ID: 927639476

View in Genome Browser
Species Human (GRCh38)
Location 2:24837742-24837764
Sequence TTTCTAATCAGACTGACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927639473_927639476 2 Left 927639473 2:24837717-24837739 CCATTTCTGCAACAGCTGCTGGT 0: 1
1: 0
2: 3
3: 22
4: 303
Right 927639476 2:24837742-24837764 TTTCTAATCAGACTGACAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927639476 Original CRISPR TTTCTAATCAGACTGACAGG AGG Intronic
901090655 1:6638606-6638628 TTTCCAAAGAGACTGACAGTCGG - Intronic
906644165 1:47461466-47461488 TTCCTAATCAGACCCACATGAGG + Intergenic
911421535 1:97647352-97647374 TTTCTAATCAGATAGACATTTGG - Intronic
915224383 1:154401887-154401909 TTTCTCATCAGCCTGGGAGGAGG - Intergenic
916885314 1:169061589-169061611 TTTCTTCTCAGACTGAAAGCTGG + Intergenic
917783065 1:178420330-178420352 TTTCTCATCACATTGCCAGGTGG + Intronic
919437538 1:197580631-197580653 TTTCTGTGCAGACTGACATGTGG + Intronic
920069373 1:203291216-203291238 GTGCTATTCAGACTTACAGGTGG + Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
921193264 1:212728546-212728568 TTTCAAATCAGATTTACAGAGGG + Intronic
1067818273 10:49500920-49500942 TTTCTAATTAAACTGATAGATGG + Intronic
1067856320 10:49796681-49796703 TTTCTTATCAGACTTAAAAGAGG + Intergenic
1068845880 10:61673159-61673181 TTTCTGATGAGAATCACAGGTGG - Intronic
1074370642 10:112898510-112898532 TTTCAAGTCAGACTGATGGGGGG - Intergenic
1075216987 10:120544788-120544810 TTTTGAATCAGACTGGCAGGAGG + Intronic
1076041901 10:127257254-127257276 TTTATAATCTAATTGACAGGAGG + Intronic
1090270576 11:125383092-125383114 TTTCTACTCAGACTCAGGGGTGG - Intronic
1095898282 12:47302501-47302523 CTTCTCATCAGCGTGACAGGAGG - Intergenic
1095937525 12:47702243-47702265 TTTCTAAAAACACTGACAGTGGG + Intronic
1098849790 12:75582126-75582148 TTTGTGATCAGACAGAAAGGAGG + Intergenic
1100701166 12:97149773-97149795 TTCCTATTCAGACTAACAGGTGG + Intergenic
1101370228 12:104122291-104122313 TTTGTATTCAGACTACCAGGAGG - Intronic
1102133299 12:110550990-110551012 TATGGAATCAGACTGTCAGGTGG + Intronic
1102385974 12:112510689-112510711 ATTCAAATGAGACTGAGAGGGGG - Intergenic
1105773042 13:23630740-23630762 TTTCTTATCAGACTGAAGGCAGG - Intronic
1106717790 13:32408982-32409004 CTTCTAATCAGACTGAAATGAGG + Intronic
1107490752 13:40878175-40878197 GTTCCAGGCAGACTGACAGGGGG + Intergenic
1107841871 13:44466438-44466460 TTGGTAATCAGAGTCACAGGAGG + Intronic
1108970932 13:56375635-56375657 TTTCTAATCAAACTAAAAGAGGG + Intergenic
1109154036 13:58882258-58882280 ATTAGAATCAGACTGAAAGGTGG + Intergenic
1109678677 13:65716785-65716807 ATTATAATCAGACTTCCAGGAGG + Intergenic
1110265223 13:73529775-73529797 TTTCGAATCCTACTGACAGGAGG + Intergenic
1112100768 13:96186743-96186765 TTTCTAATCAGACTCTCTGATGG + Intronic
1112879570 13:104089485-104089507 TATCAAGTCAGAATGACAGGAGG + Intergenic
1116566285 14:46448659-46448681 ACTCTAATCACAGTGACAGGAGG + Intergenic
1118131995 14:62976725-62976747 TTTCTTATCAGAATTACTGGAGG + Intronic
1119525101 14:75316668-75316690 TTTGTAACCACACTGTCAGGTGG + Intergenic
1120107907 14:80517137-80517159 TTCCTAATCAGTCTGGCAAGAGG + Intronic
1121068509 14:90993857-90993879 TTTCTAATCAGACTTTCAGAAGG - Intronic
1123888992 15:24756658-24756680 TTTCTACTCAGACTTAAAGTTGG + Intergenic
1124989526 15:34657760-34657782 GTGCTAATGAGACAGACAGGTGG + Intergenic
1128296446 15:66524623-66524645 TTTATAAACACACTGACAAGAGG - Intronic
1129191398 15:73939772-73939794 TTTATAAAAAGAGTGACAGGAGG + Intronic
1131456607 15:92586917-92586939 TTTCTAATCACACTGAACGGCGG + Intergenic
1131586264 15:93696645-93696667 TTTCTAATAAGAGTTACAGAAGG + Intergenic
1138627516 16:58264349-58264371 TTTAAAATCAAACTGCCAGGTGG + Intronic
1138967374 16:62100770-62100792 TTTATAATCAGACAGAAAGCAGG - Intergenic
1139426857 16:66885985-66886007 TTGCTAAATAGACTAACAGGAGG + Exonic
1143481736 17:7231115-7231137 TATCTAATGAGACTGGCTGGTGG + Intronic
1144422805 17:15113344-15113366 TTTCTCATCAGACTGACTGCTGG - Intergenic
1149282901 17:55128415-55128437 TTCCAAATCAGATTGAGAGGTGG + Intronic
1150973047 17:70052274-70052296 TTTCAAATCATACTAAAAGGTGG - Intergenic
1151409978 17:73917435-73917457 TTTCTTATCAGTCTGACTAGAGG - Intergenic
1153720939 18:7902177-7902199 TTTCTAATTAAACTCAGAGGGGG + Intronic
1157568393 18:48696108-48696130 ATGCTAATGAGACTGACAGCTGG - Intronic
1157605240 18:48922336-48922358 TTTCTCATCAGGATGACAAGGGG - Intronic
1159621155 18:70640143-70640165 TTTCTAAGCAGACTGGTAAGTGG + Intronic
1164769020 19:30793731-30793753 TTTCTAGTCAAACTTATAGGGGG + Intergenic
925667814 2:6280025-6280047 TTTCTAAACAAACAAACAGGAGG + Intergenic
926771673 2:16382941-16382963 TTTCTGATCAGTCTGACTGAAGG + Intergenic
927535409 2:23853679-23853701 TTTCTAAAGAAACTGACAAGAGG + Intronic
927639476 2:24837742-24837764 TTTCTAATCAGACTGACAGGAGG + Intronic
929019908 2:37542240-37542262 TTTCCAATCAGAAAGGCAGGTGG + Intergenic
931876735 2:66521710-66521732 ATTCTATTCATACAGACAGGTGG - Intronic
936841670 2:116777135-116777157 ATTCTAATAAGACAGACAGTAGG + Intergenic
937386990 2:121443674-121443696 TTTCTAATAAGCCTCACTGGTGG - Intronic
937764398 2:125642739-125642761 TTTTTCATCAGACTTCCAGGAGG - Intergenic
940273071 2:151912744-151912766 TGTCTAATAATACTGACAGTGGG + Intronic
942207561 2:173635796-173635818 TTCCTGATCAGTCTGACTGGAGG - Intergenic
943560290 2:189453262-189453284 TTCCTAATCTTCCTGACAGGTGG + Intronic
1170220006 20:13931903-13931925 TTTCAAATCAAAATGACAGATGG + Intronic
1173504245 20:43574518-43574540 TTTCTAATTAGTCTGCCCGGAGG - Intronic
1178968993 21:37154278-37154300 TTTCTAAACATTCAGACAGGTGG - Intronic
1179105806 21:38399365-38399387 TTTCTAATGAGAAAGACTGGGGG - Intronic
1180841459 22:18960760-18960782 TTTGCAGTGAGACTGACAGGTGG + Intergenic
1181060036 22:20278034-20278056 TTTGCAGTGAGACTGACAGGTGG - Intronic
1181781575 22:25197623-25197645 TTTCCATTCAGACTGACAAGGGG + Intergenic
954054969 3:48015094-48015116 TTTCTGCTGAAACTGACAGGAGG - Intronic
959022560 3:101204348-101204370 ATTCTAAACAAACTGACAGTGGG + Intergenic
960995895 3:123339794-123339816 TTTCTAAACAGAATGTCAGTAGG - Intronic
961573365 3:127816347-127816369 TTTCTAATCAGGTTGTCAGCCGG - Intronic
964979721 3:162664835-162664857 GTTCTAATGAGACAGTCAGGTGG + Intergenic
966033622 3:175381894-175381916 AATCTCATCACACTGACAGGTGG - Intronic
966958199 3:184906981-184907003 TTTCTAAACAGACTGAGACCTGG - Intronic
967882636 3:194312839-194312861 TTTCTCATCAGGCGGAGAGGCGG + Intergenic
970462202 4:16285569-16285591 ATTCTCCTCAGACTTACAGGAGG + Intergenic
971076383 4:23153817-23153839 TTTCTAATCAGACTTAGTGGTGG - Intergenic
972107693 4:35511480-35511502 TTTCTAAGAAGACATACAGGTGG - Intergenic
972518914 4:39835265-39835287 TTTCTAATCTCAGTGACAGTAGG - Intronic
976691783 4:87876244-87876266 TTTCTAATATGATTGAGAGGAGG - Intergenic
977139626 4:93352174-93352196 ATTCTCATCAGAGGGACAGGTGG + Intronic
979836007 4:125368294-125368316 TTTTTAATCTGACTCACTGGAGG + Intronic
982917871 4:161235969-161235991 TATCTAATCAGATAAACAGGAGG - Intergenic
983810919 4:172061241-172061263 TATCTAGTCAGATTGAAAGGAGG - Intronic
989606865 5:43252739-43252761 TTTCTAATCAGCCTAAAAGGGGG - Intronic
989813707 5:45710214-45710236 TTTATCAGCAGCCTGACAGGTGG + Intergenic
991425498 5:66487825-66487847 TATCTACTCAGAGTGGCAGGCGG - Intergenic
991992457 5:72354066-72354088 TTTTTAATCATACTGACAAAAGG + Intronic
994999721 5:107112022-107112044 TTTCAAATCAAACTCCCAGGTGG + Intergenic
1001431417 5:171665596-171665618 TTTCTATTTAGACTGATAAGGGG + Intergenic
1005154725 6:22791449-22791471 TTTCTACCCAGACTGTCAGATGG + Intergenic
1005401290 6:25436931-25436953 TCTCTAATCACACACACAGGCGG + Intronic
1005603967 6:27456766-27456788 TCTCTTATCAGGCTGACAGTCGG + Intronic
1007445020 6:41898427-41898449 TTTCTAATAAGACTGGTAGTGGG + Intergenic
1008149549 6:47934091-47934113 TCTCTAATGAGACAGCCAGGTGG + Intronic
1009198605 6:60717160-60717182 TTACTTATCAGAGTGACTGGAGG - Intergenic
1010738836 6:79474878-79474900 TTTCTAATCAAACTCAAAGATGG + Intergenic
1010917401 6:81637198-81637220 TTTCTATTCCGTCTGACAGCTGG - Intronic
1010941809 6:81928166-81928188 TTTCTTATTAGGCTGACAAGTGG - Intergenic
1011040771 6:83027876-83027898 TGTTTAATCAGACTTCCAGGAGG - Intronic
1018470965 6:164097595-164097617 TCTCTAATCAAACTGACATCTGG + Intergenic
1022327587 7:29345983-29346005 TTCATAGTCAGACTGACAGCAGG + Intronic
1022953136 7:35357076-35357098 TTTCCATTCAGACTGATAAGTGG + Intergenic
1026123780 7:67561347-67561369 TTCATAATCACAGTGACAGGTGG + Intergenic
1033917115 7:146339806-146339828 TTTTTAATTAGACTGACAAATGG - Intronic
1036473860 8:9075605-9075627 CTTCTAAAGAGACTTACAGGGGG + Intronic
1039029078 8:33290196-33290218 TTTCTAATCAGACACACTGGAGG - Intergenic
1039344445 8:36688484-36688506 ATTCTAATCAGACTGAAGAGGGG + Intergenic
1048732915 8:137463714-137463736 TTTCTATTCCTCCTGACAGGAGG + Intergenic
1049314822 8:141959267-141959289 CCTCTAACCAGACTGACTGGAGG + Intergenic
1052608744 9:30740816-30740838 TAAAAAATCAGACTGACAGGAGG + Intergenic
1056459462 9:86795394-86795416 TTTCTATTCAGACTGTGAGAGGG + Intergenic
1056955634 9:91078865-91078887 TTTCTTATCAGACTTAAAGTCGG - Intergenic
1186943772 X:14541959-14541981 TTTTTAACCAGACTCTCAGGTGG - Intronic
1187745857 X:22408629-22408651 TTTCTAAGGAGACTCACAGCTGG - Intergenic
1188034631 X:25303556-25303578 TTGCTAATCAGTATGGCAGGAGG - Intergenic
1191230286 X:58088237-58088259 TTTCTAATGATAGAGACAGGTGG + Intergenic
1193881498 X:86927883-86927905 TCTAAAAGCAGACTGACAGGTGG + Intergenic
1195911366 X:109891287-109891309 TTTCTAATCTGTCTGCCAAGAGG + Intergenic
1197849062 X:130837589-130837611 TTTCTATTCAAACTGTCTGGCGG - Intronic
1197982744 X:132235033-132235055 TTCCTGATCACACTGAAAGGAGG - Intergenic
1201319194 Y:12678457-12678479 TTTCTCATCAGACTTAAAGACGG + Intergenic