ID: 927619040

View in Genome Browser
Species Human (GRCh38)
Location 2:24632585-24632607
Sequence TGGGAGCCAATAATGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927619040_927619043 -9 Left 927619040 2:24632585-24632607 CCCTTCTCCATTATTGGCTCCCA 0: 1
1: 0
2: 2
3: 15
4: 202
Right 927619043 2:24632599-24632621 TGGCTCCCAAATTGAAAACTAGG 0: 1
1: 0
2: 0
3: 18
4: 175
927619040_927619046 7 Left 927619040 2:24632585-24632607 CCCTTCTCCATTATTGGCTCCCA 0: 1
1: 0
2: 2
3: 15
4: 202
Right 927619046 2:24632615-24632637 AACTAGGCCCTTTAGCATCCAGG 0: 1
1: 0
2: 0
3: 2
4: 55
927619040_927619050 18 Left 927619040 2:24632585-24632607 CCCTTCTCCATTATTGGCTCCCA 0: 1
1: 0
2: 2
3: 15
4: 202
Right 927619050 2:24632626-24632648 TTAGCATCCAGGCAGGAAATAGG 0: 2
1: 0
2: 1
3: 11
4: 188
927619040_927619051 21 Left 927619040 2:24632585-24632607 CCCTTCTCCATTATTGGCTCCCA 0: 1
1: 0
2: 2
3: 15
4: 202
Right 927619051 2:24632629-24632651 GCATCCAGGCAGGAAATAGGAGG 0: 1
1: 1
2: 1
3: 28
4: 246
927619040_927619047 11 Left 927619040 2:24632585-24632607 CCCTTCTCCATTATTGGCTCCCA 0: 1
1: 0
2: 2
3: 15
4: 202
Right 927619047 2:24632619-24632641 AGGCCCTTTAGCATCCAGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927619040 Original CRISPR TGGGAGCCAATAATGGAGAA GGG (reversed) Intronic
904166682 1:28560983-28561005 TGGGAGGCAGCAATGCAGAATGG - Intronic
905321756 1:37122499-37122521 GGGAAGCCAATGAGGGAGAAGGG + Intergenic
907617986 1:55944220-55944242 CTGTAGCCAAAAATGGAGAAAGG + Intergenic
908266537 1:62384922-62384944 TGGGGGCCAACAATTGAGACTGG + Intergenic
909471645 1:76035610-76035632 CGGGAGAGAATAATGGAGAGTGG - Intergenic
911278571 1:95895067-95895089 TGGGAGCATATCTTGGAGAATGG - Intergenic
913616744 1:120567625-120567647 TGGGAGACAGTAATGTTGAACGG + Intergenic
914573531 1:148943285-148943307 TGGGAGACAGTAATGTTGAACGG - Intronic
916550981 1:165849658-165849680 TTAGAGCCAAAAATGGAAAAAGG - Intronic
916997428 1:170315794-170315816 TTGGAGACAATGATGAAGAAAGG - Intergenic
917691579 1:177475263-177475285 TGTTAGCCAATAATGCAAAATGG + Intergenic
918740642 1:188127091-188127113 TGGGAGATAGTAATGGAGACTGG - Intergenic
918756732 1:188347004-188347026 GGAGAGCCAATAATGAATAAGGG - Intergenic
919643283 1:200066321-200066343 TGGGAGCCATTTGTGGAGAAGGG + Intronic
924168995 1:241317437-241317459 TTGGAGCCAAATATGGGGAAAGG + Intronic
924197469 1:241623389-241623411 GGAGAGGCAAGAATGGAGAAGGG - Intronic
1064984296 10:21194636-21194658 GTGGAGCCAAGAATAGAGAAAGG + Intergenic
1065229514 10:23582943-23582965 TGGTACCCACTGATGGAGAAAGG + Intergenic
1065789699 10:29249639-29249661 TGGGACCCATCAATGGAGAGGGG - Intergenic
1067729005 10:48795650-48795672 TTGGAGCCATTGATGGGGAATGG + Intronic
1067760973 10:49046799-49046821 TGGGAACTAAGTATGGAGAAAGG + Intronic
1069888779 10:71640035-71640057 TGGCAGCAAATCAAGGAGAAGGG + Intronic
1070776675 10:79113793-79113815 TAGGAGCCATCAATGGAGAGGGG - Intronic
1072831507 10:98663514-98663536 TGGGATCCAACAAGGGAGCAAGG + Intronic
1074301907 10:112240733-112240755 TGGGAGCCAGGAGTGGAGAGAGG + Intergenic
1075957699 10:126538131-126538153 TGGAAGGCAAAAAAGGAGAAAGG + Intronic
1077707493 11:4501575-4501597 TGGGAACCAAAAATAGAGCAGGG - Intergenic
1078582809 11:12551813-12551835 TGGGTGCCCATAATGGGGCAGGG + Intergenic
1083991483 11:66248672-66248694 TGGGAGTCTGAAATGGAGAAAGG - Intergenic
1086916353 11:92534089-92534111 TGGCATCCAAGAATGGAGAGAGG - Intronic
1088754310 11:112872959-112872981 TGGGCACCAGTAATGGAGACGGG - Intergenic
1089385160 11:118062516-118062538 TGGGAGTCAACAATGGAGACAGG + Intergenic
1089500540 11:118929199-118929221 TGGGAGCCAATAGAGGAGCAGGG + Intronic
1089934363 11:122348438-122348460 TTGGAACCTAGAATGGAGAATGG - Intergenic
1095737797 12:45576652-45576674 TTGGAGGCAACAATGGAGAGGGG + Intergenic
1098287079 12:68918195-68918217 GAGGAGCCAAGAATGGAGATGGG - Intronic
1098477907 12:70926681-70926703 TGGATGCCTATAATAGAGAATGG + Intergenic
1098501204 12:71194170-71194192 TGGGATCCAATAATTATGAATGG + Intronic
1099644957 12:85341388-85341410 TGGGAGGTAAAAATGGGGAAAGG - Intergenic
1100633632 12:96413255-96413277 TGGTACCCAGCAATGGAGAAGGG - Intergenic
1100878063 12:98984120-98984142 TAGAAGCCAAAAATAGAGAAGGG - Intronic
1101196891 12:102392817-102392839 TGGGATCCCATAAAGGATAATGG - Intergenic
1101549474 12:105748688-105748710 TGGGAGCCCAAGATAGAGAAGGG - Intergenic
1101859244 12:108469081-108469103 TGGAAGCCAGTAATGGGGATGGG + Intergenic
1104889067 12:132131220-132131242 TGGGAGCCAAAAAGGCCGAAGGG + Intronic
1107210624 13:37849785-37849807 TGGGAGCCAATCATGGTCATCGG + Intronic
1107405738 13:40111047-40111069 AGGTAGACAATAAGGGAGAAAGG + Intergenic
1109986981 13:69999511-69999533 GGGGAGCCCAAAATGCAGAAGGG - Intronic
1110170090 13:72490259-72490281 TCTGAGCCAATAATTGAAAATGG + Intergenic
1110944172 13:81391972-81391994 TGGGGGCCAGGAATGGAGACAGG - Intergenic
1112787088 13:102963074-102963096 TGGGGTCCAGGAATGGAGAAAGG - Intergenic
1115521949 14:34241815-34241837 TGGCAGCCAATACTGCAGAGAGG - Intronic
1115628806 14:35222641-35222663 TGGGAGTCCAAAATGGGGAAGGG - Intronic
1115907508 14:38216811-38216833 TGGGAGCTAAAAAGGGAAAAGGG - Intergenic
1115914255 14:38292963-38292985 TGGGACTCAATGATGGAGACGGG - Intergenic
1117972228 14:61263170-61263192 TGAGAGGGAATAAGGGAGAATGG - Intronic
1118333033 14:64828464-64828486 TGGGAACCATTAAAGGAGAGGGG + Intronic
1119705061 14:76778165-76778187 TGGGAGCGAAAAAGAGAGAAGGG - Intronic
1121916506 14:97840645-97840667 TGGGAGCCTATGATGGAGGGGGG + Intergenic
1124679601 15:31719262-31719284 TTGGAGCCAACAATGAAGGAGGG - Intronic
1125046432 15:35246456-35246478 AGGGAGACACTAATGGGGAAAGG - Intronic
1125934009 15:43619001-43619023 TAGGAGCCAGTGATGCAGAAAGG + Intergenic
1125947106 15:43718463-43718485 TAGGAGCCAGTGATGCAGAAAGG + Intergenic
1128110148 15:65071262-65071284 TGGGGGCAAAGAAAGGAGAAAGG - Intronic
1128841121 15:70852831-70852853 GGTGAGCCAGTAATAGAGAATGG + Intronic
1129451652 15:75654543-75654565 TGGGTCCCAAAAATGCAGAAAGG - Intronic
1129503550 15:76061790-76061812 TGGGATGCGATAATGGAAAATGG - Intronic
1131563117 15:93461548-93461570 TGAGAGTTAATAATGGAGAGTGG + Intergenic
1132422873 15:101689074-101689096 AGGGAGCCCATAATGGGCAATGG - Intronic
1133444222 16:5846345-5846367 TGGGAAAGAATAATGGGGAAAGG + Intergenic
1135178058 16:20248700-20248722 TGGGAGACAATAATGTACGAAGG - Intergenic
1136494225 16:30632106-30632128 GGGGAGCCAAGATAGGAGAATGG - Intergenic
1138625433 16:58248047-58248069 TGGAAGCCAAAAATGGACAGTGG - Intronic
1141289672 16:82706154-82706176 AGGGAGCGAAAAAGGGAGAAGGG - Intronic
1142207875 16:88792556-88792578 TGGGAGCAACAAAGGGAGAAAGG + Intergenic
1143544017 17:7585973-7585995 TGGGAGCCAAGAGTGCTGAAGGG + Exonic
1144198784 17:12920412-12920434 TGGAAGGCGATGATGGAGAAAGG + Intronic
1150647239 17:66986501-66986523 TGAGAGCCCATTATGGGGAAGGG + Intronic
1151241687 17:72763181-72763203 TGGGAGGCAATGAGGGAGAAGGG - Intronic
1153873051 18:9338468-9338490 TGGGAGTGAATAATGTAGGAGGG - Intronic
1155802137 18:30120173-30120195 TGAGAGCCAATAACTGAGAATGG + Intergenic
1155905229 18:31442706-31442728 CGGGAGAGGATAATGGAGAATGG + Intergenic
1156150821 18:34240986-34241008 TGGGAGAAAATATTTGAGAAAGG - Intergenic
1157201140 18:45660939-45660961 TGGCAGCCAAGAGTTGAGAATGG - Intronic
1158273128 18:55738096-55738118 AGGGAGAAAATAAAGGAGAAAGG - Intergenic
1158664355 18:59419302-59419324 TGGGAGGGAAAAATGGAAAATGG - Intergenic
1159818203 18:73104064-73104086 TGAGAGATAATGATGGAGAAAGG + Intergenic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
926115433 2:10210155-10210177 TGGGAGTCCATGAGGGAGAAAGG - Intronic
927619040 2:24632585-24632607 TGGGAGCCAATAATGGAGAAGGG - Intronic
927781527 2:25943210-25943232 TGGGATCCAATGCTGAAGAAAGG + Intronic
929007451 2:37409860-37409882 TGGGAGCCAAGAATGGTGTGGGG + Intergenic
932552563 2:72785982-72786004 GGGGAGCCAAGACAGGAGAATGG + Intronic
933245538 2:79970696-79970718 TGGCAGGCCATACTGGAGAATGG + Intronic
933828410 2:86185592-86185614 AGGAAGCCCAAAATGGAGAAGGG + Intronic
936411720 2:112264473-112264495 TAGGAGACCATAATGAAGAAGGG + Intergenic
936875800 2:117187862-117187884 TGGGTGCCAGTTATGAAGAATGG - Intergenic
937089695 2:119197822-119197844 AGCAAGCCAATAATGGAGAAAGG + Intergenic
939753957 2:146086041-146086063 CAGGAGCCAAAAATAGAGAAGGG - Intergenic
940144700 2:150533736-150533758 TGTGAGCCATTGATAGAGAAAGG - Intronic
942380293 2:175384165-175384187 TGGAAGACAGAAATGGAGAAGGG + Intergenic
943410886 2:187545957-187545979 TGAGAGGCAATAAGGGGGAAGGG + Intronic
943537612 2:189171983-189172005 TGGTCTCCAATAAAGGAGAAAGG + Intronic
944761231 2:202816653-202816675 TGGGATTCAGAAATGGAGAAAGG - Intronic
946014688 2:216594499-216594521 TGGGAGGCAAAAATGGATATTGG - Intergenic
946122231 2:217526294-217526316 GGAGAGCCAATGGTGGAGAAAGG + Intronic
947180982 2:227411224-227411246 TGGGAGGGAATAAGGAAGAATGG - Intergenic
948592088 2:239057017-239057039 CGGGACCCTAAAATGGAGAAAGG + Intronic
1168836412 20:880732-880754 TGGGAGCCACTGATTGAAAATGG + Intronic
1169743043 20:8915980-8916002 TGGGAGATGTTAATGGAGAATGG - Intronic
1170666724 20:18393090-18393112 TGGGGCCCAAGAAAGGAGAAGGG + Intronic
1171015278 20:21535268-21535290 TGGAAGCTAATACTGGAGCAAGG + Intergenic
1171072905 20:22092525-22092547 GGGGAGCCAGAAATGGGGAATGG + Intergenic
1172845081 20:37925449-37925471 TGGGAGCCAAGGATGGAGGACGG - Intronic
1174593918 20:51668219-51668241 TGGGAGCAGGTACTGGAGAAGGG + Intronic
1176956108 21:15105922-15105944 TGGTAGCAAATTAAGGAGAAAGG - Intergenic
1177448304 21:21228749-21228771 TGGGAGGCAAGAAAGGAGAAGGG + Intronic
1177484491 21:21739650-21739672 TGGGATCAAATAATAGACAATGG - Intergenic
1178806052 21:35840228-35840250 AGGCAGTCAATAAAGGAGAAGGG + Intronic
1179780206 21:43694731-43694753 TGGGAGGCAGCAGTGGAGAAGGG - Exonic
1180904568 22:19400042-19400064 TGGGAGCCCAGAAAGGAGAAGGG + Intronic
1183510725 22:38233188-38233210 TGGGAGCCCTTAATGGATTAGGG - Intronic
1183772713 22:39940312-39940334 TGAGAGCCCAAAATGGGGAAAGG + Intronic
949540478 3:5027976-5027998 TGGGATGCAGTGATGGAGAAAGG - Intergenic
950413030 3:12851296-12851318 TGTGAGCCAATAAGGGAGCATGG + Intronic
954613813 3:51959532-51959554 TGGGACACATTACTGGAGAAGGG - Intronic
955622985 3:60885921-60885943 TGGGAGCCAATAAATGAATATGG - Intronic
959596128 3:108130277-108130299 TGGGAGGCAGCAAGGGAGAAGGG + Intergenic
960498105 3:118400494-118400516 TGAGAGAGAGTAATGGAGAAAGG + Intergenic
960727394 3:120684149-120684171 TGGGAGCTAATAAAAGACAAAGG + Intergenic
961716503 3:128861263-128861285 TGTGAGCCAATAAGGGAGCATGG - Intergenic
961805191 3:129484118-129484140 TGTGAGCCAATAAGGGAGCATGG + Intronic
962734033 3:138308101-138308123 TGGGAGGAAATCATGGAGGAGGG + Intronic
964379492 3:156083608-156083630 TAGGAGACATTAATGGAGCAGGG - Intronic
964439466 3:156691301-156691323 TGGCATCCAGTAATGGATAAAGG - Intronic
966315958 3:178645581-178645603 TGGGAGCCAGTGTAGGAGAATGG + Intronic
968042296 3:195598880-195598902 TGGGTGAAAATAATGGAGGAGGG + Intergenic
968309252 3:197669283-197669305 TGGGATCCCGAAATGGAGAAAGG - Intergenic
968761526 4:2444742-2444764 TGGAAGCCAGCAGTGGAGAAAGG - Intronic
972155862 4:36160993-36161015 AAGGAGCCAAAAATGGAGACAGG + Intronic
972903688 4:43717980-43718002 TGGGAACCCATGATGCAGAAAGG + Intergenic
973758640 4:54098321-54098343 TTGGAGCCACTGATGGAGAATGG - Intronic
976761398 4:88553115-88553137 TGGGAGGCCATAATGGACCATGG + Intronic
980821255 4:138020680-138020702 TGAGAGCCAAGAAAGGACAATGG + Intergenic
982333667 4:154210146-154210168 TGGGTGCAAATCATAGAGAATGG + Intergenic
982381560 4:154754445-154754467 TGGGGACCAATAAAGGAGAGGGG + Intergenic
982686718 4:158499271-158499293 TAAGAGCCAAGAAAGGAGAAAGG + Intronic
982979366 4:162112566-162112588 TGGAAGAAAATAATTGAGAAAGG - Intronic
986692342 5:10323613-10323635 TGGCAGCCAGAAATGGACAAGGG - Intergenic
986816144 5:11414084-11414106 AGAGAGACAAAAATGGAGAAGGG + Intronic
987198656 5:15552653-15552675 TGGGAGGCAAGAGTGGAGATGGG - Intronic
987395083 5:17415594-17415616 TGGAAGCAAACAATGGTGAAAGG - Intergenic
987792038 5:22580743-22580765 TGCTATCCAATAAAGGAGAAAGG - Intronic
991173122 5:63652108-63652130 TGGGGGCAGATAATGGAGGAAGG + Intergenic
992255347 5:74915405-74915427 TGGGAGGAAATACTGGAGAGGGG + Intergenic
992632701 5:78697345-78697367 TGGGAGCCAAGGCAGGAGAAGGG + Intronic
993451896 5:88081857-88081879 TGCTATCCAATAATGGAGACAGG - Intergenic
993651232 5:90524920-90524942 TAAGAGCAAAAAATGGAGAAAGG + Intronic
996338278 5:122408418-122408440 TGGGCTCCAAGAATGGAAAATGG + Intronic
996984188 5:129538513-129538535 AGGGAGGCAATAATGAAGAGTGG - Intronic
998011143 5:138696648-138696670 TGGCAGCCAATGAGGGAGCAGGG + Intronic
1001689020 5:173618406-173618428 GGGGTGCCAAAAATGGAGAAGGG - Intergenic
1001952940 5:175829030-175829052 TGAGGGCCAATAATGGGGACAGG - Intronic
1003439566 6:6126847-6126869 TGGGAGCCAGTACTGGTGACTGG - Intergenic
1004993455 6:21164511-21164533 TGGGAGACAATGATGGATAGTGG - Intronic
1005836129 6:29710902-29710924 TGGGAACCATTACTAGAGAAGGG - Intergenic
1005856901 6:29869658-29869680 TGGGAACCATTACTAGAGAAGGG - Intergenic
1005862719 6:29913792-29913814 TGGGAACCATTACTAGAGAAGGG - Intergenic
1006175984 6:32121860-32121882 GAGGAGCCACTAAAGGAGAAAGG - Intronic
1006335629 6:33419046-33419068 TGTGACCCAAAAATGGAGAGAGG + Intergenic
1008021001 6:46577013-46577035 TTAGAGCCAGCAATGGAGAAGGG + Intronic
1008583641 6:52929336-52929358 CTGGAGCCACTAATGGAGAGGGG + Intergenic
1010768656 6:79804237-79804259 TGGGTGCCAAAAAGGGAGCATGG + Intergenic
1012505105 6:99936459-99936481 AAGGAGCCAAGAATGGAGACAGG - Intronic
1014191344 6:118500261-118500283 TGGGAGCCAAAAATGCCAAAGGG + Intronic
1014699625 6:124668356-124668378 TGGAAATCAATAAAGGAGAATGG - Intronic
1014795500 6:125719820-125719842 TGGTATCCAATAACTGAGAAAGG + Intergenic
1017154336 6:151309411-151309433 TGGGAGAAAATAATGAACAAGGG + Intronic
1018373198 6:163187078-163187100 TGGGAGCCACTGATAGGGAAGGG - Intronic
1019553473 7:1616765-1616787 TGGGAGCCAAGCAGGGAGATGGG - Intergenic
1019660410 7:2220796-2220818 TGGGAGTCAACAAAGAAGAAAGG + Intronic
1025871083 7:65434876-65434898 TCGGAGCCACTAGTGTAGAAAGG - Intergenic
1025874933 7:65472345-65472367 TGGCAGCAAAGAATGAAGAAGGG + Intergenic
1026427517 7:70311364-70311386 TGGGAGACAAGAATGGAGAAAGG - Intronic
1027810224 7:82887343-82887365 TGGGATTCAATAAAGGAGTAAGG - Intronic
1028077754 7:86535695-86535717 TGGGAGGCAAAAAAGGAGTATGG + Intergenic
1028610722 7:92708223-92708245 GGTGAACCAAGAATGGAGAATGG + Intronic
1032165438 7:129541336-129541358 TGGAAGGGAATACTGGAGAAAGG + Intergenic
1033196360 7:139331093-139331115 GGGGACCCAATACTGGAGACTGG - Intergenic
1033411547 7:141122706-141122728 TGGGAGGAAATTATGGATAAGGG + Intronic
1034490985 7:151392905-151392927 AGGGAGCCAAGACTGAAGAATGG - Intronic
1034741194 7:153475089-153475111 TGGTAGCCAATAATCGTAAACGG - Intergenic
1039598228 8:38809904-38809926 TGGGATCCTATGAAGGAGAATGG + Intronic
1039924297 8:41915455-41915477 TGGGTGCAGATAAGGGAGAAAGG - Intergenic
1042863457 8:73335944-73335966 TGGGAGCCAATGTTGGAGTTGGG - Intergenic
1045567856 8:103339672-103339694 TGGGAGTCAAATCTGGAGAAGGG - Intergenic
1047961390 8:130014592-130014614 TGGGAGCTGAGAAAGGAGAAGGG + Intronic
1053287345 9:36858645-36858667 TGGGAGCCAGTAATAGAGGCTGG - Intronic
1055131717 9:72783169-72783191 TGGGAGCTTATTAGGGAGAAAGG + Intronic
1055521488 9:77085523-77085545 TGCTAGCAAATAAGGGAGAAGGG - Intergenic
1055983573 9:82032106-82032128 AGGGAGACGATAAGGGAGAATGG + Intergenic
1056002214 9:82229117-82229139 TGAAAGCCCATAATGGTGAATGG + Intergenic
1056570204 9:87808178-87808200 TGGGAGAAAATAATAGAGACAGG + Intergenic
1057963874 9:99484158-99484180 TGGGTGCCAATAATACATAATGG - Intergenic
1058187999 9:101877866-101877888 TTGGAGGCAACACTGGAGAATGG - Intergenic
1058766759 9:108189455-108189477 GGGGAGCCAAGATAGGAGAAGGG + Intergenic
1061213470 9:129206671-129206693 TGGGAGCAAAGAAAGGGGAAGGG + Intergenic
1061890121 9:133614880-133614902 TGGGAGCAGAGAAAGGAGAATGG + Intergenic
1062548475 9:137074735-137074757 AGGTAGCCAAGAATGCAGAAAGG + Intergenic
1187669212 X:21651754-21651776 TGGGGGCCTGTAATGGAGAATGG - Intronic
1188228338 X:27629581-27629603 AGGGTGCCAATAATGCACAATGG - Intronic
1191734014 X:64369601-64369623 TGGGGGCCTATCATGGAGGAGGG + Intronic
1192000082 X:67140509-67140531 CTGGACCCAACAATGGAGAATGG - Intergenic
1192424088 X:71060307-71060329 TGGGAGCCACAAAGGGAGAGGGG + Exonic
1193456640 X:81739239-81739261 TGAAAGCCAATAATGGATCAGGG + Intergenic
1197314961 X:124954395-124954417 TGGAACCCAGTATTGGAGAAGGG - Intronic
1197334679 X:125198715-125198737 TGGGAGTCACTAATTCAGAATGG - Intergenic
1201777139 Y:17678398-17678420 TGGGAGCCAATTGTGGACTAAGG - Intergenic
1201824418 Y:18227594-18227616 TGGGAGCCAATTGTGGACTAAGG + Intergenic
1201992496 Y:20042989-20043011 TGGGACAGAGTAATGGAGAAAGG - Intergenic