ID: 927618446

View in Genome Browser
Species Human (GRCh38)
Location 2:24624613-24624635
Sequence GTAGCATTTGAACAAGTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 235}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927618446_927618449 22 Left 927618446 2:24624613-24624635 CCATTTACTTGTTCAAATGCTAC 0: 1
1: 0
2: 0
3: 24
4: 235
Right 927618449 2:24624658-24624680 CAGATACAATTCCTTTCTTAGGG 0: 1
1: 0
2: 0
3: 26
4: 237
927618446_927618448 21 Left 927618446 2:24624613-24624635 CCATTTACTTGTTCAAATGCTAC 0: 1
1: 0
2: 0
3: 24
4: 235
Right 927618448 2:24624657-24624679 GCAGATACAATTCCTTTCTTAGG 0: 1
1: 0
2: 1
3: 16
4: 215
927618446_927618447 -1 Left 927618446 2:24624613-24624635 CCATTTACTTGTTCAAATGCTAC 0: 1
1: 0
2: 0
3: 24
4: 235
Right 927618447 2:24624635-24624657 CTGAGTGTTTTGTTGATGAATGG 0: 1
1: 0
2: 1
3: 39
4: 590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927618446 Original CRISPR GTAGCATTTGAACAAGTAAA TGG (reversed) Intronic
901865859 1:12106324-12106346 GTAGGATTTGACTAAGTGAATGG - Intronic
903505316 1:23830547-23830569 TTAGCATTTGAATCAGTAAAGGG + Intronic
904584806 1:31574382-31574404 GTAGCAGATGGACAGGTAAATGG + Intergenic
906399906 1:45497287-45497309 GTACCAGTTGAGTAAGTAAAAGG - Exonic
907956354 1:59231739-59231761 GTAGCATTGGAATAAAGAAAAGG + Intergenic
908278721 1:62505985-62506007 GCAGGATTTGAATAAGAAAAGGG + Intronic
908284574 1:62581214-62581236 GTAGGAGTTCAATAAGTAAAGGG + Intronic
909786043 1:79615017-79615039 GAAACATTTGAACAAATGAAAGG - Intergenic
910356158 1:86358329-86358351 GTTGCAATAGAACAAATAAAAGG + Intronic
911450926 1:98059567-98059589 GATGCATTTGATCAATTAAAAGG - Intergenic
911502867 1:98710475-98710497 GTAACAGATGGACAAGTAAAAGG + Intronic
911723937 1:101221558-101221580 GTAGCATTTGTAGAGGTAATAGG + Intergenic
912984535 1:114414192-114414214 GTAGCTTTTAAAAAAGAAAAAGG - Intronic
915736732 1:158089962-158089984 GTGGGATTTGAGCAGGTAAAGGG - Intronic
916092992 1:161323456-161323478 GTAGCTTTTCAACTAGAAAATGG + Intronic
916341459 1:163740692-163740714 GTAGCATTTCTATATGTAAATGG - Intergenic
916584267 1:166136608-166136630 AGAGCAGATGAACAAGTAAATGG + Intronic
917690634 1:177464661-177464683 GTAGCACTTTGACTAGTAAATGG + Intergenic
917992832 1:180400646-180400668 TTATAATTTGAAGAAGTAAAAGG - Intronic
918505671 1:185251252-185251274 GTAGCTTTATAAAAAGTAAAAGG - Intronic
919434204 1:197536241-197536263 GTAGGATTAGAACTAGGAAATGG - Intronic
922201856 1:223410328-223410350 GTGGCCTTTTAACAATTAAAAGG + Intergenic
924397627 1:243640220-243640242 GTGTCATTTGAACAAATAACAGG + Intronic
1063147004 10:3304633-3304655 GAAGCCTTTGAATAACTAAAGGG + Intergenic
1063897740 10:10700085-10700107 TTAGCATTTGAACAAGGACAAGG - Intergenic
1065411317 10:25432050-25432072 GTAACATTTAAACAATTAAAAGG + Intronic
1066978682 10:42391811-42391833 GTAGTTTTTGAACAGGTAACAGG + Intergenic
1068412554 10:56676155-56676177 GTACTATTTAAATAAGTAAAGGG + Intergenic
1068878285 10:62021456-62021478 GTAGCATTTGAATATGAAAGAGG + Intronic
1069621782 10:69841756-69841778 GTAGGAATTGACCAGGTAAAGGG + Intronic
1071157847 10:82711650-82711672 GTAGCATTGGAAGAAGTCAGAGG - Intronic
1071591531 10:86878894-86878916 GTATCAATTGGACAATTAAAAGG + Intronic
1071782411 10:88860974-88860996 ATACCATTTTAATAAGTAAAGGG + Intergenic
1074381091 10:112981240-112981262 CTTGAATTTGAGCAAGTAAAGGG + Intronic
1075273120 10:121070236-121070258 CTAGCAGTTTAAGAAGTAAATGG - Intergenic
1076194319 10:128504827-128504849 GTAACATTTGAATAAGTTAAGGG - Intergenic
1078423310 11:11229770-11229792 ACAGCATTAGAACAAGTAGAAGG + Intergenic
1080742136 11:35076247-35076269 GTAGCATTTGTGGAAATAAAGGG + Intergenic
1082881284 11:58040849-58040871 GTAGCATTTGGAAAAGAAGAGGG + Intronic
1084837780 11:71816284-71816306 GTAGCATCTGAACATGCCAAAGG - Intergenic
1086075737 11:82849705-82849727 TTAGCATTTAAATCAGTAAAGGG - Intronic
1086318268 11:85616154-85616176 GTAGTCTTTGAACAAGTGAATGG - Intronic
1086540482 11:87904050-87904072 AAAGCATTTTAACAAGAAAAAGG - Intergenic
1091328321 11:134709551-134709573 GTAGAATTTGAACAGGTAGAGGG + Intergenic
1093044756 12:14430241-14430263 GCAGCATTTGATATAGTAAACGG - Intronic
1093363207 12:18257926-18257948 GTTGTATTTGTACAGGTAAAAGG - Intronic
1093553597 12:20445083-20445105 GCAGTAATTGCACAAGTAAACGG + Intronic
1095568571 12:43655371-43655393 GCAGGATTTGCACAAGTAGAAGG - Intergenic
1097471307 12:59995972-59995994 GTAGAATTTTAACAATTATAAGG - Intergenic
1100412523 12:94335544-94335566 GAAGCACTTGAAAAAATAAAAGG + Intronic
1100653630 12:96617603-96617625 GTAGCACTGGAAAAAGAAAAGGG - Intronic
1101942525 12:109110632-109110654 GTGGAATTTGAACAAGGAAGAGG + Exonic
1104111349 12:125707697-125707719 GTAGCATTTAAAGAAGTATCTGG + Intergenic
1104704986 12:130937247-130937269 TTAGCATTTGAATCAGTAGACGG - Intergenic
1105333201 13:19437345-19437367 GTAGCATCTCAGCAAGAAAATGG + Intronic
1105878508 13:24582447-24582469 GTAGCATCTCAGCAAGAAAATGG - Intergenic
1105921344 13:24966646-24966668 GTAGCATCTCAGCAAGAAAATGG + Intergenic
1107002996 13:35572895-35572917 GTAGATTATGATCAAGTAAATGG - Intronic
1107016210 13:35709603-35709625 GAAGAATTTGAAGAAGTAACAGG - Intergenic
1108291234 13:48963495-48963517 GTAGTATTTGACAAAGTAACAGG + Intergenic
1108626564 13:52234491-52234513 GTAGCATCTCAGCAAGAAAATGG + Intergenic
1108659506 13:52571997-52572019 GTAGCATCTCAGCAAGAAAATGG - Intergenic
1108960637 13:56223633-56223655 GTAACATTTAAACAACTCAAAGG - Intergenic
1109246326 13:59958268-59958290 GTAACATTTGAACTAGGAAAAGG + Intronic
1114934860 14:27521721-27521743 GTAGAATTTGAATTACTAAATGG - Intergenic
1115281974 14:31674255-31674277 GTAGAATCTGAACAAATAAAAGG - Intronic
1115720532 14:36156442-36156464 GTATAATTTGAAAAAGAAAAAGG - Intergenic
1116323831 14:43505008-43505030 GTAGCTTCTGAAAAAGTACATGG + Intergenic
1116430599 14:44841468-44841490 TTAGCATTTGAATCAGTAGATGG + Intergenic
1119993854 14:79230116-79230138 GTAGCATCTGGAAAAGAAAAAGG + Intronic
1120229244 14:81824786-81824808 GTAGCATTTGAGAAACCAAATGG - Intergenic
1120390083 14:83895427-83895449 GTACCACTTTAACAAGAAAAAGG + Intergenic
1120689228 14:87574260-87574282 GGATCATTTGAACAACTTAAAGG + Intergenic
1121771278 14:96543495-96543517 GCAGCATTAAAACAAGTGAAAGG + Intronic
1125066482 15:35492251-35492273 TTAGCATTTGAATTTGTAAACGG - Intronic
1126875998 15:53041998-53042020 GTAGCATTAGAAAGAATAAAAGG + Intergenic
1127187701 15:56496712-56496734 GTAGCATTTGTACCAGTAGATGG + Intergenic
1129995360 15:80000066-80000088 GTAGCATTGGTACAAGGATAGGG + Intergenic
1132004183 15:98211676-98211698 ATAGCATTTGAATCAGTAGAGGG - Intergenic
1133850089 16:9495338-9495360 TTAGCATCTGAATCAGTAAACGG + Intergenic
1134925925 16:18160220-18160242 TTAGAATTCCAACAAGTAAAGGG + Intergenic
1135049561 16:19181613-19181635 GTAGCTGTTGAGCACGTAAATGG + Intronic
1135404299 16:22187118-22187140 GTAGCATTCAAAGAAGTGAATGG - Intronic
1135726520 16:24858183-24858205 GTAGCATTGGAACAAGATTATGG + Intronic
1138153845 16:54684892-54684914 GTAGCATTGGAAGAAATATAGGG - Intergenic
1146013230 17:29212381-29212403 GGAGGATTTGAATAAGGAAAGGG - Intergenic
1146694615 17:34898993-34899015 ATAACATTTGATCAAGTATATGG - Intergenic
1149116826 17:53107287-53107309 CTAACAATTGCACAAGTAAAAGG + Intergenic
1150030107 17:61724517-61724539 GTAGCTTCTGAAAAAATAAATGG + Intronic
1150863124 17:68821879-68821901 ATAGTCTTTGAACAAGTAGAAGG - Intergenic
1151157022 17:72132257-72132279 GAAGGATTTGAACCAGGAAATGG + Intergenic
1151312359 17:73301232-73301254 GTTACATTTTAACAAGTAAGAGG - Intronic
1156772992 18:40752049-40752071 GTAGCATTTGTACTTGAAAAGGG - Intergenic
1159286063 18:66353796-66353818 ATAGCATTGGAAAAAGTAACAGG + Intergenic
1159316666 18:66783869-66783891 GTAGCATTTGTACAACAAATAGG + Intergenic
1159767992 18:72512968-72512990 GTAGTATTTGATTAATTAAAAGG + Intergenic
1160140057 18:76313198-76313220 ATAACATTTTAACAAGTACAAGG + Intergenic
926342985 2:11920189-11920211 GCAGCAAATGAGCAAGTAAATGG - Intergenic
927318825 2:21719109-21719131 GTAGCTATTGAATAAGTAAAAGG - Intergenic
927618446 2:24624613-24624635 GTAGCATTTGAACAAGTAAATGG - Intronic
928807906 2:35183658-35183680 TTAGAATATAAACAAGTAAAAGG + Intergenic
930975992 2:57461951-57461973 GTATCATTTTATCAAGCAAAGGG + Intergenic
931750884 2:65328914-65328936 GTTTCATTTGCAGAAGTAAAAGG - Intronic
933552020 2:83789620-83789642 GTAGGAATTGAAAAACTAAATGG + Intergenic
936738065 2:115470438-115470460 ATAGCATATGAACAAGTAGATGG + Intronic
940466596 2:154037324-154037346 ATAGCATTTCAAAAATTAAATGG + Intronic
941751092 2:169136104-169136126 GTATGAATTGAAAAAGTAAATGG - Intronic
943905585 2:193496714-193496736 TTATTATTTGAACAAGTGAAAGG + Intergenic
944358846 2:198827062-198827084 GTAGTCTTTGCACATGTAAAGGG + Intergenic
944945463 2:204678761-204678783 GTAGCATTTGAGCTGGAAAACGG + Intronic
945590858 2:211729424-211729446 GAAGCATTTGGACACATAAAAGG + Intronic
945933106 2:215876033-215876055 GTAGCAATAGAAGAAGCAAATGG - Intergenic
946951383 2:224879087-224879109 GAAGTATGTGGACAAGTAAAAGG + Intronic
948074506 2:235155523-235155545 GAAGCAGTTGACCAAGGAAAAGG + Intergenic
1169483617 20:6007109-6007131 GTAGCATATCAACAGGTAAGTGG - Intronic
1169585965 20:7085710-7085732 GAAGCACATGAACAAGGAAATGG - Intergenic
1170344633 20:15370601-15370623 GATGCAGTTGAAGAAGTAAATGG + Intronic
1171091987 20:22294070-22294092 GTAGCAGTTAACCAAGTGAAGGG + Intergenic
1172020876 20:31913218-31913240 CTAGCATTTGACCAAGCAACTGG + Intronic
1176739837 21:10591248-10591270 GTAGCATCTCAGCAAGAAAACGG - Intronic
1177356981 21:20021033-20021055 ATAGCATTTGAAAAATTAATTGG - Intergenic
1177357124 21:20022688-20022710 ATAGCATTTGAAAAATTAATTGG - Intergenic
1177608396 21:23412602-23412624 TTAGCAATTGAACAATCAAATGG + Intergenic
1181915958 22:26280086-26280108 GTAACATTTGAACCAGGTAATGG - Intronic
1182785552 22:32904686-32904708 AAAGCATTTGAACAAGTAATGGG + Intronic
949451604 3:4191391-4191413 GTACCAAATGAAGAAGTAAAAGG + Intronic
949478885 3:4474506-4474528 GAAGCATTTGAAAAAGAAAAGGG - Intergenic
951486731 3:23221154-23221176 CTAGTAATTGAACAAGTAAAAGG + Intronic
951654076 3:24985173-24985195 TTAGTATGTGAACGAGTAAAAGG - Intergenic
952163881 3:30724600-30724622 ATACAATTTCAACAAGTAAATGG + Intergenic
952599303 3:35059975-35059997 CTAACCTTGGAACAAGTAAATGG - Intergenic
952635496 3:35524348-35524370 ATTGCTCTTGAACAAGTAAATGG + Intergenic
954549677 3:51470754-51470776 GCAACATTTTAACAAATAAAAGG + Intronic
955757459 3:62239931-62239953 GTAGAATTTGTACATGCAAAGGG + Intronic
955999751 3:64716537-64716559 GTATCATTTGGCCAAGAAAATGG + Intergenic
956882715 3:73527304-73527326 ATAGGATATGAACCAGTAAATGG + Intronic
957225897 3:77445762-77445784 GTTGCTTTTAAACAATTAAAAGG + Intronic
958066874 3:88555020-88555042 ATAGCATTAGAACAATTCAAGGG + Intergenic
959210053 3:103367062-103367084 ATAGTATCAGAACAAGTAAATGG - Intergenic
959282182 3:104358261-104358283 GTTGCATTTGAACACGTTAATGG + Intergenic
959499218 3:107086572-107086594 GTAGCATTTGCACACGGAGAGGG - Intergenic
960042372 3:113163533-113163555 GTACCATATGAACCAGTAAGTGG + Intergenic
960077373 3:113502711-113502733 GTAGGATTTGAACTAGGATAAGG + Intronic
960100253 3:113734604-113734626 TTACTATATGAACAAGTAAAAGG + Intronic
960355517 3:116648176-116648198 TTAGCATTTGAATCAGTAGATGG + Intronic
961149978 3:124629207-124629229 TTAGCATCTGAACAAATCAAAGG - Intronic
963178688 3:142330128-142330150 GTAAAATTTGAACAAACAAATGG + Intronic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
963999579 3:151753829-151753851 GTATCTTGTGAACAAGTAACTGG + Intronic
964733679 3:159894016-159894038 GTAGGAGTTGTACAGGTAAAGGG - Intronic
966279859 3:178213962-178213984 GTAGGAATTGAAAAACTAAATGG - Intergenic
966722030 3:183073266-183073288 GTAGAATGTCAAGAAGTAAAGGG + Intronic
967395465 3:189003741-189003763 GTAGCATTTGGGAAAGTAGAAGG - Intronic
967629252 3:191724111-191724133 GTAGCATATCCACAGGTAAAGGG + Intergenic
969852531 4:9971358-9971380 GTAGAAATTTAACAAGTAATAGG - Intronic
970745433 4:19288942-19288964 GTAGCATTCTAATAAGTAGATGG + Intergenic
970767329 4:19565385-19565407 GTAGCATTATTACTAGTAAAAGG + Intergenic
970942710 4:21654285-21654307 GTAACAATTGCAAAAGTAAATGG - Intronic
971032758 4:22658798-22658820 GTATGATTTGAACAAATAAATGG + Intergenic
971872589 4:32263219-32263241 GTAAAATTTGAAAAATTAAAGGG + Intergenic
972200177 4:36704610-36704632 GTAGCATTTCAACAAAAATATGG - Intergenic
973116970 4:46473675-46473697 GTAGCATTTTAAATTGTAAATGG + Intronic
974648349 4:64723117-64723139 TTAGCATTTGAACTAGCAAGTGG + Intergenic
975289219 4:72657382-72657404 GTAGCCTTTAAAGAACTAAATGG - Intergenic
976676302 4:87707574-87707596 GTACAATTTGAGCAAGGAAATGG - Intergenic
977801497 4:101239166-101239188 TTTGCATTTGATAAAGTAAAAGG - Intronic
978483200 4:109218528-109218550 GTAGTATTTGAACAAGGACATGG - Intronic
978703482 4:111676229-111676251 GGAGCATTTGAAAAGGTATAGGG - Intergenic
978758172 4:112326569-112326591 GTGGGATTAGAACAAGGAAATGG - Intronic
979479924 4:121205068-121205090 TTAGCATTTTAACAGGTAATAGG + Intronic
980904324 4:138932857-138932879 GTATGAATTGAAAAAGTAAATGG - Intergenic
982329665 4:154166999-154167021 GAAGAATTAGAACAAGTAATTGG + Intergenic
984985816 4:185328819-185328841 GTAGTTTTTGAACAGGTAACAGG + Intronic
986491413 5:8295020-8295042 GTAACATATTATCAAGTAAAAGG + Intergenic
987588213 5:19887181-19887203 GTTGTATGTGAAAAAGTAAATGG - Intronic
987756217 5:22099855-22099877 GTATGAATTGAAAAAGTAAACGG - Intronic
988384521 5:30543827-30543849 GTAGCATTTTAATATGTCAACGG + Intergenic
990004941 5:50935019-50935041 GTTGTATTTGAAAAAATAAAGGG - Intergenic
990640006 5:57772194-57772216 GTATCATTAAAAAAAGTAAATGG + Intergenic
992570548 5:78052012-78052034 ATAGGATTTAAAAAAGTAAACGG + Intronic
993218102 5:85051577-85051599 ATAGCATTTGTAAAAGTAAAAGG - Intergenic
995647839 5:114332837-114332859 GTAGCATTTGAATAAGCAGGTGG - Intergenic
996621396 5:125507953-125507975 GTAGGATTTGAGCAAGATAATGG + Intergenic
998061404 5:139121500-139121522 ATAGCATGTCAAAAAGTAAAAGG - Intronic
998237209 5:140408283-140408305 GTAGAATTTGAAGAATTAATGGG - Intronic
1000796170 5:165667747-165667769 GTAGTATTTGTACAAATGAAAGG + Intergenic
1001917057 5:175570568-175570590 GCTGCATTTGAATAAGTAAGTGG + Intergenic
1003125581 6:3353268-3353290 CCAGCATTTGAACAAAAAAAGGG + Intronic
1003711086 6:8590822-8590844 ATATCATTTGATCAGGTAAAAGG - Intergenic
1004175947 6:13340280-13340302 GTAGCATGTGAACACCTGAATGG + Intergenic
1004685460 6:17939157-17939179 GTAGCAGATGCACAAGGAAAGGG - Intronic
1005845410 6:29773029-29773051 GTAGAAGTTGAACAAACAAAAGG - Intergenic
1007297672 6:40838865-40838887 GTTACATTTGAACAAGTCACTGG - Intergenic
1007997847 6:46327524-46327546 GCAGCTTTTGAAAAGGTAAATGG + Intronic
1010708329 6:79140945-79140967 GTAGCATTTACACAAGCACATGG - Intergenic
1010743434 6:79534813-79534835 GCAGCATTTGCAAAAGTAAAAGG + Intronic
1011029851 6:82909976-82909998 GGAGCATTTGAACACGTTGAGGG - Intronic
1011134060 6:84080714-84080736 GAAGAATTTTAACAAGTAACAGG + Intronic
1011840719 6:91495067-91495089 GCAGTATTTGAAGAAATAAAAGG - Intergenic
1012638446 6:101578516-101578538 GGGGCATTTGAACAAGGAAATGG + Intronic
1013041377 6:106437201-106437223 AAAGCATTTGAAGAAATAAAGGG - Intergenic
1013360373 6:109388314-109388336 GGAGAATTTGAACAAGTTCAAGG - Intergenic
1014050668 6:116950035-116950057 GTTTAATTTGAACAAGAAAAGGG + Intergenic
1014931802 6:127344650-127344672 GTATGATTTGAATAAGTACAGGG + Intergenic
1015697116 6:135993012-135993034 GGAGCATTTGGACCACTAAAGGG - Intronic
1017473525 6:154764413-154764435 AGAGAATTTGCACAAGTAAAGGG + Intronic
1017874190 6:158510924-158510946 GTATCATTTGGCCAAGTCAATGG + Exonic
1018456274 6:163955819-163955841 GTGGCATTTCAACAAGAGAATGG + Intergenic
1019382309 7:730369-730391 GTAGCATTTTAGCAAGTCACTGG - Intronic
1020527308 7:9278478-9278500 TTAGCAGTTGAACAAAAAAATGG + Intergenic
1023311688 7:38894079-38894101 CTAGCACTTGAATAAGGAAAAGG + Intronic
1023704397 7:42925918-42925940 CTGTCATTTAAACAAGTAAAAGG - Intronic
1026721723 7:72837562-72837584 TTAGTATTTAAACACGTAAATGG + Intergenic
1026884058 7:73927502-73927524 GTAGCATATGTAAAAGTAAAAGG - Intergenic
1027458202 7:78420111-78420133 GTAGCATTGGCACCAATAAAGGG + Intronic
1027720755 7:81738655-81738677 TCAGCTTTTGAACAAATAAAAGG + Intronic
1028549561 7:92044490-92044512 GTAGTATTTGTACAAGTTAATGG - Intronic
1028899945 7:96086431-96086453 GTAGGATTTGAAGAATAAAATGG + Intronic
1029954480 7:104623273-104623295 GTACCATTTGAAAAAAAAAAAGG + Intronic
1032550842 7:132782544-132782566 TTAGCAGTTGAACAATTGAAAGG - Intergenic
1032662282 7:133998105-133998127 GTCACATTTGAAAAAGTAGAGGG + Intronic
1032677876 7:134148320-134148342 GTATCCTTTGAATAAGTAAAGGG + Intronic
1034504422 7:151475784-151475806 CTAGTATTTGAAATAGTAAATGG - Intronic
1036149745 8:6286373-6286395 GTAGCATTCGAATCAGTAGATGG - Intergenic
1038177181 8:25191571-25191593 GTAACTTTTAAGCAAGTAAAGGG + Intronic
1040894011 8:52346988-52347010 GTTTCATTTGAAGAAATAAAAGG + Intronic
1041521880 8:58765993-58766015 GTAGCATTAGAATATCTAAAAGG - Intergenic
1042427814 8:68669454-68669476 GTAGAATACGAATAAGTAAATGG - Intronic
1043004866 8:74807115-74807137 GAAGGTTTTGATCAAGTAAATGG - Intronic
1043626749 8:82271273-82271295 GTAGCATTTTAGCAATTATAGGG - Intergenic
1043720243 8:83540276-83540298 GTAGCATCTGGCCAAGTACAAGG - Intergenic
1043868713 8:85404889-85404911 GTGGCATTTGCACAAATAACTGG - Intronic
1046266185 8:111833662-111833684 GAAGCATTTGAAAAAATCAATGG - Intergenic
1046322975 8:112602244-112602266 TCAGCACTTGAACAAATAAAGGG + Intronic
1049937253 9:511230-511252 ATAGGTTTTGAAAAAGTAAAAGG + Intronic
1050527695 9:6560465-6560487 GAAGCATTCAAACAAGAAAACGG - Intronic
1050654348 9:7809912-7809934 GTAGCATTGGTACAGGAAAAGGG + Intronic
1051497045 9:17735154-17735176 GTCTCACTTGAACAACTAAAGGG + Intronic
1055152087 9:73013058-73013080 GTAGCATTCAAAGATGTAAATGG + Intronic
1055464730 9:76553241-76553263 ATAGCAGTTGCACAAGAAAAAGG - Intergenic
1056943350 9:90973829-90973851 TTAGTATTTGAACTAGTTAATGG + Intergenic
1057407091 9:94782305-94782327 AAAGCATATGAACAAGTGAAAGG + Intronic
1059150101 9:111941741-111941763 TTAGCATTTGTGCAACTAAATGG + Intergenic
1059507632 9:114814073-114814095 GATGCAGTTGAACACGTAAATGG + Intergenic
1062258211 9:135641333-135641355 GTCCCATTTGAAAAATTAAAGGG + Intergenic
1186501031 X:10050657-10050679 TTAGCATTTGAACAGGAAAGGGG + Intronic
1188563185 X:31493535-31493557 GCAGAATTGGAAAAAGTAAATGG + Intronic
1188706195 X:33334536-33334558 ATAGCATATAAACAAATAAATGG + Intronic
1188980054 X:36719585-36719607 GTATCCTATGAACAAGGAAAAGG + Intergenic
1189734614 X:44057134-44057156 GAAGCATTTGAAAGAGTAAAGGG - Intergenic
1193386486 X:80878498-80878520 GGAGCATTAAAACAAGTAAGAGG - Intergenic
1194980823 X:100438576-100438598 GGAGCATTTGAATGAGTGAAGGG + Intergenic
1195151695 X:102077793-102077815 GGAGCCTTTGGACAACTAAATGG - Intergenic
1195624565 X:106994459-106994481 GTAGTAATAGAACAAGTATATGG - Intronic
1197959316 X:131986647-131986669 GAAACATTTCTACAAGTAAACGG + Intergenic
1198598830 X:138263817-138263839 GTATGAATTGAAAAAGTAAATGG - Intergenic
1199150007 X:144420520-144420542 GCAGAATTTGAAGAAGTCAAAGG + Intergenic
1199822230 X:151460919-151460941 GTAGGAGTTCACCAAGTAAAAGG + Intergenic
1200303327 X:155000511-155000533 GTATCATTTCAACAAGCCAAAGG + Intronic
1201740421 Y:17318345-17318367 TTGGCATTTGCACCAGTAAAAGG + Intergenic