ID: 927626196

View in Genome Browser
Species Human (GRCh38)
Location 2:24721585-24721607
Sequence TGCCCAGGGAATCTCCCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927626196_927626202 21 Left 927626196 2:24721585-24721607 CCCTTTGGGAGATTCCCTGGGCA 0: 1
1: 0
2: 2
3: 12
4: 125
Right 927626202 2:24721629-24721651 TGCTCACAATTGTAATCCCATGG 0: 1
1: 0
2: 12
3: 144
4: 380
927626196_927626203 26 Left 927626196 2:24721585-24721607 CCCTTTGGGAGATTCCCTGGGCA 0: 1
1: 0
2: 2
3: 12
4: 125
Right 927626203 2:24721634-24721656 ACAATTGTAATCCCATGGACAGG 0: 1
1: 0
2: 0
3: 4
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927626196 Original CRISPR TGCCCAGGGAATCTCCCAAA GGG (reversed) Intronic
900805245 1:4763266-4763288 TCCCCAGGGAATTGCCCCAAAGG - Intronic
901474825 1:9482272-9482294 TGCCAAGTGAATCTGCCTAAGGG + Intergenic
902106639 1:14042193-14042215 TGCTGAGGAAATTTCCCAAAAGG - Intergenic
903438097 1:23367877-23367899 ATCCCAGGGAATTTCCCACAGGG + Intronic
903674592 1:25055950-25055972 TGCCCAGGGTCTCCCCCAAGAGG - Intergenic
909039812 1:70635728-70635750 TGCCCATGGAGTCTCCATAAAGG + Intergenic
909533314 1:76705966-76705988 TCCCATGGGAATATCCCAAAGGG - Intergenic
909561277 1:77011420-77011442 TACCCAGGGAATATCTCTAATGG - Intronic
910614782 1:89185656-89185678 TGCTTAGGGAATGTCACAAAAGG - Intronic
911383862 1:97149912-97149934 TGCAAAGGGAAACTGCCAAATGG - Intronic
913099797 1:115552445-115552467 AGTCCAGGGAAGCTCCCAGATGG + Intergenic
922029034 1:221780451-221780473 TCCCCAGGGAACCTCCCACAAGG - Intergenic
923083453 1:230682461-230682483 TGCCCAGTGAAGCTTACAAAAGG - Intronic
1063494637 10:6495491-6495513 TGGTCCGGGAATCTCCCCAACGG - Intronic
1065599335 10:27352975-27352997 TGCACATGGAATCTCCAAAGAGG + Intergenic
1066335782 10:34476778-34476800 TGCTCAGGGTAACTCCCAACAGG + Intronic
1067907478 10:50308739-50308761 TTCTCAGGTAATTTCCCAAATGG - Intronic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1070601382 10:77868772-77868794 TCCCCAAGGAAACTCCAAAAGGG + Intronic
1072338398 10:94421499-94421521 TGCTCAGGGAATATGCCAAAAGG - Intronic
1073127101 10:101158127-101158149 TGCCATGTGAATCTCCCAATAGG + Intergenic
1073190733 10:101649076-101649098 AGCCCAGGGAATCCCCAAAGAGG + Intronic
1073212931 10:101819117-101819139 TGCCCACGGCCTCTCCCCAAAGG - Intergenic
1073284696 10:102380603-102380625 TTCCCAGGTGATCTCCCAGAGGG - Exonic
1074050385 10:109876247-109876269 TGCACTGGGAAACACCCAAAGGG + Intronic
1074825676 10:117214232-117214254 TGCCCAGGCTATCTCTCAGAGGG + Intergenic
1075275932 10:121092462-121092484 TGCCAAGGGAATCTTTGAAATGG + Intergenic
1077607618 11:3622716-3622738 TGACCAGGGACTCTCCCAGCAGG - Intergenic
1077607673 11:3622999-3623021 TGCTCAGGGAGTCTACCACAGGG - Intergenic
1080398879 11:31915738-31915760 AGCACAGGGAATGTACCAAAAGG - Intronic
1080414425 11:32056064-32056086 TCCCCAGGGTTTTTCCCAAAAGG + Intronic
1090129754 11:124127949-124127971 TGAACAGGGAATCTACAAAATGG - Intronic
1097232561 12:57521518-57521540 AGCCCCGTAAATCTCCCAAAAGG + Intronic
1099706109 12:86154601-86154623 TGCACAGTGAATCTGCCCAACGG + Intronic
1100427942 12:94504542-94504564 AGCCTTGGGGATCTCCCAAATGG + Intergenic
1100687026 12:96997582-96997604 TTCCCAGAGAATCTTCCAACTGG - Intergenic
1101688915 12:107056265-107056287 TGCCAAGGCAACCTCACAAAAGG - Intronic
1101847827 12:108376881-108376903 AGCCCAAAGAATCTGCCAAAAGG + Intergenic
1103781871 12:123404112-123404134 TGCCCAGGGAAACTTTTAAAAGG + Intronic
1107438046 13:40399276-40399298 TGCCCTGGGAATATTTCAAAAGG + Intergenic
1107560405 13:41552492-41552514 TGCCCAGAAAGTCTCCCAAAAGG - Intergenic
1107818813 13:44267666-44267688 TGCCCAGGGAATCTACCACAGGG - Intergenic
1110654973 13:77987093-77987115 TGTCCTGGGAATGCCCCAAAAGG - Intergenic
1117506696 14:56411376-56411398 TGACCAAGGAATCTTCCAATTGG + Intergenic
1119922033 14:78455381-78455403 TGCCCAGGAGCTCTCCCTAAGGG - Intronic
1121110380 14:91308656-91308678 TACCCAGGGAACCCCCCAAAGGG - Intronic
1121309122 14:92925414-92925436 TGACCAGGGTGTCTCCCATAAGG - Intronic
1121512924 14:94526009-94526031 TTCCCAGGGGAGCTCCCATAAGG - Intergenic
1124192502 15:27592732-27592754 TGCCCAGAGAAGCTACCCAAAGG + Intergenic
1124650802 15:31472441-31472463 TCCCCAGGGAGCTTCCCAAAAGG + Intergenic
1125347411 15:38732252-38732274 TGCCCATGTAATCTCCAAGAAGG + Intergenic
1127684686 15:61331500-61331522 AGCCAAGGGAATCTCCAATATGG - Intergenic
1128647964 15:69390960-69390982 TACTCAGGAAATCTCCCAAATGG + Intronic
1129889721 15:79063907-79063929 GGCCCAGGGAGTCTCCCTACAGG + Intronic
1132899230 16:2244309-2244331 TGCCCTTGGAATCTCTCACAGGG - Intronic
1137966748 16:52942200-52942222 AGCCCAGTGTATGTCCCAAAGGG - Intergenic
1140504535 16:75463436-75463458 TGCCCAGGGATTTTCCCGGACGG - Intronic
1143256563 17:5562065-5562087 TGCCCAGGGAAACACCCAGATGG + Intronic
1143984227 17:10897418-10897440 TGCCTATGCAATCACCCAAAGGG + Intergenic
1150724027 17:67636969-67636991 TGCCCAGGAAAACTCAGAAAGGG - Intronic
1151589936 17:75036565-75036587 AGCACAGGGAATCTCCCAAAGGG + Intronic
1158228825 18:55230753-55230775 TACCCAGAGATTCTCCAAAATGG - Intronic
1158473059 18:57755667-57755689 TACACAGGCAAACTCCCAAAGGG + Intronic
1161154192 19:2723657-2723679 TGCCGAGGGACTCTCCAAAGAGG - Intronic
1166532842 19:43552888-43552910 AGCCCCAGGAGTCTCCCAAAGGG - Exonic
1167587394 19:50382770-50382792 TGCCCAGCGAGTCTTCCAGAAGG + Exonic
925016249 2:526581-526603 TGCTTAGAGAATCTTCCAAAAGG - Intergenic
925297639 2:2788608-2788630 TGCCCACATAATCTCCCAACAGG + Intergenic
927626196 2:24721585-24721607 TGCCCAGGGAATCTCCCAAAGGG - Intronic
929765740 2:44842839-44842861 TGTCCAGGCAATACCCCAAAGGG - Intergenic
933128605 2:78643730-78643752 TGGCCAGTGAATCTTCCCAAAGG + Intergenic
933624298 2:84581315-84581337 TGTGCAGAGAATCTCCCTAAAGG - Intronic
935763659 2:106343689-106343711 TCCACAGGGAGTCTCCAAAATGG + Intergenic
936079800 2:109424291-109424313 TGCACTGGGAATCTCCCTCAGGG - Intronic
936854534 2:116941038-116941060 TGCATAGGGAATTTCACAAATGG - Intergenic
939114136 2:138041223-138041245 TACCCAGGGAAGCTCTCAGAGGG + Intergenic
941248777 2:163135325-163135347 TGCCAAGGAAACCCCCCAAATGG - Intergenic
943655891 2:190508594-190508616 TGCACTGTGAATCTCCCAAAGGG - Exonic
943873549 2:193033448-193033470 TGAACAGGGAATCTACAAAATGG - Intergenic
1174541823 20:51295932-51295954 TGCCCAGATGATTTCCCAAAAGG + Intergenic
1181064220 22:20298187-20298209 TGCACAGGGCAGCTCCCACAAGG + Intergenic
1181894874 22:26098412-26098434 AGCCCAGGGAATTTACCAACTGG - Intergenic
1183423031 22:37723396-37723418 TCCCCATCGAATCACCCAAAGGG + Exonic
1183469791 22:37999174-37999196 TCCCCAGGGCATTTCCCACAAGG - Intronic
1185351243 22:50340638-50340660 TGACCAGGGAAACCCCCACAGGG + Intergenic
950692401 3:14670345-14670367 TGTCCAGGGAAATTCCCCAATGG - Intronic
951120252 3:18918252-18918274 TCCACAGGGATTCACCCAAAAGG + Intergenic
956385611 3:68715356-68715378 TGCCCTAGGGTTCTCCCAAAGGG + Intergenic
956766289 3:72487313-72487335 GGCCCAGGGACTCACCCAGAGGG + Intergenic
957279018 3:78126104-78126126 TGACTAGGGAATCTCTAAAATGG - Intergenic
959829423 3:110842728-110842750 TGCCCAGTGACTCTCCCCAAGGG - Intergenic
960774315 3:121231690-121231712 TTCCCAGTGAATCACCCAATGGG + Intronic
960853273 3:122077696-122077718 AGCCCTGGGAAACCCCCAAAGGG - Intronic
961684372 3:128619103-128619125 TGCCCAGGGACACTCCCACTTGG + Intergenic
962060232 3:131918761-131918783 TGCACTGTGAATCTCCAAAAAGG + Intronic
970605777 4:17680871-17680893 CGCCCAGGAAATCTCCTAGAAGG + Intronic
971241015 4:24888785-24888807 TGCCCAGGGAGTCTTGCAATTGG - Intronic
977818124 4:101439798-101439820 TACCCAGAGAATCTTCAAAAAGG - Intronic
978950349 4:114550972-114550994 GTCCCAGGGACTCTCACAAAAGG - Intergenic
993164921 5:84340474-84340496 TACCCATGGAATTTCACAAAGGG + Intronic
997282314 5:132656663-132656685 GGCCCACGGCATCTCCCACAGGG - Intronic
997689867 5:135821175-135821197 TGCCCAGGGAAGTTCCCATGTGG - Intergenic
1000865250 5:166505781-166505803 TGCCCATGGAAACTCACAAGTGG - Intergenic
1001118841 5:168962173-168962195 GGCTCAGGGCATCTCCCAAGTGG + Intronic
1002414340 5:179111575-179111597 TGCCCAGGGAATGTCCCAGCTGG + Exonic
1003636230 6:7833981-7834003 TGCTCATGGAAACTCCCACAGGG - Intronic
1006798081 6:36743598-36743620 TCACCAGGGAAGCCCCCAAAGGG + Intronic
1007553585 6:42747605-42747627 TGCGCGGGGAATCTGCCACACGG - Intronic
1013614473 6:111828978-111829000 TGCACAGGGAATCCCCAAGAGGG + Intronic
1014381079 6:120743218-120743240 TGCCCTCATAATCTCCCAAAAGG - Intergenic
1016296369 6:142577367-142577389 TGCCCATGGAGTCTCCCTGATGG + Intergenic
1017549371 6:155488697-155488719 TGCCAATGGACCCTCCCAAATGG - Intergenic
1021565667 7:22014265-22014287 TGCCCAGGGAGTCAGACAAAAGG + Intergenic
1022521262 7:31008454-31008476 TTCACAGAGAATGTCCCAAAGGG - Intergenic
1024411269 7:49045113-49045135 TGCCCATGAAATATCCCAGAGGG + Intergenic
1024906870 7:54393178-54393200 TCCCCAGGGACTCTCCCAAGGGG - Intergenic
1026575514 7:71568101-71568123 TGCCCAGGGAAGCACCTTAACGG + Intronic
1030922847 7:115414136-115414158 GGCCCAGAAAATCACCCAAAAGG + Intergenic
1032585277 7:133140701-133140723 TGCTCAGGAAGTCTCTCAAAAGG + Intergenic
1034472850 7:151264831-151264853 TGCCCAGGGTAACTGCCAGAAGG + Intronic
1038032005 8:23650834-23650856 TGCCCACGGAGTCTCCCTGATGG - Intergenic
1045066865 8:98455686-98455708 TGCCCAGGTAAATTCCCAAAAGG - Exonic
1045697844 8:104830727-104830749 TCCCTAGTGAATCTCCAAAAGGG + Intronic
1047435980 8:124835747-124835769 TGCTCAGGGAAGCACGCAAATGG + Intergenic
1048617738 8:136096504-136096526 ATCCCAAGGAATCTACCAAATGG - Intergenic
1048973670 8:139658971-139658993 AGCCCAGGAAAGCTCCCAGAAGG + Intronic
1049282830 8:141759264-141759286 TGCCCCAGGAATTTCCCAGAGGG - Intergenic
1049579178 8:143403408-143403430 AGCCCAGGGAAGCTGCCACAGGG - Intergenic
1054710879 9:68509668-68509690 TTCCCAGAGAATCTCCAAAAAGG - Intronic
1060550640 9:124483365-124483387 TGCCCAGGGATCCTCCCCGAGGG - Intronic
1060965668 9:127711146-127711168 TGCTCTGGGAACCTCACAAAGGG + Intronic
1061753981 9:132799952-132799974 GGTCCAGGGAATCTTACAAAAGG + Intronic
1061873318 9:133532001-133532023 TCCCCAGGGAACCTCCAAAGTGG + Intergenic
1187158572 X:16743958-16743980 TGACCAGGGGAGCTGCCAAAGGG - Intronic
1187197939 X:17105998-17106020 TGCACAGCGACTCTCCCAGAGGG - Intronic
1187200107 X:17126593-17126615 TGCTCAGTGAATCTCCAAGAGGG + Intronic
1196266641 X:113656444-113656466 TGCACAGGGAATCACTGAAATGG - Intergenic
1198075142 X:133186945-133186967 TTCTCAGGGAATTTCCTAAAAGG - Intergenic
1200812780 Y:7502473-7502495 TTCCCTGGGAATATCCCCAATGG + Intergenic
1201363403 Y:13177764-13177786 GGCTCAGGGAATGTCACAAAAGG + Intergenic