ID: 927637691

View in Genome Browser
Species Human (GRCh38)
Location 2:24828029-24828051
Sequence CCTCATCGCCACCATCATGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927637691_927637698 10 Left 927637691 2:24828029-24828051 CCAGCATGATGGTGGCGATGAGG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 927637698 2:24828062-24828084 CCACATAGTTGTAATACTTGGGG 0: 1
1: 0
2: 1
3: 7
4: 126
927637691_927637695 8 Left 927637691 2:24828029-24828051 CCAGCATGATGGTGGCGATGAGG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 927637695 2:24828060-24828082 GGCCACATAGTTGTAATACTTGG 0: 1
1: 0
2: 1
3: 4
4: 93
927637691_927637699 19 Left 927637691 2:24828029-24828051 CCAGCATGATGGTGGCGATGAGG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 927637699 2:24828071-24828093 TGTAATACTTGGGGTTCTCCAGG 0: 1
1: 0
2: 1
3: 9
4: 148
927637691_927637696 9 Left 927637691 2:24828029-24828051 CCAGCATGATGGTGGCGATGAGG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 927637696 2:24828061-24828083 GCCACATAGTTGTAATACTTGGG 0: 1
1: 0
2: 0
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927637691 Original CRISPR CCTCATCGCCACCATCATGC TGG (reversed) Exonic
906964618 1:50444190-50444212 CAGCATGGCCACCATCTTGCTGG - Intronic
907883915 1:58576307-58576329 CCTCATCGCCGTCATCGTGGTGG - Exonic
908689055 1:66756777-66756799 CATCTTCCCCACCATCTTGCGGG + Intronic
913195178 1:116450370-116450392 TCTCATTGCCACCATGTTGCTGG - Intergenic
915916340 1:159943151-159943173 CCTCATGCCACCCATCATGCAGG - Exonic
923463159 1:234224801-234224823 ACTGATCTCCACCATCATGATGG + Intronic
1065158695 10:22896461-22896483 CGTCATCATCACTATCATGCTGG + Intergenic
1069041801 10:63703656-63703678 CCTCCTCGCCCCCAATATGCAGG - Intergenic
1072744419 10:97929775-97929797 CACCATCACCACCATCATCCAGG + Intronic
1074107492 10:110399327-110399349 ATTCATCACCACCATCATGAAGG - Intergenic
1075722703 10:124596786-124596808 CCTCATATTCACCATCATGGTGG - Intronic
1083185165 11:61013475-61013497 CCTCATCCCCTCCATCGTTCTGG + Exonic
1083672367 11:64306362-64306384 CCTCCTCGCGACCAGCCTGCAGG - Exonic
1084894836 11:72258539-72258561 CCTCATTTCCACCAACATGATGG + Intergenic
1088952333 11:114584420-114584442 TCTCATCGCCACCCTCTTGAGGG - Intronic
1090385762 11:126356702-126356724 CCTCATGGCCACCCACAAGCTGG + Intronic
1091788302 12:3256393-3256415 CCTCAGGGCCTCCGTCATGCTGG - Intronic
1093809535 12:23474754-23474776 CCTCAGCCCCACCAGCATCCTGG + Intergenic
1097355438 12:58595643-58595665 ACTCGTCCCCACCATCATCCAGG - Intronic
1104226081 12:126835023-126835045 ACCCATCCCCATCATCATGCTGG - Intergenic
1104495880 12:129238136-129238158 CATTATCGCCACCATCAGGAGGG - Intronic
1105456053 13:20542180-20542202 CCTCACTGCCACCATCCTGCAGG - Intergenic
1115734091 14:36305102-36305124 CATCACCCTCACCATCATGCTGG - Intronic
1118254779 14:64196028-64196050 CCTGATGGCCAGCATCAGGCAGG + Intronic
1121312325 14:92941842-92941864 CCACATCGCCACTGTCCTGCAGG - Exonic
1121450708 14:94005498-94005520 CCTCACCGCCCCCATCAGTCAGG + Intergenic
1122887897 14:104718681-104718703 CCTCATCGCCACTGTCCAGCAGG - Intronic
1126324055 15:47455979-47456001 CATCATCGCCATCATCATCATGG - Intronic
1127007069 15:54582564-54582586 CCTCATCTTCACCCTCATTCTGG - Intronic
1127752568 15:62060365-62060387 CCTCAGCGCCACCATGGTGCTGG - Exonic
1128496121 15:68199602-68199624 CCTCATGGCCACCATGAGGTCGG + Exonic
1133825443 16:9274212-9274234 CCTCATCTCCCCCATCTTCCAGG + Intergenic
1138073646 16:54019046-54019068 CATCATCACCACCCTCATGCTGG + Intronic
1139471459 16:67180179-67180201 CCGCAGGGCCACCAACATGCAGG + Exonic
1139582739 16:67883039-67883061 CGTCACCTCCAGCATCATGCAGG + Exonic
1141300989 16:82815351-82815373 CATTATCGTCTCCATCATGCAGG - Intronic
1142215273 16:88826718-88826740 CCTCCTCCCCACCCTCCTGCAGG - Exonic
1143750427 17:9023021-9023043 CCTCATCGCCTTCAGCACGCTGG + Exonic
1144778929 17:17798312-17798334 CCTCCTCGCCCCCATCCTCCCGG - Exonic
1146430969 17:32794587-32794609 ACTCATCTCCACCCTAATGCAGG + Intronic
1149028799 17:52061370-52061392 CCTCAGAGCCTCCATAATGCAGG + Intronic
1154027886 18:10725027-10725049 CCGCAGGGCCACCAACATGCAGG - Intronic
1158771978 18:60529874-60529896 CCTCAGTGCCACCGTCTTGCAGG + Intergenic
1159166582 18:64710087-64710109 CCCCATCCCCACCATCCTCCAGG - Intergenic
1159516357 18:69463283-69463305 CCTAATCGCCACGGTGATGCTGG - Intronic
1160979088 19:1808221-1808243 CCTCATCATCATCATCCTGCAGG - Exonic
1161043210 19:2121016-2121038 CCTCATCGCCGCCCAAATGCTGG - Exonic
1161067886 19:2247530-2247552 CCTCAGGGCGACCATCAGGCAGG - Intronic
1161294004 19:3510554-3510576 TCTCATCCCCACCAGCCTGCAGG + Intronic
1161816377 19:6502206-6502228 CCTCAGCGCCACCGCCATGCGGG - Exonic
1161956815 19:7500784-7500806 CCTCATCTCCACCCTCTCGCAGG + Exonic
1162421100 19:10566390-10566412 CCTCATCCCCATCAACATCCGGG + Intergenic
1162496002 19:11023744-11023766 CGTCATCGCCACCCCCAAGCTGG - Intronic
1163793432 19:19321451-19321473 CCCCATCGCCACCAACAGGTGGG - Intronic
1165464024 19:35961460-35961482 CCTCAGCCCCACCAAAATGCTGG + Intergenic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
925350319 2:3196802-3196824 CATCAGCTCCACCATCATCCCGG + Intronic
926425072 2:12732707-12732729 CACCATTGGCACCATCATGCCGG - Intronic
927637691 2:24828029-24828051 CCTCATCGCCACCATCATGCTGG - Exonic
928186009 2:29111467-29111489 CCCCATAGCCACCAATATGCTGG - Intronic
929552398 2:42902960-42902982 CCTCCTGGCCACCATGAGGCAGG - Intergenic
931053222 2:58437728-58437750 CCTCATCTCCATCATCTGGCTGG - Intergenic
940405015 2:153291550-153291572 TTTCATCCCCACCACCATGCTGG + Intergenic
940513754 2:154652518-154652540 CATCATCACCATCTTCATGCTGG + Intergenic
945275521 2:207983866-207983888 CCTCATGGCCACCTTCATCAAGG + Intronic
948280739 2:236746102-236746124 CCACCTGGCCACCCTCATGCTGG - Intergenic
948656671 2:239480513-239480535 TCACATAGCCACCATCATGGTGG + Intergenic
1168880861 20:1204893-1204915 CCTCATCACCACCTCCGTGCTGG + Intronic
1171720823 20:28561518-28561540 TCTCATCGTCACCATCATCATGG + Intergenic
1172482572 20:35279582-35279604 CACCATTGCCACCAGCATGCGGG - Exonic
1175733708 20:61371258-61371280 CCTGATGGCCTCCATCCTGCAGG - Intronic
1176382327 21:6119608-6119630 CCCCATCCCCACCATCAACCTGG - Intronic
1179741145 21:43418631-43418653 CCCCATCCCCACCATCAACCTGG + Intronic
1182429985 22:30293671-30293693 CCTCAGCCCCAAGATCATGCAGG - Exonic
1184093800 22:42305818-42305840 CCCCATCTCCATCCTCATGCAGG + Intronic
950335786 3:12191800-12191822 CCTCATTGGCACCACCATGTGGG - Intergenic
951686972 3:25355247-25355269 CCTGATTGCCACCATCGGGCTGG + Intronic
955063064 3:55510850-55510872 CCTCATCTCCAGTATCCTGCTGG - Exonic
960385820 3:117020616-117020638 CCTCCTAGACTCCATCATGCTGG - Intronic
965882407 3:173401404-173401426 CCTCGCCACCACCATAATGCAGG - Intronic
967514161 3:190347180-190347202 CCCCATTGCCACCATCATCATGG - Intronic
969497100 4:7532421-7532443 CCTCATGCCGAGCATCATGCAGG - Intronic
974880735 4:67753928-67753950 GCTGATCACCACCATCATGAAGG + Exonic
977320404 4:95507636-95507658 CCTGATCACAACCATCATGTTGG + Intronic
985111915 4:186555245-186555267 CCTCATCTTCACCATCGTGGTGG - Exonic
985795327 5:1957911-1957933 CCTGATCAGCCCCATCATGCTGG + Intergenic
992758951 5:79934650-79934672 CCTCATCCTCACCAGCATGGAGG - Intergenic
993168803 5:84389099-84389121 CCTCACCGCCACCTTGATCCTGG - Intergenic
993368032 5:87056973-87056995 ACTCATCTCCACAATCAGGCAGG + Intergenic
996835445 5:127786952-127786974 CCTCAGAGCCACCATCCAGCAGG - Intergenic
998695253 5:144631016-144631038 CCCCATAGCCACCACCATCCTGG - Intergenic
1001954854 5:175842193-175842215 CCTTATGGCCCCCATCCTGCTGG - Intronic
1003731959 6:8834764-8834786 CTTTATAGACACCATCATGCAGG - Intergenic
1006374163 6:33662729-33662751 CCTCTTCCCCACCATCCTGGAGG + Intronic
1009548980 6:65061797-65061819 CCTCATAGGAACCATCATGTAGG + Intronic
1012572322 6:100743924-100743946 CATCATCATTACCATCATGCAGG + Intronic
1018861134 6:167711662-167711684 GCACATTGCCACCATCATTCAGG + Intergenic
1020807078 7:12803265-12803287 CATCAATGCCACCATCATTCTGG - Intergenic
1024607759 7:51036584-51036606 CCTCATAGCCACAAGCCTGCAGG + Intronic
1029308293 7:99638395-99638417 CCTCATCTTCACCAACAAGCAGG - Intergenic
1031408865 7:121419356-121419378 CCTAATCACCTCCATCATGGTGG + Intergenic
1034329556 7:150270561-150270583 CCTCATGCTCACCACCATGCAGG + Intronic
1034668500 7:152839300-152839322 CCTCATGCTCACCACCATGCAGG - Intronic
1038227572 8:25670906-25670928 CCCCATCTCCACCATTTTGCGGG + Intergenic
1040542647 8:48373819-48373841 CCTCGTGGCCACCTTCTTGCTGG + Intergenic
1043284014 8:78506662-78506684 CATCATCATCATCATCATGCTGG - Intergenic
1045660428 8:104431734-104431756 CTTCATAGCCGCCTTCATGCTGG + Intronic
1048930666 8:139313275-139313297 CCTCTCCCCCACAATCATGCTGG + Intergenic
1049284143 8:141765447-141765469 CCACCTCGCCTCCATCCTGCAGG - Intergenic
1049756150 8:144312089-144312111 CCTCATTGACTCCATCCTGCGGG + Exonic
1057919887 9:99088279-99088301 TCTCACTGCCATCATCATGCTGG - Intergenic
1057985728 9:99711776-99711798 CCTCTTAGCCACCCCCATGCAGG + Intergenic
1059088211 9:111327836-111327858 GCTCATGAACACCATCATGCTGG - Exonic
1062731424 9:138112370-138112392 CCCCTTCCCCACCATCATCCTGG + Intronic
1185444912 X:252768-252790 CCTTATCCCCACCAACATCCAGG - Intergenic
1188656032 X:32696594-32696616 CCTCATCACCACCTTCATTAAGG - Intronic
1189187365 X:39065774-39065796 CTCCACCGCCACCATCAGGCTGG - Intergenic
1197183387 X:123561626-123561648 CCTCAGCACCACCACCATGCAGG + Intergenic
1202078962 Y:21064387-21064409 TCTGATCTCCACCTTCATGCTGG - Intergenic