ID: 927627604

View in Genome Browser
Species Human (GRCh38)
Location 2:24738951-24738973
Sequence TCACTTGGAGGTACTATGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927627604 Original CRISPR TCACTTGGAGGTACTATGTC TGG (reversed) Intronic
900907928 1:5573896-5573918 TCAAGGGGAGGTACTATGCCTGG + Intergenic
901320735 1:8338434-8338456 TGACTTTGAGGTTCTCTGTCTGG + Intronic
903131726 1:21283986-21284008 TCACCTAGAGGTACTAGGCCAGG + Intronic
908238721 1:62171269-62171291 TCAAAGGGAGGTACTATGCCTGG + Intergenic
912576627 1:110677493-110677515 TCACTTTGAGCTACTCTGTTGGG - Intergenic
915167459 1:153956321-153956343 TCACTTTGGGGAGCTATGTCTGG + Intronic
916078690 1:161218497-161218519 AGACTTGGATGTAGTATGTCGGG + Intronic
918210894 1:182349884-182349906 TCACTGGGCAGGACTATGTCAGG + Intergenic
919525545 1:198644725-198644747 TCAATTGAAGGTACTATGAATGG - Intronic
920123826 1:203677883-203677905 GCACTTGGAGATACTCTGGCAGG - Intronic
920135414 1:203765320-203765342 TCACTTGGAAGCACCATGTCCGG + Exonic
923936139 1:238762584-238762606 TCAAGGGAAGGTACTATGTCTGG + Intergenic
924953616 1:248907199-248907221 TCAAGTGGAGGTACTATGCCTGG + Intronic
1063570702 10:7212094-7212116 GGACTTGGAGGCACTAGGTCTGG + Intronic
1063882199 10:10542631-10542653 TTAGTTGGAGGTACTATATTTGG + Intergenic
1065141967 10:22726730-22726752 GCACTTGCAGGTACTTTGCCTGG - Intergenic
1069753965 10:70762036-70762058 TCCCTTGGAGGTAGCATGGCCGG - Exonic
1071835996 10:89417483-89417505 TCACTTGGGGAAACTATGCCTGG + Exonic
1082716331 11:56618613-56618635 TCAAGGGGAGGTACTATGCCTGG + Intergenic
1083797137 11:65023491-65023513 TCAAGGGGAGGTACTATGCCTGG + Intronic
1084226342 11:67716783-67716805 TCACGGGAAGGTACTATGACTGG + Intergenic
1084229342 11:67739632-67739654 TCACGGGAAGGTACTATGACTGG + Intergenic
1084799754 11:71535379-71535401 TCAAGGGGAGGTACTATGCCTGG - Intronic
1084808854 11:71600072-71600094 TCACGGGAAGGTACTATGACTGG - Intronic
1084812982 11:71626709-71626731 TCACGGGAAGGTACTATGACTGG - Intergenic
1085705904 11:78786756-78786778 TCATCTGGAGGTATTATGACTGG - Intronic
1086333088 11:85773316-85773338 TAACTTCAAGGTACTGTGTCGGG - Intronic
1089384024 11:118056356-118056378 TCAATTGGAGGTAGTAAGTTAGG + Intergenic
1094698105 12:32841689-32841711 TTACTGGGAGGCACAATGTCAGG - Intronic
1095456175 12:42388398-42388420 TCAAGGGGAGGTACTATGCCTGG - Intronic
1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG + Intronic
1106132943 13:26954444-26954466 TCACTTGGAGGTTCTGGGACTGG + Intergenic
1113994116 14:16052990-16053012 TTACTTGGAGGTGCTTTGCCTGG + Intergenic
1114006592 14:18320158-18320180 TCAAGGGGAGGTACTATGCCTGG - Intergenic
1114072990 14:19130125-19130147 TCAAGGGGAGGTACTATGCCTGG - Intergenic
1114089276 14:19269869-19269891 TCAAGGGGAGGTACTATGCCTGG + Intergenic
1115222665 14:31072829-31072851 TGACTGGGAAGTTCTATGTCTGG + Intronic
1116851887 14:49917137-49917159 TTTCTTGGATTTACTATGTCAGG - Intergenic
1118957765 14:70498334-70498356 TCATTTGGAGGAAATATGACAGG - Intergenic
1123390520 15:19866797-19866819 TCAAGGGGAGGTACTATGCCTGG - Intergenic
1127470557 15:59286527-59286549 TCACTTAGGGGTACTGTGTCTGG + Intronic
1127709369 15:61580278-61580300 TCACTTGTAGGGACTAGGGCTGG + Intergenic
1128343850 15:66841693-66841715 TTACTGAGAGGTACTAAGTCCGG - Intergenic
1136407738 16:30058380-30058402 TGACTTGGAGGTTATATGGCTGG + Intronic
1137438538 16:48478603-48478625 GCACTTGGAGGCACTCTCTCTGG - Intergenic
1139394304 16:66628022-66628044 TCAAGGGGAGGTACTATGTCTGG + Intronic
1144571262 17:16400815-16400837 TCAGAGGGAGGTACTATGCCTGG - Intergenic
1145363349 17:22230293-22230315 TCAAGGGGAGGTACTATGCCTGG - Intergenic
1146892128 17:36512937-36512959 GAACTTGGAATTACTATGTCTGG + Intronic
1146992035 17:37283151-37283173 TTACTTGGAAGTCCTATGTTTGG + Intronic
1148101710 17:45096152-45096174 TCACTTGGAGGTATTCTGCCAGG - Intronic
1160091448 18:75831032-75831054 TCACATCGAGTTACTATGTCAGG - Intergenic
1162062300 19:8103583-8103605 TGACTTGGAGGTACTCTGCAGGG + Exonic
1168379524 19:55908161-55908183 TCAGTTGCAGGTACGAAGTCAGG + Intronic
927627604 2:24738951-24738973 TCACTTGGAGGTACTATGTCTGG - Intronic
932600288 2:73119474-73119496 TCAAGGGGAGGTACTATGCCTGG + Intronic
933535092 2:83562004-83562026 TCAATTGCAGGAACTATGTGTGG - Intergenic
938338746 2:130521486-130521508 TGACCTGGAGGCACCATGTCAGG + Exonic
938351094 2:130599264-130599286 TGACCTGGAGGCACCATGTCAGG - Exonic
938487045 2:131721906-131721928 TCAAGGGGAGGTACTATGCCTGG - Intergenic
938529970 2:132175312-132175334 TCAAGGGGAGGTACTATGCCTGG + Intronic
938537538 2:132257880-132257902 TTACTTGGAGGTGCTTTGCCTGG - Intronic
943078014 2:183221581-183221603 ACATTGGGAGGTACTATGCCAGG + Intergenic
1169471021 20:5885686-5885708 TCAAGTGGAGGTACTATGCCTGG - Intergenic
1170195834 20:13688762-13688784 TCATTTGGGGGAACTATGTTTGG + Intergenic
1171768302 20:29301825-29301847 TTACTTGGAGGTGCTTTGCCTGG - Intergenic
1171811007 20:29744069-29744091 TTACTTGGAGGTGCTTTGCCTGG - Intergenic
1174583042 20:51586234-51586256 TCCCTGGGAAGTGCTATGTCAGG + Intergenic
1180313152 22:11254525-11254547 TTACTTGGAGGTGCTTTGCCTGG - Intergenic
1180431101 22:15250969-15250991 TCAAGGGGAGGTACTATGCCTGG - Intergenic
1180491431 22:15852479-15852501 TCAAGGGGAGGTACTATGCCTGG - Intergenic
1180513656 22:16118870-16118892 TCAAGGGGAGGTACTATGCCTGG - Intergenic
952130727 3:30358866-30358888 TAACTTTGAGGTACTTTGACTGG - Intergenic
955209505 3:56927647-56927669 CCACCTGGAGGTTCAATGTCAGG + Intronic
956073278 3:65477598-65477620 ACATTTGGAGTTACTATGTAAGG + Intronic
957045912 3:75374458-75374480 TCACGGGAAGGTACTATGACTGG + Intergenic
961276471 3:125731151-125731173 TCACGGGAAGGTACTATGACTGG - Intergenic
966771862 3:183511217-183511239 TCAAGGGGAGGTACTATGCCTGG + Intronic
969730777 4:8956277-8956299 TCACGGGAAGGTACTATGACTGG - Intergenic
969790373 4:9490385-9490407 TCACGGGAAGGTACTATGACTGG - Intergenic
974621176 4:64356558-64356580 TCAAGGGGAGGTACTATGCCTGG - Intronic
974952402 4:68598710-68598732 TCAAGGGGAGGTACTATGCCTGG - Intronic
974952850 4:68603188-68603210 TCAAGGGGAGGTACTATGCCTGG - Intronic
976221886 4:82762599-82762621 TAACGTGGAGGTACTAGTTCTGG - Intronic
983313230 4:166093358-166093380 TCAAGGGGAGGTACTATGCCTGG + Intronic
985460973 4:190106553-190106575 TCAAGGGGAGGTACTATGCCTGG + Intergenic
985666066 5:1182010-1182032 ACACTTGGAGGGACCAGGTCGGG - Intergenic
988836745 5:35040435-35040457 TGACTTAGAGGTACAATATCTGG + Intronic
993398920 5:87424816-87424838 TCACATGTAAGTACTATATCAGG + Intergenic
994323014 5:98414871-98414893 TTACTTGGTGGTACTTTCTCAGG - Intergenic
996298934 5:121958933-121958955 TGACTTGGAGGTGATATATCTGG + Intergenic
998557394 5:143138908-143138930 TCACTTTGAGGTAGAATGACAGG - Intronic
1007492193 6:42231945-42231967 TCACATGGAGTTTCTATGTAAGG + Intronic
1010423817 6:75704373-75704395 TCAAGTGGAGGTACTATGCCTGG + Intronic
1013371864 6:109477797-109477819 CCACTTGGAGGCACTAGGCCTGG - Intronic
1014138981 6:117919215-117919237 TCACTTCAAGGTTTTATGTCTGG + Intronic
1022477144 7:30718873-30718895 TCAAGGGGAGGTACTATGCCTGG + Intronic
1026736448 7:72951880-72951902 TCAAAGGGAGGTACTATGCCTGG - Intergenic
1027107285 7:75413182-75413204 TCAAAGGGAGGTACTATGCCTGG + Intergenic
1027225988 7:76243962-76243984 TCACCTGGAGGTCCCTTGTCTGG - Intronic
1027343238 7:77232303-77232325 TGACTTGGAAGTACCCTGTCTGG + Intronic
1032102083 7:128988776-128988798 TCACTTGGAAATAGTATGTTGGG + Intronic
1033715378 7:143996409-143996431 TCAAGGGGAGGTACTATGCCTGG + Intergenic
1034312128 7:150098010-150098032 TCACTTGGTGGGACCATGTTGGG - Intergenic
1034794727 7:154002648-154002670 TCACTTGGTGGGACCATGTTGGG + Intronic
1036902218 8:12678699-12678721 TCACGGGAAGGTACTATGACTGG + Intergenic
1039867268 8:41516449-41516471 TGACATGGAGGGACTATTTCAGG + Intergenic
1040316613 8:46264325-46264347 TCAAGGGGAGGTACTATGCCTGG + Intergenic
1044347659 8:91124052-91124074 TCATTTGGGAGTAGTATGTCAGG + Intronic
1049506308 8:143001465-143001487 TCAAGGGGAGGTACTATGCCTGG - Intergenic
1051447407 9:17155272-17155294 TGACTAGGAGATACTGTGTCCGG - Intronic
1053708580 9:40781786-40781808 TCAAGGGGAGGTACTATGCCTGG + Intergenic
1054418491 9:64902581-64902603 TCAAGGGGAGGTACTATGCCTGG + Intergenic
1055540653 9:77301647-77301669 TCACTTTGAGGTACAATGGGAGG + Intronic
1062445822 9:136593904-136593926 ACACTTGGAAGTTATATGTCGGG + Intergenic
1187164735 X:16794467-16794489 ACACTTGGAGGTACTGTTGCAGG - Intronic
1188574209 X:31626501-31626523 TCATTTGGAGGTAATTTGTTTGG - Intronic
1192215027 X:69152084-69152106 GCACCTGGAGGTCCTATGACAGG - Intergenic
1193408236 X:81130661-81130683 TCAGTTGGAGGCACGATGGCAGG - Intronic
1194169973 X:90569307-90569329 GCACTTTGAGATACAATGTCAGG + Intergenic
1195483854 X:105379816-105379838 TAGCTAGGAGGTAGTATGTCAGG + Intronic
1199282384 X:146017256-146017278 TCACTTGGTGTTACTATCTTGGG - Intergenic
1199784499 X:151092222-151092244 TCAGTAGGATGTACTAGGTCAGG - Intergenic
1201076804 Y:10195572-10195594 TTACTTGGAGGTGCTTTGCCTGG + Intergenic
1201994808 Y:20074045-20074067 TCACTTAAAGGTGTTATGTCCGG - Intergenic