ID: 927620183

View in Genome Browser
Species Human (GRCh38)
Location 2:24647777-24647799
Sequence ATGTGAAAGTGGCAACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927620183 Original CRISPR ATGTGAAAGTGGCAACTGGA AGG Intronic
900958956 1:5907208-5907230 CTGGGAAATTGACAACTGGAAGG + Exonic
906670139 1:47648326-47648348 ATGAGAAAGGGGCAAATGGCAGG - Intergenic
906751158 1:48262427-48262449 ATGTGCAAGTGGAAAATGGATGG - Intergenic
909676209 1:78241657-78241679 CTGTGGAAGAAGCAACTGGAAGG - Intergenic
909983165 1:82129458-82129480 ATGTGAAAGTAGTAACAGGCAGG + Intergenic
910838416 1:91538517-91538539 ATCTGAAAGTGACAATTTGAGGG - Intergenic
911986080 1:104624572-104624594 ATGAGAAAGTAGAAACTGGAAGG + Intergenic
912838760 1:113020305-113020327 AGGAGAAAGTGGGAAGTGGATGG + Intergenic
915463966 1:156085122-156085144 ATGTGAGCCTGGCACCTGGAGGG + Intronic
918623591 1:186633223-186633245 ATCATAAAGTGCCAACTGGATGG + Intergenic
920320887 1:205121649-205121671 ATATGAAAGTGGCCTCGGGAGGG + Intronic
921252715 1:213312426-213312448 CTGAGAAATTGGCACCTGGAAGG + Intergenic
921832591 1:219744714-219744736 TTGTGAAAATGGCAAGTGGCTGG - Intronic
923540308 1:234884096-234884118 ATGTGACAGTGGCAGGTGAAGGG + Intergenic
923545871 1:234922982-234923004 ATGGGAAAGTCCCCACTGGAAGG - Intergenic
923545896 1:234923110-234923132 ATGGGAAAGTTCCTACTGGAGGG - Intergenic
923545910 1:234923176-234923198 ATGGGAAAGTTCCTACTGGAGGG - Intergenic
1063533259 10:6856769-6856791 ATCAGAAAGAGGCACCTGGAAGG + Intergenic
1067400098 10:45964674-45964696 ATGTGTAAGTGGCAAAATGAAGG - Intergenic
1067868426 10:49933966-49933988 ATGTGTAAGTGGCAAAATGAAGG - Exonic
1068276916 10:54812240-54812262 AGAAGAAGGTGGCAACTGGAAGG - Intronic
1069433141 10:68355298-68355320 ATGTGAAAGTCTCCAATGGAAGG - Intronic
1071388817 10:85149390-85149412 ATGGGAAATTGGCAAGGGGATGG - Intergenic
1074186606 10:111103692-111103714 AGGTGAAAGGGGAAATTGGAAGG + Intergenic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1076459001 10:130625713-130625735 ACGTGAAAATGGAAACTGGATGG + Intergenic
1078391694 11:10940488-10940510 ATGGGAAAGTGGAAAGGGGAGGG - Intergenic
1078833917 11:15007193-15007215 GTGTAAAAGAGGCAACTGGCAGG + Intronic
1079315105 11:19400902-19400924 ATGTAATTGTGGCAACTGGTAGG + Intronic
1079658648 11:23014024-23014046 ATGTCAAAGTGAAAACTGCATGG - Intergenic
1080430061 11:32189717-32189739 ATGTGCCAGTGGCACCTGGTGGG + Intergenic
1081374201 11:42339778-42339800 ATGTTGAAGAGGCAGCTGGATGG + Intergenic
1081562044 11:44226676-44226698 ATGGGAAAGGGGCAGCTGGCTGG - Intronic
1081670844 11:44941706-44941728 ATGTGGCAGTGGCACCAGGATGG + Intronic
1084409981 11:69001306-69001328 ATCTGAAAATGACAACTGGCAGG + Intergenic
1086008472 11:82069055-82069077 CTATGATAGTGGCAACTGGCAGG + Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1087439221 11:98161550-98161572 ATGTCAAAGAGGCAGCTGAATGG + Intergenic
1087700400 11:101430714-101430736 ATGAGATGGGGGCAACTGGATGG + Intergenic
1088777604 11:113100619-113100641 ATGTCAAAGAGGCAGCTGAACGG - Intronic
1089485409 11:118841724-118841746 AAGTGAAAGTGGCAAGTGTATGG - Intergenic
1090023869 11:123151098-123151120 ATGTGAGAATGGCAGCAGGAAGG + Intronic
1090851254 11:130572431-130572453 AGGTGAAAGAGGAAACTGGGAGG + Intergenic
1093396959 12:18694238-18694260 ATGTGTAAGTGCCCACTGGGTGG + Intronic
1095273328 12:40248922-40248944 ATGTGGAAGAGGCAACAGCATGG + Intronic
1098792306 12:74839138-74839160 ATGTGAAAGGGAAAACTGTAAGG - Intergenic
1099438934 12:82677370-82677392 CATTAAAAGTGGCAACTGGAAGG - Intergenic
1100061956 12:90590406-90590428 TTGTGAAATTGGCCACTGAATGG - Intergenic
1101062796 12:100989236-100989258 AAGAGAAAGTGGGAACTGGAAGG + Intronic
1101148384 12:101863115-101863137 AAGTGAATGTGGGAACCGGAGGG + Intergenic
1104099258 12:125590851-125590873 ATGAGGAAGTGGCATCTAGAAGG + Intronic
1104323049 12:127770264-127770286 ATGTGATAGTGGCATCTGGAAGG + Intergenic
1110672438 13:78197108-78197130 ATGTGAAAGTAGAAACTAGGGGG - Intergenic
1110740236 13:78986747-78986769 ATGTGAAAGAGGAAACTCCATGG - Intergenic
1113252514 13:108470008-108470030 ATGTGAAGATGGCACCTTGAAGG + Intergenic
1116787379 14:49302523-49302545 ATGTGAAAGTAGCACTTGTATGG - Intergenic
1117197038 14:53350643-53350665 ATGTGAAAGTGACCACAGTAAGG - Intergenic
1117201119 14:53391131-53391153 ATGTGGGAGTGCGAACTGGAAGG + Intergenic
1119528153 14:75339230-75339252 ATCTAAAAGTGGCGACTTGAGGG + Intergenic
1119846545 14:77834764-77834786 AGGTGGTAGGGGCAACTGGAGGG - Intronic
1120629636 14:86874368-86874390 ATCTGAAAGTGTCAGCTTGATGG + Intergenic
1121619598 14:95337024-95337046 GTGTGAAAGTGGCCACAGCAGGG - Intergenic
1121722653 14:96121495-96121517 ATGTGAAAATGGCAAGAGGGTGG + Intergenic
1128604464 15:69026641-69026663 ATGTGAAAGAGGCAAGTGTTGGG + Exonic
1131832235 15:96361282-96361304 CTGTGACAGTGGCACCTGGAAGG - Intergenic
1133228534 16:4355015-4355037 ATGTGGAAGTGCCCACGGGAAGG + Exonic
1134365126 16:13570116-13570138 ATATGCAAATGGCAACTAGATGG - Intergenic
1134638128 16:15808199-15808221 CTGTGAAGGTGGCCACTGCATGG + Intronic
1137071189 16:35906239-35906261 AAGTAAAAGAGGCATCTGGAGGG + Intergenic
1138629929 16:58285438-58285460 ATGTAAGAATGGCCACTGGATGG + Intronic
1138631234 16:58295655-58295677 GTGAGAAAGTGGAAACTGGCTGG + Intronic
1139365946 16:66433759-66433781 TTGTGAAAGAGGCCACAGGATGG - Intronic
1139620719 16:68139505-68139527 ATGTGAAAATGGAAAGTAGAAGG + Intronic
1140600956 16:76474276-76474298 TTGTAAAAGTGGCAAGTGGCTGG + Intronic
1141617341 16:85217442-85217464 ATGAGAAGGTGGGAGCTGGAAGG + Intergenic
1141822821 16:86459364-86459386 AAGTGAAAATGGCAGCTGTAAGG + Intergenic
1143278172 17:5730255-5730277 GTGTCACAGTGGCTACTGGAAGG + Intergenic
1145282376 17:21477518-21477540 ATGTGAAGGTCACACCTGGAAGG - Intergenic
1146263127 17:31434383-31434405 CAGGGAAAGTGGCAAGTGGAGGG + Intronic
1150455158 17:65301304-65301326 ATGGGGAAGTGGCATCGGGAGGG + Intergenic
1150607693 17:66708261-66708283 AGGTGAAAGTGGCAAATGGCAGG - Intronic
1151624299 17:75267088-75267110 ATGTGGAAGTACCCACTGGATGG - Intronic
1153584761 18:6609738-6609760 ATTTGAAAGTGCCAACTTGGTGG + Intergenic
1155046249 18:22105959-22105981 ATGTGAAAGGGGAGAGTGGAAGG - Intergenic
1155196956 18:23484773-23484795 ATAAGAAAGTGGCAGATGGAGGG + Intronic
1155219752 18:23673413-23673435 ATGTGAAAGTGTCTGCTGCAGGG - Intergenic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1155866022 18:30965654-30965676 ATGTAAAAGTGGCAAAGAGATGG - Intergenic
1159394738 18:67841496-67841518 AGGTGAAATTGGAAGCTGGAAGG - Intergenic
1167758819 19:51430396-51430418 AAGTGAAAGTGGGAACTTGAGGG - Intergenic
1168416235 19:56170654-56170676 ATGTGGAAGCGGCCACAGGACGG - Intergenic
925587031 2:5474807-5474829 GTGTGAACGTGGCAAGTGGGTGG - Intergenic
925738224 2:6982705-6982727 TTGAGAAAGTGGCAACTTCATGG + Intronic
926540585 2:14175355-14175377 ATTTGAAAGTGGCCATTGGATGG + Intergenic
926735007 2:16067049-16067071 ATGGAAAGGTGGAAACTGGAAGG + Intergenic
927409047 2:22804640-22804662 CTGTGAAAGTGGCAAGAGGCTGG + Intergenic
927620183 2:24647777-24647799 ATGTGAAAGTGGCAACTGGAAGG + Intronic
928175043 2:29027826-29027848 ATGTCACAGAGGCCACTGGATGG + Intronic
928363898 2:30687167-30687189 AGGTGAAAGTGGAGGCTGGACGG + Intergenic
929986645 2:46740579-46740601 ATGAGAAAGTGGCACCTGTGAGG + Intronic
932706240 2:74027035-74027057 AAGTGAAAGTGAAAACAGGAGGG - Intronic
933513165 2:83266541-83266563 ATTTGAAAGGCGGAACTGGAGGG - Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934532668 2:95104772-95104794 ATCTGAAGGAGGGAACTGGAGGG + Intronic
934575366 2:95397241-95397263 ATGTGGGAGGGGCAGCTGGAGGG + Intergenic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
934974717 2:98792775-98792797 TGCTGAAAGTGGCAACTGCAGGG + Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936647530 2:114388972-114388994 ATGCCAAAGAGGCAGCTGGATGG + Intergenic
938052478 2:128187245-128187267 ATGTGTGAGTGGCTAATGGAAGG - Intronic
939767867 2:146275477-146275499 ATGGGAATGTGACAGCTGGAAGG + Intergenic
940627603 2:156194856-156194878 ATGTGAATGTGTAAAATGGAAGG + Intergenic
941099731 2:161282430-161282452 GTGTGACAGTAGCAAGTGGATGG - Intergenic
942180753 2:173378254-173378276 ATTTAAAAGTGGGAACTGGCCGG - Intergenic
942578474 2:177391921-177391943 ATGTGAAAGTGGTGACAGGATGG + Intronic
942770075 2:179506314-179506336 GTGAGACAGTGGCAACTGTAAGG + Intronic
944458744 2:199921985-199922007 AAGGGAAATGGGCAACTGGAGGG - Intronic
944522065 2:200581694-200581716 AAAAAAAAGTGGCAACTGGATGG + Intronic
944997075 2:205305466-205305488 AATTCAAAATGGCAACTGGAAGG - Intronic
946500625 2:220243708-220243730 TTTTGAAAGTGGCTTCTGGAAGG - Intergenic
947462436 2:230314986-230315008 ATGTTAGAGTGACAGCTGGAAGG + Intergenic
948148135 2:235723927-235723949 GTGTGAAAGTGGCAAAAGGAGGG + Intronic
1169785385 20:9354368-9354390 GTGTGTAGGTGGCCACTGGAGGG - Intronic
1174803418 20:53584620-53584642 ATGTGGCAGTGACAACTTGAAGG - Intronic
1178097043 21:29227085-29227107 ATGTGAAAATGGACACTGGCAGG - Intronic
1178942591 21:36918943-36918965 ATGTCTAATTGGAAACTGGAAGG + Intronic
1179087112 21:38227665-38227687 AACTGAATGTGGTAACTGGATGG + Intronic
1180561254 22:16616012-16616034 ATGTGGCAGTGACAACTTGAAGG + Intergenic
1180856343 22:19048225-19048247 ATGGGAAGGAGGCAGCTGGAGGG + Intronic
1180856435 22:19048771-19048793 ATGGGAAGGAGGCAGCTGGAGGG + Intronic
1182915099 22:34022073-34022095 ATGGGAAAGGGGCAAGTGAAAGG + Intergenic
1183179013 22:36245995-36246017 ATCTGAAAGTGAGACCTGGAAGG + Intergenic
1183534405 22:38388993-38389015 ATGTGGCAGTGACAACTTGAAGG - Intronic
949365459 3:3275747-3275769 ATGTGACAGTGAGAACTGCATGG - Intergenic
949570219 3:5285378-5285400 CTGTGATATTGGCAACTGGATGG + Intergenic
950025528 3:9817437-9817459 ATGTGAAAGGGGGGACAGGAGGG + Intronic
950202107 3:11052159-11052181 ATTGGAAGGTAGCAACTGGAAGG + Intergenic
953697829 3:45173449-45173471 CTGGGAAAGAGGCACCTGGATGG - Intergenic
953941152 3:47098852-47098874 ATATGATAGTGGCAATTAGAGGG + Intronic
955102382 3:55863009-55863031 ATGGGAAAATGGGAAGTGGAGGG - Intronic
956319028 3:67974728-67974750 GTGGGAAAATGGAAACTGGAAGG + Intergenic
957600481 3:82327806-82327828 AGGGAAAAGTGGCTACTGGAGGG - Intergenic
959802622 3:110512966-110512988 CTGTGAAAGTGGGAAAAGGAGGG - Intergenic
960364530 3:116754815-116754837 ATCTGAATGAAGCAACTGGAGGG - Intronic
964827299 3:160842780-160842802 ATGTCTAGGTGCCAACTGGAAGG + Intronic
965120414 3:164547481-164547503 AAGTGTATGTGGCAAGTGGAAGG + Intergenic
967713072 3:192731606-192731628 ATGTCAAAGAGGAAAGTGGACGG + Intronic
971479142 4:27098883-27098905 ATGTGCAAGTAGGCACTGGATGG + Intergenic
972229525 4:37055014-37055036 AGGTGAAAGAGGACACTGGAGGG - Intergenic
975971571 4:80044709-80044731 ATTTCTAAGTGGCAACAGGAAGG + Intronic
981210538 4:142098639-142098661 ATGTGAAAGAGGCGACTCAAGGG + Intronic
984484309 4:180347569-180347591 GTGTGAAAATGGCATCTCGAAGG - Intergenic
985013609 4:185609324-185609346 AAGTGAAAGTGGAAACCTGATGG - Intronic
985132703 4:186755366-186755388 AAGTGAAAATGGCAACTAGTGGG - Intergenic
985389031 4:189475603-189475625 ATGTGGAATTGGCAACTACAGGG - Intergenic
986009532 5:3699843-3699865 ATGTGCAAATGGCAACAGGACGG - Intergenic
986077768 5:4355934-4355956 TTGTGAAAGTGACCTCTGGAGGG + Intergenic
990224973 5:53640221-53640243 ATGTTAAAGTAGGAACTTGAAGG + Intronic
990983008 5:61618489-61618511 AAGTGAAAGAAGCATCTGGAAGG - Intergenic
990998973 5:61763968-61763990 ATCTCAAATTGGCCACTGGATGG - Intergenic
991497145 5:67237557-67237579 ATGGGTGAGTTGCAACTGGAAGG - Intergenic
992173631 5:74128008-74128030 AGCTGAAAGAGGCAACTGGAAGG - Intergenic
993302163 5:86224727-86224749 AAGAGAGAATGGCAACTGGAAGG + Intergenic
993865232 5:93186568-93186590 ATTTTATAGTGGCAACTGAATGG - Intergenic
994440386 5:99795897-99795919 AAGTGAAAGGGGCAAATGAATGG + Intergenic
994558480 5:101334813-101334835 ATGTATAAGTGGCAATTGAATGG - Intergenic
995225128 5:109692285-109692307 AGGTCAAAGTGGCTGCTGGAGGG + Intronic
995857681 5:116610639-116610661 ATGAGAAGGTGGCATCTGGGAGG + Intergenic
997146211 5:131436367-131436389 ATATGATACTGCCAACTGGAGGG + Intronic
998603200 5:143605935-143605957 ATGTGAGAGAGGAAACTTGAAGG + Intergenic
998621436 5:143798671-143798693 ATGTGATACTGGCAAATTGAAGG - Intergenic
1003579362 6:7325806-7325828 ATGTGAAAGTGGAAATTATAAGG + Intronic
1003714496 6:8631536-8631558 ATGCTGAAGTGGAAACTGGAAGG - Intergenic
1003718128 6:8669959-8669981 ATGTTAAAGTGGTTACTGCATGG + Intergenic
1004303332 6:14477929-14477951 ATGTTTAAGTGGCAATTAGAAGG + Intergenic
1006715639 6:36118196-36118218 ATTTTAAAGTGGCAGATGGATGG - Intergenic
1006739952 6:36301020-36301042 GTGTGAAAGAGCCAACTGAAAGG - Intronic
1006774125 6:36578562-36578584 ATGGGAATGTGGAAACTGGGAGG + Intergenic
1007853731 6:44832294-44832316 ATGAGAATGTGGCCTCTGGAAGG - Intronic
1010373922 6:75144280-75144302 ATGGGATAGTGGCAGATGGAAGG - Intronic
1010774965 6:79874909-79874931 AAATGAAATTGCCAACTGGATGG - Intergenic
1011778487 6:90759809-90759831 ATGAGAAAGTGCTAAGTGGAGGG + Intergenic
1014182595 6:118401713-118401735 ATGAGAAAGTAGCATTTGGATGG + Intergenic
1015706038 6:136088686-136088708 ATAGGAAAGTGACAACTGAAAGG + Intronic
1015948265 6:138524999-138525021 ATGTGTAAGTGGCAAATGGGCGG + Intronic
1017909154 6:158778075-158778097 CTGTGAAAGTGGCACCAGGTAGG + Intronic
1021626629 7:22600006-22600028 ATGGGAAACTGGCCATTGGATGG - Intronic
1027242384 7:76340181-76340203 TTGTGCAAGGGGCAACTGTATGG + Intronic
1028020847 7:85769043-85769065 ATGTGAAAGTGTGAAGTGGGAGG - Intergenic
1028491001 7:91411524-91411546 AGGTGCAGGTGGCAAATGGAGGG + Intergenic
1028502842 7:91538178-91538200 ATGTAACAGTGCCAACTGCATGG - Intergenic
1028761125 7:94497428-94497450 ATATCAAAGAGGCAGCTGGACGG - Intergenic
1029796066 7:102895752-102895774 ATGAGAAAGTGCCAATTGGGAGG - Intronic
1030553660 7:110996292-110996314 ATGGGAAAGTGGCCTGTGGAGGG + Intronic
1030738305 7:113077617-113077639 CTGTGAAAGTGGGAGCAGGAAGG - Intergenic
1031706607 7:124988460-124988482 ATATGAGAGAGGCAACTGGAAGG + Intergenic
1031871960 7:127097250-127097272 CTTTTAAAGTGGCAACTGAATGG + Intronic
1031965546 7:128025701-128025723 CTGTAAAAGTGGAAACTGCATGG + Intronic
1032763391 7:134966262-134966284 ATGAGAAAGTGGGAAAGGGAAGG - Intronic
1033050829 7:138002369-138002391 ATGTGAAAGGGGCGTCTGAAAGG + Intronic
1033681423 7:143599859-143599881 ATGTGAAAGTGACAGAGGGAAGG - Intergenic
1033703469 7:143861954-143861976 ATGTGAAAGTGACAGAGGGAAGG + Intronic
1034585655 7:152090024-152090046 ATATGATAATGGGAACTGGAAGG - Intronic
1034885960 7:154799066-154799088 AGGAGAAACTGGCATCTGGAAGG + Intronic
1034903550 7:154923553-154923575 TTGTGAGAGCGGCAACTGGACGG + Intergenic
1035190182 7:157160361-157160383 ATTTGAAAGTGGCTGCTGCAGGG - Intronic
1035925258 8:3721117-3721139 ATGCAAAAGTCGCAACTGGCCGG - Intronic
1036150220 8:6290124-6290146 ATGTGGAAGATGCAACCGGAAGG + Intergenic
1037774139 8:21821737-21821759 TTGTGAAAGTGTGAAGTGGACGG - Intergenic
1038272701 8:26088825-26088847 ATGTGGAAATGGCCACTAGATGG - Intergenic
1038491055 8:27971653-27971675 AAGTGAGGGTGGCATCTGGAAGG + Intronic
1039441094 8:37595805-37595827 ATGAGAAAGGGGAAACTAGATGG + Intergenic
1046505099 8:115126819-115126841 ATGTGAAAGCGGCAAAGAGAGGG + Intergenic
1048861227 8:138725506-138725528 ATTTGAAAGAGGCAAAGGGAAGG + Intronic
1052415160 9:28168365-28168387 GTGTGAAAATAGCAACAGGAAGG + Intronic
1053425605 9:38008087-38008109 ATGTGACAGGAGCACCTGGAGGG + Intronic
1053581927 9:39414184-39414206 ATGAGAAAGTGGAAACAGCAGGG + Intergenic
1054103506 9:60972916-60972938 ATGAGAAAGTGGAAACAGCAGGG + Intergenic
1054582847 9:66933920-66933942 ATGAGAAAGTGGAAACAGCAGGG - Intergenic
1055542709 9:77329438-77329460 ATTTGAAAGAGGCCATTGGAGGG + Intronic
1055686048 9:78775920-78775942 TTGTGAAACAGGAAACTGGAAGG + Intergenic
1056058499 9:82855964-82855986 AAGTAAAAGTGGAAACTGAAAGG + Intergenic
1056498231 9:87181858-87181880 AAGTGAAAGTGGTGACTGCAAGG + Intergenic
1057067091 9:92064965-92064987 ATGTGGATGTGGCAACATGAAGG + Intronic
1058257425 9:102785573-102785595 ATCTGGAAGTGGCAACAGGAAGG - Intergenic
1058309839 9:103486199-103486221 ATTTGAAAAGGGCAACTTGAAGG + Intergenic
1058625681 9:106930682-106930704 CTGTGAAGGTGAGAACTGGAAGG + Exonic
1059543115 9:115150036-115150058 ACGTGAAACTGGCAGCTGGAAGG - Intronic
1059953462 9:119491881-119491903 AGGTGAAAGTTACAACTGAAAGG + Intergenic
1060058469 9:120437121-120437143 ATGTGGAAGTGGTCACTGGGAGG + Intronic
1061912910 9:133734305-133734327 ATGGGGAAGTGGCAAGAGGAAGG - Intronic
1203392835 Un_KI270468v1:305-327 ATGTGTAAGTGGAAACTTGGAGG + Intergenic
1203568043 Un_KI270744v1:108393-108415 GTGTGACAGTAGCAAGTGGAAGG + Intergenic
1186192180 X:7076686-7076708 ATTGGAAAGTGGCAGCTGGTGGG - Intronic
1187432624 X:19238981-19239003 ATGTGCAAGTGACAACTATATGG - Intergenic
1188563571 X:31498918-31498940 ATGGAAAAGTGGTAACTGAAAGG - Intronic
1189881148 X:45493774-45493796 ATGTGAAAATGGCAGCTTGTGGG + Intergenic
1192248546 X:69392326-69392348 ATTTTAAAATGTCAACTGGATGG - Intergenic
1194156112 X:90391255-90391277 ATGGGAAAATGGCAAGAGGAAGG - Intergenic
1195203517 X:102572442-102572464 GTAGGAAAGTGGCAACTGGTAGG - Intergenic
1195321899 X:103727555-103727577 ATGAGAAAGGGGCAATTGGTGGG + Intronic
1195789133 X:108562065-108562087 ATCTGAAAGAGTCAAGTGGATGG + Intronic
1196274224 X:113748146-113748168 ATGAAAAATTGGCAACAGGATGG + Intergenic
1198085397 X:133277647-133277669 ATGTGAAACTGGCCAGTGGCTGG + Intergenic
1199787340 X:151117137-151117159 AAGTGAACTTGGCAACGGGAAGG - Intergenic
1200204992 X:154309355-154309377 TTGTGGATGTGGCAACAGGATGG + Exonic
1200502458 Y:3968228-3968250 ATGGGAAAATGGCAAGAGGAAGG - Intergenic
1202071976 Y:21001325-21001347 ATGTGAATGTAGCAACAGGAGGG - Intergenic