ID: 927631165

View in Genome Browser
Species Human (GRCh38)
Location 2:24775345-24775367
Sequence CTATGAGCTTGTAAGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927631165_927631173 18 Left 927631165 2:24775345-24775367 CCAAATTCCTTACAAGCTCATAG No data
Right 927631173 2:24775386-24775408 CAAATCTAGGTCAGGCACAGTGG No data
927631165_927631170 5 Left 927631165 2:24775345-24775367 CCAAATTCCTTACAAGCTCATAG No data
Right 927631170 2:24775373-24775395 TCCATTTTGAAAACAAATCTAGG No data
927631165_927631172 10 Left 927631165 2:24775345-24775367 CCAAATTCCTTACAAGCTCATAG No data
Right 927631172 2:24775378-24775400 TTTGAAAACAAATCTAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927631165 Original CRISPR CTATGAGCTTGTAAGGAATT TGG (reversed) Intergenic
No off target data available for this crispr