ID: 927621732

View in Genome Browser
Species Human (GRCh38)
Location 2:24667986-24668008
Sequence CCCCCACTAGAGTTCCACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927621728_927621732 30 Left 927621728 2:24667933-24667955 CCACAGTACTTTTTACATCTGAC 0: 1
1: 0
2: 1
3: 17
4: 178
Right 927621732 2:24667986-24668008 CCCCCACTAGAGTTCCACGAGGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927621732 Original CRISPR CCCCCACTAGAGTTCCACGA GGG Intronic
903827518 1:26156547-26156569 CCCCCACCAGAGATCCCTGAGGG + Intergenic
903879720 1:26500589-26500611 GCCCCACGAGAGTTCTTCGAGGG - Intergenic
908690878 1:66778966-66778988 CCCCCGCTGTTGTTCCACGAAGG - Intergenic
911732673 1:101306934-101306956 CCTCCACTAGACTTCCCTGAGGG - Intergenic
912838947 1:113021889-113021911 TCCTCACCAGAGTTCCACAAGGG + Intergenic
923040309 1:230315203-230315225 CCCCCACCAGAGTTCCCTGAAGG + Intergenic
923047049 1:230362991-230363013 CCCCCACTTGATTTCCTAGATGG - Intronic
923480186 1:234376487-234376509 CCGCTAAGAGAGTTCCACGAGGG - Intronic
1063180186 10:3591088-3591110 CCCCCACTGGAGATCCCAGAAGG + Intergenic
1076821872 10:132943484-132943506 CACCCACGAGAGTCCCACGTGGG + Intergenic
1080592137 11:33733718-33733740 TCCCCACTAGAGTTTAACTATGG - Intronic
1094412662 12:30183326-30183348 CCCCTTCAAGAGTCCCACGAAGG + Intergenic
1100027962 12:90152623-90152645 CCCGCACTCGAGGTCCAGGAGGG - Intergenic
1104043645 12:125146365-125146387 CCACCACTAGAGTTCTGGGAGGG - Intergenic
1113960930 13:114125841-114125863 CCCCCACCACAGTTCCACAACGG + Intronic
1117505154 14:56394822-56394844 CCCCCACTAGAGTGGTACAATGG - Intergenic
1119458961 14:74781944-74781966 CTCCCCCTGGAGTTCCACAAGGG + Exonic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1128746639 15:70119669-70119691 CCCCCACTACACTTCCACCTGGG - Intergenic
1167569259 19:50276745-50276767 CCCCCAATAAAGGTCCAAGAGGG + Exonic
1167813899 19:51861520-51861542 CTCCCACAAGAGTTCCAAAAGGG + Intronic
927621732 2:24667986-24668008 CCCCCACTAGAGTTCCACGAGGG + Intronic
931557211 2:63518783-63518805 ACCCCACTAGGGTACCACGTGGG + Intronic
1182067728 22:27442477-27442499 CCCCCACAAGACTTCCATTATGG + Intergenic
952252307 3:31666356-31666378 CCCCAACTAGAATTCCTGGAAGG - Intronic
957156236 3:76548880-76548902 CCCCCACTCCAGCTCCACCATGG + Intronic
965123589 3:164595370-164595392 CCCCCACTTGGGCTCCACCATGG - Intergenic
983462556 4:168046561-168046583 GCCCCACTCAAGTCCCACGAAGG - Intergenic
988676827 5:33441171-33441193 CACCCACTAGAGTCCCAGGCTGG - Intronic
1001696240 5:173672288-173672310 CCCCCACTGGAGTACCAAAAAGG + Intergenic
1024996013 7:55273698-55273720 ACCCCACTCGAGCTCCAGGAAGG + Intergenic
1029339659 7:99932764-99932786 CCCCCCCTAGACTTACAAGATGG - Intergenic
1033301742 7:140192378-140192400 CCACCCCAAGAGTTCCAGGAGGG + Intergenic
1040481511 8:47831627-47831649 CCCCCACCAGAGCGCCATGAGGG + Intronic
1048718744 8:137298540-137298562 CCCCTACTAGGGTTCCACACAGG - Intergenic
1052081353 9:24209917-24209939 CCCCCTCTAGAGTTGCAGTAGGG + Intergenic
1062158655 9:135067832-135067854 CCCTCACTAGAGCTCCCTGAAGG - Intergenic
1185467056 X:361428-361450 CCCCCACGAGAGGGCCACCATGG - Exonic
1186705505 X:12136295-12136317 CTCCCACTGGAGCTCCACAAGGG - Intergenic
1191214346 X:57920075-57920097 CCTCCTGTAGAGTTCCAGGAGGG - Intergenic