ID: 927624002

View in Genome Browser
Species Human (GRCh38)
Location 2:24693400-24693422
Sequence CTGGATATAATTAGTTTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 369}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927624002_927624005 5 Left 927624002 2:24693400-24693422 CCCTTAAAACTAATTATATCCAG 0: 1
1: 0
2: 2
3: 33
4: 369
Right 927624005 2:24693428-24693450 CTTTCTGTTCTATGAGATTTAGG 0: 1
1: 0
2: 0
3: 34
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927624002 Original CRISPR CTGGATATAATTAGTTTTAA GGG (reversed) Intronic
904059657 1:27698584-27698606 GTGAATATAATTACTGTTAAAGG - Intergenic
905517529 1:38572727-38572749 CTGGATATACTGATTTTTGAAGG + Intergenic
906763815 1:48408230-48408252 TTTTATACAATTAGTTTTAAAGG + Intronic
907655924 1:56341790-56341812 CTGGATCTTATTATTTTTTATGG - Intergenic
908998941 1:70195449-70195471 CTAAACATCATTAGTTTTAAAGG + Intronic
909092995 1:71250655-71250677 ATGGATATAATTATATTTTAAGG + Intergenic
909262788 1:73515173-73515195 CTGCATAGGATTTGTTTTAATGG + Intergenic
909315082 1:74206091-74206113 TTTCACATAATTAGTTTTAAAGG + Exonic
909689063 1:78385526-78385548 CTGGAATTAAATAGTTTTGAAGG + Intronic
910030796 1:82720162-82720184 CTGAATATTATTATTTTTTATGG + Intergenic
910547824 1:88439115-88439137 CAGGATCTAATTTGTTTTTAAGG - Intergenic
911355314 1:96810853-96810875 CTGTAGATAATTGGTTTTACAGG + Intronic
911493646 1:98602020-98602042 CTGGATTTTATTTCTTTTAAAGG - Intergenic
911530205 1:99035396-99035418 CAGGATTTTATTATTTTTAAAGG - Intergenic
911933709 1:103938832-103938854 TTTGAGATACTTAGTTTTAAAGG + Intergenic
912632764 1:111261090-111261112 CAGGATCTAATTATTTTTTATGG + Intergenic
913005669 1:114628755-114628777 CAGAATATAATTAGGTTAAAGGG - Intronic
913543138 1:119841126-119841148 CAGCATCTATTTAGTTTTAAAGG - Intergenic
913613860 1:120536087-120536109 CAGCATTTAATAAGTTTTAATGG + Intergenic
914576407 1:148974807-148974829 CAGCATTTAATAAGTTTTAATGG - Intronic
914801516 1:150965975-150965997 CTGGTTAGAATTTGGTTTAAAGG + Exonic
916038955 1:160946004-160946026 CTGAGTATAATTTATTTTAATGG - Intronic
918016269 1:180635948-180635970 AAGGATATTATTAATTTTAAAGG - Intronic
919123927 1:193374225-193374247 CTGAATATCATTAGTTATTACGG - Intergenic
919262314 1:195212444-195212466 CTGGATATAATTAGTGGTCTTGG - Intergenic
919344365 1:196356107-196356129 CTAGTTATAATTATTTTAAAGGG - Intronic
921150782 1:212401099-212401121 CTGAATATATTTACTTTAAAAGG - Intronic
922128304 1:222751443-222751465 ATGGCTATAATTAATTTTATGGG + Intergenic
922442595 1:225668518-225668540 CTGGAAAGAATTTATTTTAAGGG - Intergenic
922694069 1:227718797-227718819 TTGGTTATAACTAGTTCTAAGGG - Intergenic
923346771 1:233061279-233061301 GTGCATATAATCAATTTTAAAGG - Intronic
1062935068 10:1379420-1379442 CTGGAGATAGCAAGTTTTAAGGG - Intronic
1063733053 10:8721512-8721534 CAGGACATAGTCAGTTTTAAGGG + Intergenic
1063740205 10:8809108-8809130 CTGGATCTAATCAGTTCTGAAGG - Intergenic
1064959859 10:20952116-20952138 CTGGAAATGAAAAGTTTTAAAGG + Intronic
1065426476 10:25609640-25609662 CAGGATTTTATTATTTTTAATGG + Intergenic
1065449958 10:25846820-25846842 CTTGATAAAATTAGTTTAAATGG + Intergenic
1065461938 10:25976867-25976889 CTGGATGCAATTATTTTTAAAGG + Intronic
1065585699 10:27215299-27215321 ATGTATATTATTAGTTATAATGG + Intronic
1066036006 10:31484680-31484702 CTGGTTATTCTTAGTTTTTACGG + Intronic
1066149435 10:32599412-32599434 CTTAATATAATTACTGTTAAGGG + Intronic
1066583313 10:36904203-36904225 ATTGATATCATTAGGTTTAAAGG - Intergenic
1068476508 10:57533348-57533370 CTGGATTTAATTAATTTTGAGGG - Intergenic
1068501902 10:57850221-57850243 CTTGATATATTCAGTTTAAAGGG + Intergenic
1070109389 10:73468982-73469004 CTGTACATAAATAGTGTTAATGG - Intronic
1070486504 10:76937015-76937037 CTGGATATCCTTAGTTATAAAGG + Intronic
1071095573 10:81970330-81970352 CTAGATATAATCAGTGTTAAAGG + Intronic
1072951207 10:99848100-99848122 CTGGACATAGGGAGTTTTAAAGG + Intronic
1073796505 10:106994164-106994186 CTAGATTTAATTAGTTTTAATGG - Intronic
1077294186 11:1816712-1816734 CTGGAAATATATATTTTTAAAGG - Intergenic
1078708657 11:13769121-13769143 ATGGATAGAATTCGTTTTCATGG + Intergenic
1078790495 11:14537162-14537184 CTAGAAAACATTAGTTTTAAAGG - Intronic
1078941261 11:16008787-16008809 GTGGATATAAACAGTTTTAGAGG - Intronic
1079715818 11:23743067-23743089 CAGAATATAAATAATTTTAATGG - Intergenic
1080260033 11:30338932-30338954 CTGCATAAATTGAGTTTTAATGG - Intergenic
1080543052 11:33287735-33287757 CTGGTTATTTTTATTTTTAATGG + Intronic
1083229578 11:61307726-61307748 CTGGATATACTCAGTTTCAGTGG - Intronic
1085612435 11:77963927-77963949 CTTGATATGAATAGTTTTTAAGG + Intronic
1085927699 11:81040832-81040854 CTAGATATACTTACTTTTCAAGG + Intergenic
1086208020 11:84283808-84283830 CTTGATATTATTACTATTAATGG + Intronic
1086412093 11:86553281-86553303 CTGGATGTAATTAGCTTTGGTGG + Intronic
1086613629 11:88787867-88787889 CTGGATATGTTAAGTTTGAAAGG + Intronic
1087282124 11:96222740-96222762 CTGCATATATTTAACTTTAAGGG - Intronic
1087503022 11:98983620-98983642 CATGATTTAATTAGTTTTTATGG + Intergenic
1089887316 11:121839956-121839978 CTGGATTAAATTATCTTTAAGGG + Intergenic
1091653919 12:2330467-2330489 CAGGATATCATGAGTATTAAAGG - Intronic
1092685824 12:11044772-11044794 TTGGATATAAGCTGTTTTAACGG - Intronic
1093092092 12:14933461-14933483 CTGGATAAATGTAGTTTTAATGG + Intronic
1093120299 12:15262792-15262814 CTGGATATAAATAATTTGAAAGG + Intronic
1093246605 12:16745899-16745921 CTGGATCTCATTATTTTTTATGG - Intergenic
1093892600 12:24541251-24541273 CAGGATATTAGTAGTTTTCAAGG - Intergenic
1094430078 12:30358763-30358785 CTGCACATAATTAGGTTTGAGGG + Intergenic
1095323264 12:40856469-40856491 CTGGAGATAATGAGTTTATAGGG + Intronic
1095736317 12:45560358-45560380 TTGGATATACTTACTGTTAAAGG - Intergenic
1097346654 12:58500806-58500828 CTAGATATAAGTAGCTTTTAAGG + Intergenic
1097724554 12:63059827-63059849 CTTAAAATAATAAGTTTTAAAGG - Intergenic
1098037524 12:66320328-66320350 ATGGATATAATAAGGTTAAAAGG - Intronic
1099585305 12:84506628-84506650 TTGGATATAATGAGTTAGAAGGG + Intergenic
1100143776 12:91652149-91652171 ATGGTTATAATAAATTTTAATGG - Intergenic
1101981235 12:109408763-109408785 ATGTATTTATTTAGTTTTAAAGG - Intronic
1102639358 12:114353025-114353047 GTTGATAAAATTAGTTTCAAAGG + Intergenic
1102784582 12:115594197-115594219 TTGGATACAAGTAGTTTTATTGG + Intergenic
1104402490 12:128487916-128487938 TTGGTTTTAATTAATTTTAATGG - Intronic
1106693409 13:32144913-32144935 GAGGAAATAATTAGTTTTAACGG + Intronic
1107676186 13:42799708-42799730 CATGATTTAATTATTTTTAATGG - Intergenic
1107867879 13:44720697-44720719 CTGGCTTTAATTAGTTATAATGG - Intergenic
1108084923 13:46777285-46777307 TTAGATATAATTAATTTTATAGG + Intronic
1108382271 13:49865924-49865946 CTGTATATACTTCTTTTTAATGG - Intergenic
1108610950 13:52083352-52083374 CTGTGTATAATTTGTGTTAAAGG - Exonic
1109121568 13:58464253-58464275 CTGAATATAATTAGATGAAATGG + Intergenic
1109724113 13:66316680-66316702 GAGGATATCATTATTTTTAAAGG - Intronic
1111462606 13:88566685-88566707 GTGAATATAATTAATTTTAATGG + Intergenic
1112472822 13:99704721-99704743 GTTGATATAATTAATTTAAAAGG + Intronic
1112522442 13:100108944-100108966 ATTGATATGATTAGTTTTATTGG + Intronic
1112635188 13:101209256-101209278 CTGGATGTTATTAATCTTAATGG - Intronic
1114901134 14:27059774-27059796 CTGGAAATAATGAGTTTACAAGG + Intergenic
1115172078 14:30519948-30519970 CTATATATAATTACTTTGAAGGG + Intergenic
1115380132 14:32727320-32727342 CTAGCTATATTTATTTTTAAAGG + Intronic
1115745716 14:36435354-36435376 ATGAAAATAATTATTTTTAATGG - Intergenic
1116030977 14:39571127-39571149 CAGGATTTTATTATTTTTAATGG + Intergenic
1116556839 14:46321880-46321902 CTGGACATAATAAGTATGAAAGG + Intergenic
1116745707 14:48815967-48815989 CGAGATATAATTAATTTTTATGG - Intergenic
1117503959 14:56382172-56382194 CAGGATGTCATTAGTTTTTATGG + Intergenic
1118107789 14:62680203-62680225 CTTGAAATAATGAGTTTTCAAGG - Intergenic
1120169251 14:81232544-81232566 CAAGATAGAAGTAGTTTTAATGG - Intergenic
1120346381 14:83296024-83296046 CTGATTTTAAATAGTTTTAAAGG - Intergenic
1120983756 14:90314579-90314601 CTGGGGAAAATGAGTTTTAAAGG - Intronic
1121420759 14:93811978-93812000 CTGGTTGTAACTAGTTTTACAGG + Intergenic
1121956830 14:98221405-98221427 CTGTATATATTTACTTTTTATGG - Intergenic
1122831582 14:104399988-104400010 CTGGAGATAATTAGTTCTAACGG + Intergenic
1124112138 15:26800471-26800493 TTGTTAATAATTAGTTTTAATGG - Intronic
1125672484 15:41484216-41484238 CTGGCTATCATGAGTTTGAAGGG + Intergenic
1125808184 15:42513057-42513079 CTGGCTGGAATTAGTATTAAAGG + Intronic
1126032573 15:44513799-44513821 CAGAATGTAAATAGTTTTAATGG + Intronic
1126257934 15:46650175-46650197 CTGGATATAAATATTTTAAAAGG + Intergenic
1126388168 15:48115616-48115638 CTGGAAAGAATTAGATATAAAGG + Intergenic
1126995853 15:54444034-54444056 GTGGATATTATTAGATCTAAAGG - Intronic
1127423070 15:58827429-58827451 ATGGATACAATTTTTTTTAATGG - Intronic
1128272392 15:66322241-66322263 CTGTATAAAATTATCTTTAAGGG + Intronic
1128846492 15:70901809-70901831 CTTGATAAAATTTTTTTTAATGG + Intronic
1130771464 15:86928104-86928126 CTTGATATTCTTAGTTTAAATGG - Intronic
1132195535 15:99912097-99912119 CTCAAGATAAGTAGTTTTAAAGG + Intergenic
1134258074 16:12627716-12627738 CTGGATAAAAAAAGTGTTAATGG - Intergenic
1137328298 16:47463030-47463052 CTGGATATAAAAAGTGTTATTGG + Intronic
1138256110 16:55562882-55562904 CTGACTATAACTAGTATTAAAGG + Intronic
1139057379 16:63201519-63201541 CTAGATATAATTAATTTTTATGG + Intergenic
1139242664 16:65410168-65410190 CTGGCAAGAGTTAGTTTTAAAGG + Intergenic
1139807020 16:69575480-69575502 CTTTATAAAATTAGTTTTACAGG + Intronic
1140633771 16:76886901-76886923 CTCGATATAATTAGTTCAGAAGG + Intergenic
1142949697 17:3468158-3468180 CTGGATATTATTACTCTTTAAGG - Intronic
1143049371 17:4111357-4111379 GTGAATAAAATTATTTTTAATGG + Intronic
1143312836 17:6007427-6007449 CTTAATATAATTAGTTTTTTTGG + Intronic
1143577348 17:7802005-7802027 CTGGATATAAGAAGTATGAAGGG + Exonic
1143690969 17:8565392-8565414 ATGGACCTAATTATTTTTAATGG + Intronic
1144491474 17:15715320-15715342 CAGGATATATTAAGTTTAAAAGG - Intronic
1144909013 17:18663885-18663907 CAGGATATATTAAGTTTAAAAGG + Intronic
1146200905 17:30857670-30857692 ATAGATATAATTAGTTCAAAGGG + Intronic
1149067854 17:52501512-52501534 CTTGATCTAATTAGTTTGGAAGG - Intergenic
1149631307 17:58126798-58126820 CTGTAAATAAATAGTTGTAATGG - Intergenic
1151172421 17:72258322-72258344 CTGGATATAATAAGGTTCAGAGG - Intergenic
1151510127 17:74553343-74553365 CTGGGCAACATTAGTTTTAATGG + Intergenic
1152843032 17:82582067-82582089 CTGGATTAATTTACTTTTAATGG + Intronic
1155747540 18:29377664-29377686 CTGAATATAATTAGTATATAGGG - Intergenic
1155790185 18:29957575-29957597 CTGTAAACAAATAGTTTTAACGG - Intergenic
1156638530 18:39061369-39061391 CTGGAGTTAATCAGTTTTATTGG + Intergenic
1158273233 18:55739141-55739163 CTGTATATAATTATGCTTAAGGG + Intergenic
1158751812 18:60270868-60270890 CTGGATATGCTTGGTTTTGAAGG + Intergenic
1158898488 18:61938488-61938510 ATGGAGACAATGAGTTTTAAAGG - Intergenic
1159394284 18:67836080-67836102 CTGGATCTCATTCTTTTTAATGG + Intergenic
1159622375 18:70653317-70653339 ATTGATATAATTAATGTTAACGG - Intergenic
1162466213 19:10842554-10842576 CTGGCTAAAATAATTTTTAATGG + Intronic
1162690095 19:12422462-12422484 CTAGAGATAATTAGCTGTAATGG + Intronic
1166477100 19:43136553-43136575 CTCGATATTATTAGTTATCAAGG + Intronic
1167964211 19:53130378-53130400 CTGGACACAATTAATTTCAAAGG + Intronic
1168232054 19:55038885-55038907 CCGGCTATAATTTTTTTTAATGG + Intergenic
1168378806 19:55903133-55903155 CTAATTATAATTAGTTATAATGG + Intronic
925596682 2:5562417-5562439 CTGGATATAATTGTTTTTCATGG - Intergenic
925626161 2:5843688-5843710 CTGGAAATAAATAGATTAAAAGG - Intergenic
927624002 2:24693400-24693422 CTGGATATAATTAGTTTTAAGGG - Intronic
927766387 2:25812618-25812640 CCAAATATATTTAGTTTTAATGG - Intronic
927766522 2:25814112-25814134 CTGGATATAATTTTCTTTGAAGG + Intronic
930566385 2:53025808-53025830 CAGGATATAATTATTTTTTATGG - Intergenic
931345611 2:61442952-61442974 CAGGATTTCATTATTTTTAATGG - Intronic
932856909 2:75243548-75243570 CTGCATATAAATAGTCTCAACGG + Intergenic
932906519 2:75758977-75758999 CTCGATGCAATTACTTTTAAGGG - Intergenic
933381075 2:81546505-81546527 CTGGATGCACTTAGTTTGAAAGG + Intergenic
934910127 2:98245127-98245149 CTGGATAATATTTGATTTAAGGG - Intronic
936054406 2:109250820-109250842 CTGGATATAATTATTTCCCAGGG - Intronic
937039001 2:118806814-118806836 CTGGATATATAAAGTTGTAATGG - Intergenic
937547246 2:123037246-123037268 CTGGAAAAAAATAGGTTTAACGG + Intergenic
938851762 2:135267735-135267757 CTGGATATAAATATTTAAAATGG - Intronic
939230402 2:139417535-139417557 CTGAATATCTTTAGATTTAATGG + Intergenic
939774186 2:146363741-146363763 CTGCATATATTTTGTTTGAATGG + Intergenic
939871404 2:147530115-147530137 CTTGACATAATTATTCTTAAAGG - Intergenic
940062817 2:149591509-149591531 CTGGACATACTTAGTTTGGAAGG - Intergenic
940545850 2:155083995-155084017 CTGAATATATTTAAATTTAAAGG - Intergenic
940573829 2:155474143-155474165 CTGAATATATTTAAATTTAAAGG - Intergenic
941413089 2:165185123-165185145 CTGGAACTAATTAATTTTTAGGG + Intronic
941526728 2:166615151-166615173 TTGGATAAAATTAGCTATAATGG - Intergenic
942371534 2:175290893-175290915 CTGCATATACTTAGTTTTCTAGG + Intergenic
942771994 2:179532677-179532699 CTGATTATAATTAGTATTACAGG - Intronic
942779834 2:179629197-179629219 CTAGACATAATCAGTTTCAATGG - Intronic
942843357 2:180391813-180391835 CAGGATCTCATTATTTTTAATGG + Intergenic
943341553 2:186688183-186688205 ATGGCTATAATTTTTTTTAATGG - Intergenic
943804637 2:192109079-192109101 CTGGAAATAAGTAGTGGTAATGG + Intronic
943913667 2:193600734-193600756 CAGGATCTAATTATTTTTTAAGG - Intergenic
944031512 2:195240272-195240294 CTGGATTTAGGTAGTTCTAAAGG - Intergenic
944222921 2:197320328-197320350 CTGGATATGAATAGTTTCAAGGG - Intergenic
944307059 2:198190672-198190694 GTGGAAATAATTCTTTTTAAAGG + Intronic
945522295 2:210843872-210843894 GGGGCTATAACTAGTTTTAATGG - Intergenic
945772726 2:214064691-214064713 TTGGTTTGAATTAGTTTTAATGG + Intronic
1169180335 20:3560317-3560339 CTGGATGTCATTCTTTTTAACGG + Intronic
1169747399 20:8956524-8956546 CTGGATATTATGTCTTTTAAAGG + Intronic
1170269540 20:14509014-14509036 CTGAAAATTATAAGTTTTAATGG - Intronic
1170531477 20:17296988-17297010 CTTTATATATTTATTTTTAAGGG + Intronic
1170730280 20:18968638-18968660 CTGGATTTATTGATTTTTAAAGG - Intergenic
1172818514 20:37710802-37710824 ATCGATATAATTAGATTTCACGG - Intronic
1173636762 20:44566183-44566205 TTGTAAATAATTAGTTTTATTGG + Intronic
1175406768 20:58739586-58739608 CTCGATATCATTAGTTATCAGGG + Intergenic
1177105682 21:16952708-16952730 CTGGATGTCATTCGTTTTTATGG - Intergenic
1177354455 21:19989421-19989443 CTAGTTATAATCATTTTTAATGG + Intergenic
1177362408 21:20090358-20090380 CTGGAAATCATTAGTCTTTAGGG - Intergenic
1177399004 21:20577670-20577692 GTGGATATAATTGTTCTTAAAGG - Intergenic
1181260568 22:21594198-21594220 CTGTATATAATTTGTTCTCATGG + Intronic
950531577 3:13555250-13555272 CTGCTTATACTTACTTTTAAAGG + Intronic
951022502 3:17796456-17796478 CTTAATATAATTAGTTATCAGGG - Intronic
951662167 3:25079877-25079899 CTGTATGTAATGAGTTGTAAAGG + Intergenic
951963983 3:28361843-28361865 ATGGCTATAATTTTTTTTAAAGG + Intronic
952072798 3:29659308-29659330 CTAGATATAAATAGTGTTAATGG - Intronic
952411109 3:33050930-33050952 CTGGACAAAATAATTTTTAAGGG - Intronic
952834782 3:37593622-37593644 CAGGATATAATTCGGTTTAGAGG - Intronic
953421323 3:42755701-42755723 CTGGATTTAAGTGGTTTTCAGGG + Intronic
953861537 3:46548252-46548274 TGGTATATAATTATTTTTAATGG - Intronic
953965605 3:47303287-47303309 CTGTGTATAATGAGCTTTAAAGG + Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
957268326 3:77996635-77996657 CAGGAGACAATTTGTTTTAAGGG - Intergenic
957864640 3:86006042-86006064 CTGGATCTCATTAGTTTTTATGG + Intronic
958872128 3:99572388-99572410 CTGCATCTTATAAGTTTTAACGG + Intergenic
959442444 3:106394617-106394639 CATGATACAATTATTTTTAATGG - Intergenic
959848793 3:111064176-111064198 GTTCATATAATTAGTTTAAAAGG - Intergenic
960635056 3:119776777-119776799 ATGGATATAATTTTTTTTAATGG + Intergenic
963345040 3:144085635-144085657 ATCAATATAATTAGTTTTTAAGG + Intergenic
963345097 3:144086852-144086874 ATCAATATAATTAGTTTTTAAGG - Intergenic
963460036 3:145600379-145600401 ATGGAACTAATTAGTTTGAAGGG - Intergenic
965316919 3:167203434-167203456 CTGCATATAATTGGTGTTATGGG - Intergenic
965396304 3:168163951-168163973 GTGGATGTAAGTAGTTTTGACGG + Intergenic
966283767 3:178268438-178268460 GTGGAAATAATTACTTTAAAAGG - Intergenic
968202840 3:196770256-196770278 CTGTATATATATACTTTTAATGG - Intronic
971436655 4:26633261-26633283 CTGTATATAATGAGCCTTAAAGG + Intronic
971524476 4:27599389-27599411 ATGGATATTATTACTTTTTAAGG - Intergenic
971563327 4:28110387-28110409 CATGATATAGTTAGTTTTCAAGG - Intergenic
971798804 4:31261550-31261572 CTGTATATAATTATTTCTACTGG + Intergenic
971911884 4:32804681-32804703 CTGGTTATAATTGGTCTTCAGGG - Intergenic
972415693 4:38838412-38838434 CAGGATTTAATTATTTTAAATGG - Intronic
972837187 4:42886364-42886386 GTTGATATTATTAGTTATAAAGG - Intergenic
973129626 4:46634763-46634785 CTGGATATAAAAATTTTTAATGG + Intergenic
973228416 4:47813242-47813264 CTGGATATTTTTAGTTTTTGAGG - Intronic
974370385 4:61009416-61009438 ATGTATATAATTAATTCTAATGG + Intergenic
975365787 4:73525995-73526017 TTTGATATAATTAACTTTAACGG + Intergenic
975550638 4:75609119-75609141 CTAGAGAAAGTTAGTTTTAATGG + Intronic
975927431 4:79475374-79475396 TTGGATATGACTATTTTTAATGG + Intergenic
975970727 4:80033042-80033064 CTGAAGATAATTAGATTTTAAGG + Intronic
976823826 4:89237016-89237038 CTGCTTATTATTATTTTTAATGG + Exonic
977324607 4:95559160-95559182 CTGGAAAAAATTTTTTTTAAAGG + Intergenic
978051035 4:104200471-104200493 CTGGATTTATTGATTTTTAAAGG + Intergenic
979397618 4:120207352-120207374 CTTGATAGAAGTAGTTTCAATGG + Intergenic
979568892 4:122192318-122192340 CTGGATATAGTTTGTGGTAAAGG + Exonic
980482247 4:133401859-133401881 CTGGATTTAATTATTGTTATTGG + Intergenic
980687082 4:136242405-136242427 CTGGATTTCATTATTTTTTATGG - Intergenic
980894561 4:138849808-138849830 ATTTATATAACTAGTTTTAATGG - Intergenic
982005092 4:151056018-151056040 CTTGATATTAATAGTTTTCAGGG + Intergenic
982296907 4:153838208-153838230 CTACATACAATTACTTTTAAAGG - Intergenic
983078586 4:163356602-163356624 CTCCATGTAATTTGTTTTAAAGG + Intergenic
983195136 4:164798539-164798561 CCTGATATAATGATTTTTAAAGG + Intergenic
983348398 4:166556589-166556611 CTGGATCTCATTATTTTTTATGG + Intergenic
984239268 4:177198092-177198114 CTGGATCTCATTACTTTTTATGG + Intergenic
985081248 4:186266624-186266646 CTGGAGATAAATAGATTTATAGG + Intronic
986108829 5:4689911-4689933 CTGCATATAATTAGTTGGAGGGG - Intergenic
986204556 5:5611225-5611247 GTGGATATGATTTATTTTAAGGG - Intergenic
988398795 5:30733739-30733761 CTGTAGATATTTAGTTTGAATGG + Intergenic
988677157 5:33443877-33443899 CTGGATTTAATAAACTTTAAAGG - Intronic
988848005 5:35149445-35149467 CTGGATATTATTATTATCAAAGG - Intronic
988939858 5:36133217-36133239 CTGGATCTCATTCTTTTTAATGG - Intronic
990018320 5:51094107-51094129 CTGCATGTAATGAGTTGTAAAGG + Intergenic
990852853 5:60226860-60226882 CTGGATATTAATATTTTAAATGG + Intronic
992126918 5:73651692-73651714 CTGAATATGATCATTTTTAAAGG - Intronic
992589787 5:78282555-78282577 CTAAATATATTTACTTTTAATGG - Intronic
992905475 5:81341392-81341414 CTGAATTTACTTAGATTTAAAGG + Intronic
992918274 5:81482241-81482263 CCAGATTTAATAAGTTTTAAGGG + Intronic
993132610 5:83918283-83918305 CAGGGTAAATTTAGTTTTAAAGG - Intergenic
993372302 5:87108092-87108114 TTGGGTATATTTAATTTTAAGGG - Intergenic
994374923 5:99008474-99008496 CTTGATATTATAAATTTTAATGG - Intergenic
994845061 5:104978166-104978188 TTGGATATAATTATATTTAAAGG + Intergenic
994893121 5:105664944-105664966 CTGGATCTCATTCTTTTTAATGG + Intergenic
995121604 5:108541451-108541473 CTGGAGATAGATAGTGTTAATGG + Intergenic
996078048 5:119220829-119220851 CTGAAGAAAATTAATTTTAAAGG + Intronic
996387093 5:122920412-122920434 CTGAAAATAATTATTTTGAATGG + Intronic
997867243 5:137475261-137475283 CTGGATATTGTTATTTTTCAAGG - Intronic
997923959 5:138010533-138010555 CTGGATATTAATAGTTTAAGTGG - Intronic
997954283 5:138266342-138266364 ATGGTTATAATTTTTTTTAATGG - Intronic
998016764 5:138738365-138738387 CTGAAAAGAAATAGTTTTAAAGG - Intronic
998159017 5:139802717-139802739 GTGGATTTCATTAGTGTTAAGGG + Intronic
999487720 5:152015835-152015857 CAGGAAAAAATTTGTTTTAATGG - Intergenic
1000357128 5:160409736-160409758 TTGGATAGAATCACTTTTAATGG - Intronic
1001018360 5:168162044-168162066 CAGGTAATATTTAGTTTTAAGGG - Intronic
1004296575 6:14417254-14417276 CTGGAAAGCATTAGCTTTAATGG + Intergenic
1004694131 6:18018368-18018390 CTGCATAGCATTAGTTCTAAAGG - Intergenic
1004723479 6:18289430-18289452 TGGGATATAAATAGTGTTAATGG + Intergenic
1005103837 6:22202013-22202035 CTGGAGATAGGTAGTTTTGATGG + Intergenic
1005285985 6:24327396-24327418 ATATATATAATTAGTTTTCATGG + Intronic
1005465757 6:26110913-26110935 GTGGATATCATTTGTTTTTATGG - Intergenic
1007000893 6:38311402-38311424 CAGGATATAATTCCTTTTTATGG + Intronic
1008028576 6:46667073-46667095 CTTGATAAAATCAGTTTCAAAGG - Intronic
1008045298 6:46845518-46845540 ATGGATATAATTATTTCTACAGG + Intergenic
1008243976 6:49148053-49148075 CTGGATTTATTGATTTTTAAAGG + Intergenic
1008246588 6:49182173-49182195 CTGGACATAACTAGTCTTTAAGG + Intergenic
1008327577 6:50202800-50202822 CTGGATATGATGAGTTTTAGGGG - Intergenic
1009429420 6:63549519-63549541 CCTGATTTAATTATTTTTAAAGG + Intronic
1009534576 6:64864076-64864098 CTGGATAAAATATATTTTAAAGG - Intronic
1010336676 6:74692665-74692687 TTGGATATAAGTCATTTTAACGG + Intergenic
1010469760 6:76213246-76213268 ATGGATATGTTTTGTTTTAAAGG + Intergenic
1011654632 6:89539976-89539998 CTGGATCTCATTATTTTTTATGG + Intronic
1012257818 6:97054727-97054749 ATGGCTATCATTAGTTTTTAAGG - Intronic
1012331238 6:97990682-97990704 TTGGATAAAACAAGTTTTAAAGG + Intergenic
1013451971 6:110290946-110290968 CTGAATATGATTAGTTATTAGGG - Intronic
1014327271 6:120014423-120014445 CTGGCTATAATAATTTTTAAGGG + Intergenic
1015089815 6:129342159-129342181 TTTGATATAAATATTTTTAAAGG - Intronic
1015739740 6:136441304-136441326 TTGCATATAAGTGGTTTTAATGG - Intronic
1015959957 6:138638026-138638048 CAGGATCTAATTCTTTTTAATGG - Intronic
1017446687 6:154512376-154512398 CTGGATGTCATTAAGTTTAAAGG - Intergenic
1018534376 6:164804862-164804884 CTATATATTATTAGTTTTTAAGG + Intergenic
1020642411 7:10772102-10772124 CTGTTTATTATTAGTTTTACTGG - Intergenic
1024952143 7:54875029-54875051 CTGCATATAGTTAGTCATAAGGG - Intergenic
1028058142 7:86274638-86274660 TTCAATATAATTATTTTTAAAGG - Intergenic
1028755726 7:94431954-94431976 CAAGATTCAATTAGTTTTAAAGG + Intergenic
1028760193 7:94487498-94487520 CAGGATTTAATTATTTTTAATGG + Intergenic
1030015808 7:105219457-105219479 TTGAAGATCATTAGTTTTAAAGG - Intronic
1030830463 7:114213052-114213074 CTGGATAGAATTTTTTTTAAAGG + Intronic
1031090698 7:117350070-117350092 CTGGACAGAAGTAGTTTTTAAGG - Intergenic
1031191356 7:118555858-118555880 CTGAATATAATTAATTAAAAGGG + Intergenic
1031449808 7:121900933-121900955 ATGGATATAATAAGTCTTACAGG - Intronic
1031940191 7:127780428-127780450 CTGGACATAAGTACTTTAAAAGG - Intronic
1031940436 7:127783075-127783097 CTGGATATATTTCCTTTAAAGGG + Intronic
1032319529 7:130873438-130873460 CTGTAAATGATTACTTTTAATGG + Intergenic
1032816452 7:135479951-135479973 CAGAATTTAATTAGTTTTAAAGG - Intronic
1034607045 7:152326577-152326599 CTGAATTTAATGAATTTTAATGG - Intronic
1034952559 7:155309755-155309777 CTGGAGTTAATTTGTTTTACAGG + Exonic
1036595070 8:10204713-10204735 CTGTATATATGTATTTTTAATGG + Intronic
1036714272 8:11106284-11106306 CTGCACATGATTAGTTTTACTGG + Intronic
1037077164 8:14734739-14734761 CTGTCTATTATTATTTTTAATGG + Intronic
1037159357 8:15749493-15749515 CTTGGTATATTTATTTTTAATGG - Intronic
1037171821 8:15901793-15901815 CACAATATAATTAATTTTAATGG - Intergenic
1037188704 8:16095988-16096010 CTGAACAAAATTAATTTTAAGGG + Intergenic
1038301977 8:26359892-26359914 CTAGCTTTAATTACTTTTAAGGG + Intronic
1038306241 8:26405744-26405766 CTGGTCATAGTCAGTTTTAAGGG - Intronic
1038942028 8:32315403-32315425 CTGGATATCATTCCTTTTTATGG + Intronic
1038997126 8:32936066-32936088 CTGGAAAGAAATAGTTTTTAAGG + Intergenic
1039760901 8:40574150-40574172 CTGGATATTATTAAATTTAAAGG + Intronic
1039931864 8:41999530-41999552 CTGGATAAAAATAGTATTTAAGG - Intronic
1040740416 8:50568179-50568201 CAGGATTTCATTATTTTTAATGG + Intronic
1040993489 8:53377231-53377253 ATGTATATATTTTGTTTTAAAGG - Intergenic
1041336625 8:56792521-56792543 CTCGATATCATTAGTCTTTAGGG + Intergenic
1043481865 8:80661607-80661629 CAGGATATCATTCTTTTTAATGG - Intronic
1043738892 8:83782636-83782658 CTGGAGATACTTAGTTATATGGG - Intergenic
1044817725 8:96130413-96130435 CTGGGTATATTTGGTTTTGATGG - Intergenic
1045776985 8:105816174-105816196 CTGGATCTCATTATTTTTTATGG + Intergenic
1046557575 8:115793954-115793976 CAGGATCTAATTATTTTTTATGG - Intronic
1046582712 8:116112743-116112765 CTGCAAATAATTTTTTTTAAAGG + Intergenic
1046815644 8:118580775-118580797 CTGGAAATTTTTATTTTTAATGG + Exonic
1046934985 8:119876922-119876944 CTGGAATTAATTAGTATTATTGG + Intronic
1048230940 8:132640762-132640784 TTGGATATAATCAGTTTATAAGG - Intronic
1049305024 8:141898137-141898159 CTGGATATAAGTTGTTTGTACGG - Intergenic
1049872034 8:144987712-144987734 CTGAATATCTTTAATTTTAAAGG + Intergenic
1050133136 9:2433566-2433588 CTTGACATAATTAGTTATCAGGG - Intergenic
1050361291 9:4833579-4833601 CTGGATATAATTTATGTTCAGGG + Intronic
1050522388 9:6514691-6514713 CTGGATATCATTCTTTTTTATGG + Intergenic
1050548577 9:6729725-6729747 CTGGAAATCATTAGCTTTTATGG - Intronic
1051288541 9:15521616-15521638 CTGGAAATATTTAGTATTCATGG + Intergenic
1051792411 9:20821444-20821466 AGGGAGATAAGTAGTTTTAATGG + Intronic
1052278041 9:26701056-26701078 CTTGATTTAATTCTTTTTAAGGG - Intergenic
1053652267 9:40181219-40181241 ATGGATATAATTATTTCTATGGG - Intergenic
1053902661 9:42810532-42810554 ATGGATATAATTATTTCTATGGG - Intergenic
1054532315 9:66194996-66195018 ATGGATATAATTATTTCTATGGG + Intergenic
1054992537 9:71345815-71345837 CTGAATATTATTGGTTTTCAGGG + Intronic
1055205976 9:73730954-73730976 CTGGCCATAATTAGTAATAAAGG - Intergenic
1056473606 9:86930304-86930326 CTGGATATCATTCTTTTTTATGG - Intergenic
1057516269 9:95724282-95724304 CTGTATACAATGTGTTTTAAAGG - Intergenic
1057886994 9:98837294-98837316 CTGCATATAATTATTATAAATGG - Intronic
1058199773 9:102025211-102025233 CTGGATTTATTTATTTTTGAAGG + Intergenic
1058611564 9:106781987-106782009 CAGGATATACTCAGTTTGAAGGG - Intergenic
1059338902 9:113586328-113586350 CTGTATATAAATAGTTTTATTGG - Intronic
1186063178 X:5732484-5732506 CTGGAGATAATTATATTTAAGGG - Intergenic
1186915757 X:14218449-14218471 CAGGATATCATTCTTTTTAATGG + Intergenic
1187079089 X:15967116-15967138 CTAGATATGATCAGTTTTTAAGG - Intergenic
1187581837 X:20615414-20615436 CTGGATATCATTCTTTTTTATGG - Intergenic
1188636572 X:32439496-32439518 ATGGATATAAATAATTTTAATGG + Intronic
1188813894 X:34687263-34687285 CTGGATTTCATTATTTTTGATGG + Intergenic
1189161719 X:38815765-38815787 CTTCATATAATTAGTTTTGGCGG + Intergenic
1189459406 X:41226226-41226248 CTGGATAACCTTAGTTTTTACGG - Intronic
1189623035 X:42864119-42864141 CCTGATTTAATTAGTTTCAAGGG - Intergenic
1189854050 X:45205356-45205378 CAGGATCTCATTATTTTTAATGG + Intergenic
1189980753 X:46507877-46507899 ATAACTATAATTAGTTTTAATGG - Intronic
1190796658 X:53751606-53751628 CAGGCTATAATTTTTTTTAATGG - Intergenic
1190821294 X:53975540-53975562 CAGGATTTCATTTGTTTTAATGG - Intronic
1191934043 X:66407219-66407241 CATGATTTAATTAGTTTTTAAGG + Intergenic
1192276746 X:69639504-69639526 CTCAATATCATTAGTTTTTAGGG - Intronic
1193161627 X:78235257-78235279 TTGTATATAAGTAATTTTAATGG + Intergenic
1193557331 X:82971743-82971765 CTTAATATAATTAGTCTTCATGG - Intergenic
1194252614 X:91596158-91596180 TTGCATTTAATTTGTTTTAAAGG + Intergenic
1194573953 X:95588279-95588301 TTGGATATAATTAATTTTATAGG + Intergenic
1194636912 X:96356745-96356767 CTGGAGATAAATAGTTGTAATGG + Intergenic
1194719659 X:97325380-97325402 CTGGTGAGAATTACTTTTAATGG + Intronic
1194815583 X:98437393-98437415 CTGGATCTCATTATTTTTATGGG + Intergenic
1195116301 X:101702281-101702303 CAGGATCTCATTAATTTTAATGG - Intergenic
1195224028 X:102773756-102773778 CTGGATCTCATTATTTTTTATGG + Intergenic
1195851654 X:109288848-109288870 CTGGATATAAGCAATTTTACTGG + Intergenic
1196656184 X:118219728-118219750 CTCGATATAATTAGTTGTTAAGG + Intergenic
1197473891 X:126896316-126896338 CTGGATCTCATTATTTTTTATGG - Intergenic
1197730105 X:129802805-129802827 CTGAATATCATTTGTTTTAAAGG - Intergenic
1198384581 X:136116458-136116480 CTGTCTATAAGTAGTGTTAAGGG - Intergenic
1198628760 X:138610548-138610570 CTGAAAATAAATAGTTTTGAGGG - Intergenic
1200571546 Y:4837415-4837437 TTGCATTTAATTTGTTTTAAAGG + Intergenic
1201507285 Y:14716456-14716478 TTGGGTATAATAAGTGTTAAGGG - Intronic
1201855917 Y:18541822-18541844 CTATATATAATTAATTTAAAAGG - Intergenic
1201877404 Y:18778563-18778585 CTATATATAATTAATTTAAAAGG + Intronic