGCAGAGATTGCATGG + Intergenic
1122405110 14:101496272-101496294 AACAGCATGCAGAGGCTGCAGGG + Intergenic
1124800860 15:32831527-32831549 AGGGCTTTGCAGAGGCTGCAGGG + Intronic
1127774296 15:62253428-62253450 AGCTCAAAGCAGGGGCTGCACGG + Intergenic
1128534233 15:68478718-68478740 TCCTCTATCCAGAGGCCTCAAGG + Intergenic
1128625092 15:69193203-69193225 ACCTCCAGGCAGAAGCTGGAGGG + Intronic
1129384584 15:75188889-75188911 AGGTCTGTGCAGGGGCTGCAGGG + Intergenic
1129566136 15:76625317-76625339 ACCCATATGCAGAGGCAGCTGGG + Intronic
1130880037 15:88047003-88047025 ACCGCCCTGCAGAGGCTCCATGG + Intronic
1131317710 15:91354938-91354960 TCCTCTGTTCAGTGGCTGCATGG + Intergenic
1132514949 16:361908-361930 TCCTCTCAGCAGGGGCTGCAAGG - Intergenic
1134292770 16:12915693-12915715 AATACTATGCAGCGGCTGCAAGG + Intronic
1134900915 16:17937020-17937042 CCCCCTATGCAGAAACTGCACGG + Intergenic
1138099866 16:54244052-54244074 ACCTCTCTGATGAGGCTGGAGGG + Intergenic
1138120274 16:54395761-54395783 ACCTGTATTGAGAGGCTGCTGGG + Intergenic
1138211055 16:55163854-55163876 ACCTTCCTGCGGAGGCTGCACGG + Intergenic
1138678137 16:58666559-58666581 CCCTCTTTTCAGAGGCCGCAGGG - Exonic
1141584892 16:85027551-85027573 GCCTCTAAGCAGAGCCAGCAAGG + Intergenic
1142519939 17:497734-497756 ACCTCTCTCAAGAGGCTGCAGGG - Intergenic
1142933477 17:3308322-3308344 TCCCCTCTGCAGAGGCTGCTGGG + Intergenic
1142987257 17:3703658-3703680 ACGTGTCTTCAGAGGCTGCAGGG - Intergenic
1143037109 17:4005610-4005632 CCCTCTGTGCAGGGTCTGCAGGG - Exonic
1146244305 17:31265798-31265820 ATCTCTATGAAGATGGTGCAAGG + Intronic
1146508552 17:33426255-33426277 ACCTTTATGGACAGGCTGCCTGG + Intronic
1146615032 17:34349810-34349832 ATCTCTTGGCAGTGGCTGCATGG + Intergenic
1146628915 17:34456016-34456038 ACCTCCATGCAGTGGATGGAAGG - Intergenic
1146659896 17:34658797-34658819 CCCTGGATGCAGAGGCTACAGGG - Intergenic
1147702958 17:42407398-42407420 ACCCCTATACATAGGCTGCTCGG + Intronic
1148536191 17:48440962-48440984 AACTCTTTGCTGAGGTTGCATGG - Intergenic
1149952866 17:61009834-61009856 CCCTCTGTGCAGAAGCTGCCAGG - Intronic
1150286847 17:63959513-63959535 ACCTCCTGGCAGAGGCTGCGGGG + Intronic
1152616075 17:81338497-81338519 CCCACTGTGCAGAGGCTGCTTGG - Intergenic
1154213123 18:12396767-12396789 ACCTCTCCGCAAGGGCTGCAGGG + Intergenic
1157158258 18:45288505-45288527 ACCTCTATCCAGAAGCTGCCAGG - Intronic
1159129443 18:64264301-64264323 ACATCTATGCAGAGAATGCTTGG - Intergenic
1161853471 19:6750917-6750939 ACCTGGAGGCAGAGGTTGCAGGG + Intronic
1163723557 19:18909994-18910016 ACTCCTGTGCAGAGGCAGCATGG - Intronic
1166158969 19:40937432-40937454 ACGTAAATGCAGAGGCTGCGTGG + Intergenic
1166167916 19:41005354-41005376 ATGTAAATGCAGAGGCTGCATGG + Intronic
1166820446 19:45576145-45576167 ACCGGGATGCAGAGGTTGCAGGG + Intronic
925201175 2:1968764-1968786 CTCTTTAGGCAGAGGCTGCACGG + Intronic
925568473 2:5283123-5283145 TCCTATATGCAGAAGCTGGAAGG + Intergenic
927615932 2:24595741-24595763 ACCTCTATGCAGAGGCTGCAAGG - Intronic
929182529 2:39058278-39058300 ACCTCTGTGAAAAGGCTACAAGG - Intronic
931206264 2:60148915-60148937 AAATCTAAGCAGAGGCAGCATGG + Intergenic
931760642 2:65413647-65413669 ACATCTAAGCATAAGCTGCAGGG + Intronic
932553831 2:72799987-72800009 CCCTGGAGGCAGAGGCTGCAGGG + Intronic
937242501 2:120471373-120471395 GCTTCTCTGGAGAGGCTGCATGG + Intergenic
940899906 2:159117104-159117126 TCCTCTATGCTGAGGGTGAAAGG + Intronic
944542576 2:200767631-200767653 ACCTGTCTGCACAGCCTGCAGGG - Intergenic
945986382 2:216357395-216357417 ACCCAGAGGCAGAGGCTGCAGGG - Intronic
947756803 2:232571935-232571957 ACCTCTACCCAAAGGCTGCAAGG - Intronic
948669187 2:239555894-239555916 ACCTCTATGCAGATACTTAAAGG - Intergenic
1168765376 20:378666-378688 TCCTCTAGGCAGAGGCTGGATGG - Intronic
1168813751 20:722854-722876 ACTTCAATACAGAGCCTGCAGGG + Intergenic
1169251027 20:4061194-4061216 GTGACTATGCAGAGGCTGCAGGG - Intergenic
1170786739 20:19473741-19473763 ACTGCTATGCAGAGGCTGATGGG + Intronic
1170873239 20:20227532-20227554 ACTTCCCTGCAGAAGCTGCAAGG - Intronic
1171406567 20:24915777-24915799 ACCTGTCTGCAGAATCTGCAGGG - Intergenic
1174124083 20:48289853-48289875 CCTCCTCTGCAGAGGCTGCAGGG - Intergenic
1175980856 20:62737933-62737955 AGCTTTACGCAGAGGCTGCAGGG - Intronic
1178449696 21:32685521-32685543 ACCAGAAGGCAGAGGCTGCAGGG + Intronic
1179568208 21:42262200-42262222 ACTTCCTAGCAGAGGCTGCAAGG + Intronic
1180019017 21:45108549-45108571 ACCTGCATGCACAGGCTGCCAGG + Intronic
1180500884 22:15928014-15928036 ATCTCTTTCCAGAGGCTGCATGG + Intergenic
1183751653 22:39724325-39724347 GGCTCCCTGCAGAGGCTGCAAGG - Intergenic
1184294844 22:43516741-43516763 GCCTCTTTCCAGAGGCTGCATGG - Intergenic
1184500770 22:44870299-44870321 ACTTCAGTGCAGAGGCTGCCAGG - Intergenic
952855045 3:37763291-37763313 ACCTTTATTCAGAAGTTGCAGGG + Intronic
958989016 3:100820007-100820029 ACCTATATGCAGAAAATGCAAGG + Intronic
962188293 3:133283266-133283288 ACCTCCATGCATAGGATGCTGGG - Intronic
962355099 3:134686948-134686970 TCCTCCATGCAGAGTCTGAAGGG + Intronic
963224326 3:142846272-142846294 ACCTGCAGGCAGAGGTTGCAGGG - Intronic
963790820 3:149580687-149580709 ACCGGAAGGCAGAGGCTGCAGGG - Intronic
964496229 3:157293212-157293234 GACTCTAAGCAGAGGCAGCAGGG + Intronic
965813659 3:172615377-172615399 ACCACTATGGGGAGGGTGCAGGG - Intergenic
966386254 3:179402470-179402492 ACCTCTTTCAAGAGACTGCATGG - Intronic
968700738 4:2056916-2056938 ACCTCTCTGGCGAGGCTGCCTGG - Intergenic
968919774 4:3516535-3516557 GCCTGTGTGCAGAGGCTGCCAGG + Intronic
969070791 4:4537058-4537080 ACTGCTGTGCAGAGGCAGCAGGG - Intronic
969569791 4:8001660-8001682 CCCTCTATACAGAGGCTGTTAGG - Intronic
970655562 4:18226760-18226782 ACCTTCATGAAGGGGCTGCAGGG - Intergenic
974168686 4:58238107-58238129 TCTTCTATGCAGAAGCTGGAAGG - Intergenic
977579969 4:98714234-98714256 AGAGCAATGCAGAGGCTGCAAGG - Intergenic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
979303123 4:119110252-119110274 ACCTCTATGCAGTGGCTAGTGGG - Intergenic
980964757 4:139510267-139510289 ACCTCGATGCAGCGGCTGGAAGG - Exonic
982154807 4:152508132-152508154 ACCTCCTTGAAGAGGCTTCATGG + Intronic
985002664 4:185501116-185501138 AACGCCATGCAGAGCCTGCAAGG + Intronic
985170063 4:187139190-187139212 CCCACTATGCAGAGGCTGATGGG + Intergenic
985698292 5:1355483-1355505 ACCTTGATGGGGAGGCTGCAGGG - Intergenic
985936531 5:3101801-3101823 AGCTCCATCCAGAGGCTCCAGGG - Intergenic
988140422 5:27232224-27232246 CCCTGGAGGCAGAGGCTGCAAGG - Intergenic
988661310 5:33272391-33272413 TCCTCTATTCAGAGGCTACGTGG - Intergenic
989108373 5:37884925-37884947 TCCTCTCTCCAGAGGCTTCAGGG - Intergenic
991428018 5:66511608-66511630 ACCTAGATGCAGAGGGTGCTGGG - Intergenic
993854178 5:93052417-93052439 ACCTCTATCCATATTCTGCAGGG + Intergenic
994177531 5:96728069-96728091 ACCTCCATGCAGAGGCAGAATGG - Intronic
994264117 5:97694290-97694312 ACCTCTTTGCAGAGTCTGAAGGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
1000627973 5:163561450-163561472 AATTCTATGTAGAGGCTGCCAGG - Intergenic
1002902874 6:1424447-1424469 ACGTCAAGGCAGAGTCTGCAGGG + Intergenic
1003501455 6:6706462-6706484 AGCTCCATGCACAGGCTGAATGG - Intergenic
1003564804 6:7214076-7214098 ACCTCTGTGCAGAGGAAGCCTGG - Intronic
1004490885 6:16114517-16114539 ATATCTATGCAGTGACTGCATGG - Intergenic
1005399475 6:25416878-25416900 ACCTCTATGCAGAGGTTTTGTGG + Intronic
1006015234 6:31075523-31075545 ATCTCTAAGCAGAGGCTGCATGG - Intergenic
1007789624 6:44301589-44301611 AGCTCTAGGCAGAGGTGGCAGGG + Intronic
1007930894 6:45689793-45689815 TCCTGTGTGCAGAGGCTTCAGGG + Intergenic
1008187674 6:48414117-48414139 ACCTTGGTGAAGAGGCTGCAAGG - Intergenic
1009760871 6:68003673-68003695 ACCGCTAGGCAGAAGCTGAAAGG - Intergenic
1011724621 6:90197652-90197674 GCCTCTTTACTGAGGCTGCATGG + Intronic
1017724428 6:157267305-157267327 AGCTCCATGCAGAAGCCGCATGG - Intergenic
1018733307 6:166669292-166669314 CCCTCTATTCACAGGGTGCATGG + Intronic
1018777023 6:167026983-167027005 ACTTCTGTGCAGAAGCTTCATGG + Intronic
1019180775 6:170186333-170186355 ACCTCACTGCAGGGACTGCAGGG + Intergenic
1021451230 7:20785242-20785264 ACCTCTGTGGACGGGCTGCAGGG - Exonic
1022001883 7:26233713-26233735 CCCTGTAGGCAGAGGTTGCAGGG + Intergenic
1022114119 7:27247970-27247992 ACCTCCATGCAATGGCTGCTTGG - Intergenic
1022320670 7:29284897-29284919 ACGTCTCTGAAGAGGCTGCCTGG - Intronic
1024855545 7:53774249-53774271 ACCATAATGCAGAGACTGCAGGG + Intergenic
1026664454 7:72330390-72330412 TCCAGTAAGCAGAGGCTGCAGGG + Intronic
1027233220 7:76283569-76283591 ACCCCTCTGCACAGGCTGCCTGG + Intronic
1029133630 7:98352564-98352586 CCCTGGAGGCAGAGGCTGCAGGG + Intronic
1029299758 7:99571081-99571103 TCCTCTATGCAAAGTATGCAGGG - Intronic
1031137702 7:117902914-117902936 ATTTCACTGCAGAGGCTGCAAGG - Intergenic
1032871982 7:135995807-135995829 ACCTCTATTCAGATGCATCAAGG + Intergenic
1034425990 7:151014275-151014297 ACATCTGTCCAGAGGCTGCAAGG + Exonic
1037538970 8:19854098-19854120 TTCTCTGTGAAGAGGCTGCAGGG + Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038583140 8:28767445-28767467 ACCTTTAAGCTGTGGCTGCACGG - Intergenic
1040581485 8:48702160-48702182 ACTTCTTGGCAGAGGCTGGAAGG + Intergenic
1041851492 8:62398169-62398191 AACTAAAAGCAGAGGCTGCAGGG + Intronic
1044607256 8:94058156-94058178 AGCTCCATGCCGAGGCTGCAAGG - Intergenic
1047715770 8:127593811-127593833 ACCTCTATGCAATGGCCTCAAGG + Intergenic
1048408358 8:134145866-134145888 CCCTCTAAGCACAGGGTGCAGGG + Intergenic
1048985741 8:139733816-139733838 ACCTCTGTTCTGTGGCTGCAAGG + Intronic
1050780790 9:9332029-9332051 CCCTCTCTGCGGAGTCTGCATGG + Intronic
1052835012 9:33243990-33244012 ATCTCTGTGAGGAGGCTGCAGGG - Intronic
1053281861 9:36825727-36825749 ACCTCCAGGCAGAGTCTCCAGGG - Intergenic
1053447188 9:38161986-38162008 ATCTTTGTGCAGAGGCTGCTGGG + Intergenic
1056269909 9:84937222-84937244 ACCTCTATGGAGTGACTGCCGGG + Intronic
1056698459 9:88880550-88880572 ACCTGGATGAAGAGGCTGCAGGG - Intergenic
1057498168 9:95576393-95576415 AGCCATATGAAGAGGCTGCATGG + Intergenic
1059331227 9:113536978-113537000 AGCTCAATGCAGAGGCTCAAGGG - Intronic
1059476509 9:114551876-114551898 TCCACTATGCAGGGGCTGCTTGG + Intergenic
1060428295 9:123525202-123525224 ATTTCTATGGAAAGGCTGCATGG + Intronic
1061064465 9:128268718-128268740 AGCTCAAAGCAGGGGCTGCACGG + Intronic
1061375000 9:130219067-130219089 ACCTCCGGGCAGTGGCTGCACGG + Intronic
1061425779 9:130497642-130497664 CCCTCTTTGCAGGGGCTGCCAGG + Intronic
1061924909 9:133801249-133801271 ACCTCCATGAAGAGCCTGAAAGG + Intronic
1062195709 9:135272771-135272793 GCGTCTCTGCAGAGGCTGCTGGG - Intergenic
1062355877 9:136162091-136162113 GCCTCCAGGCAGAGGCTGCTGGG - Intergenic
1187219717 X:17312217-17312239 AACTGTATGCAAAGCCTGCAAGG + Intergenic
1189820238 X:44863757-44863779 ACCTCTGTGAATAGTCTGCAGGG - Intergenic
1193723776 X:85017375-85017397 AGCTCTGTGCACAGGCTGCCTGG - Intronic
1195000856 X:100641948-100641970 ACGTCTGTGCAGAGGCTCCAGGG + Intergenic
1196168919 X:112565711-112565733 AAATCTATGCAGAGGCTCCCAGG + Intergenic
1197560511 X:128014873-128014895 GCCCCTATGCAGAGGCTCCACGG - Intergenic
1198396852 X:136228015-136228037 ACCTCTGTCCACTGGCTGCAGGG - Intronic
1198852930 X:140984969-140984991 TCCTCATTGCAGAGGTTGCAGGG + Intergenic
1199676185 X:150191118-150191140 CTCTCTGTGCAGAGGCTGCTTGG - Intergenic
1200707919 Y:6458526-6458548 ACCTCCATGAAGATGCTTCACGG - Intergenic
1201026193 Y:9706182-9706204 ACCTCCATGAAGATGCTTCACGG + Intergenic