ID: 927640376

View in Genome Browser
Species Human (GRCh38)
Location 2:24841879-24841901
Sequence GTCCCCAGGCACCACAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 342}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927640376_927640385 5 Left 927640376 2:24841879-24841901 CCCTCCCTGTGGTGCCTGGGGAC 0: 1
1: 0
2: 1
3: 29
4: 342
Right 927640385 2:24841907-24841929 CACACTGCCCACTCCTGCCCAGG 0: 1
1: 0
2: 5
3: 60
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927640376 Original CRISPR GTCCCCAGGCACCACAGGGA GGG (reversed) Intronic
900142212 1:1143418-1143440 GTCCCCAGGCAGTGCAGGGCTGG - Intergenic
900620512 1:3584872-3584894 GTCCCCAGGCACCTCCGGGCTGG - Intronic
901296953 1:8168173-8168195 GTGACCAGTCACCACAGGAAGGG - Intergenic
901669894 1:10849996-10850018 CACCCCAGGGAGCACAGGGATGG + Intergenic
901678904 1:10901994-10902016 GTCCTCAGGCACGGAAGGGAGGG - Intergenic
902248295 1:15136435-15136457 GTCAACAGGCACCATCGGGAAGG + Intergenic
902289343 1:15426517-15426539 GACCCCAGGAAGTACAGGGATGG + Intronic
903668285 1:25021212-25021234 GGCCGCAGGGACCTCAGGGAGGG + Intergenic
903953663 1:27011021-27011043 GGCCCCAGGCATGGCAGGGAGGG - Intronic
904756149 1:32769965-32769987 CCCCCGAGGCACCTCAGGGATGG + Exonic
905393615 1:37653369-37653391 GTGCCCAGGGACCCCAGAGAGGG + Intergenic
905569235 1:38991087-38991109 GTCACCAAGCAACACCGGGAAGG - Intergenic
905884790 1:41485780-41485802 GTCTCCAGGCACAACAGGAAAGG + Intergenic
907047434 1:51308049-51308071 GTCCACATGCACCACAGAGAAGG - Intronic
907064121 1:51462553-51462575 GTCCACATGCACCACAGAGAAGG + Intronic
909510534 1:76447629-76447651 GTCCCTAGGCTACACGGGGAGGG - Intronic
909562712 1:77024047-77024069 GGCCCCAGGCAGCAGAGGAAAGG + Intronic
913507879 1:119534743-119534765 TTCCCAAGGCACCACAGTGAAGG - Intergenic
913710021 1:121473380-121473402 GTTCCCAGGCTGCACAGAGAAGG + Intergenic
915016435 1:152738154-152738176 GTCCCCAGCCAGGACAGGGCTGG - Intronic
915252820 1:154602690-154602712 TTCCACAGGCAGCAAAGGGAGGG - Intronic
915476067 1:156153655-156153677 GTTCCCAGGCCCCAGAGGCAGGG - Exonic
916736023 1:167607756-167607778 GTCCCCAGGCTGCAAAGGGCAGG - Intergenic
916923935 1:169498008-169498030 GGCCTCAGGCTCCCCAGGGAAGG + Intergenic
918374627 1:183896836-183896858 GTCCTCAGGCACCAGGAGGAAGG + Intronic
920045528 1:203129894-203129916 GCTCCCAGGCAGCACTGGGATGG + Intronic
920351807 1:205342951-205342973 GTCACCAGGCCCCACTGAGAGGG - Intronic
921406771 1:214788933-214788955 GTTCCCAGGTACCAGAGGGCTGG + Intergenic
921793752 1:219319317-219319339 TTCCCCAGGCACCACATTAATGG - Intergenic
922517107 1:226215587-226215609 AGCCCCTGGCTCCACAGGGAGGG + Intergenic
923044007 1:230341592-230341614 CTCCCCAGACACGACACGGAAGG + Intronic
923045130 1:230350149-230350171 GTCAGCAGTCACCACAGGGCTGG + Intronic
923558932 1:235023683-235023705 GTCAGCAGGCACCACGAGGAAGG + Intergenic
924613026 1:245589410-245589432 GTCCCCAGGCGGCACTGAGAAGG + Intronic
1062992908 10:1836758-1836780 ATCCCGAGGCCCCACAGGGCAGG + Intergenic
1063112492 10:3048806-3048828 GGCCCCAGGCAGGAGAGGGAGGG + Intergenic
1063180504 10:3594159-3594181 GTTTCCAAGCACCACAGGCAGGG + Intergenic
1065800113 10:29344361-29344383 GTCCGCATCCAGCACAGGGAGGG - Intergenic
1067529240 10:47058589-47058611 GGGCCCAGGCACTACAGGGCTGG - Intergenic
1068949395 10:62762048-62762070 GTACCCAGGGACCCCAGAGAGGG + Intergenic
1069071720 10:63996317-63996339 GTCTCCAGGCACCAGAGAGAGGG + Intergenic
1069389235 10:67915019-67915041 TTCCCAAGACACCACAGGCAGGG - Intronic
1069826803 10:71259739-71259761 TTGCCCAGGCCCCACAGGGAGGG + Intronic
1070599664 10:77856878-77856900 TTCCACAGGCACTACCGGGAAGG - Exonic
1070737775 10:78876196-78876218 GACTCCAGGCAGCAGAGGGACGG + Intergenic
1070811002 10:79298131-79298153 GTCCCCATTTATCACAGGGATGG + Intronic
1071447244 10:85759953-85759975 GTCCCCAGGCACCACACTTTGGG - Intronic
1071463330 10:85918964-85918986 GTCCCCAGGCCCCACTGCTAGGG + Intronic
1074430014 10:113386471-113386493 GAACCCAGTCACCCCAGGGAGGG - Intergenic
1074986476 10:118664318-118664340 GTCTCCTGGCACCCCAAGGAGGG + Intergenic
1075853204 10:125605144-125605166 GTCCCCAGGCACAGCACGCAGGG + Intronic
1077374099 11:2197550-2197572 GTCCCCAGGACCCCGAGGGAGGG + Intergenic
1077463826 11:2724065-2724087 GCCCCCAGGCACCACCGGAGGGG - Intronic
1079244187 11:18741130-18741152 GTCCCCAGGAAGCTCAGAGAGGG + Intronic
1079391068 11:20022751-20022773 CTCCCCTGGGACCACATGGAGGG + Intronic
1079981289 11:27154022-27154044 ATCCCCAGGCACCACCTGGGAGG + Intergenic
1081418706 11:42846318-42846340 GTACCCAGAAACCACAGGGTAGG - Intergenic
1081762467 11:45585865-45585887 GTCCCCAGGCACCTAAGAGCTGG + Intergenic
1082816773 11:57514621-57514643 GTCGCCCGGCCCCAGAGGGAAGG - Intronic
1083341861 11:61963327-61963349 GTACCCAAGCACTACAGGAAAGG + Exonic
1083372344 11:62192375-62192397 GTCACCTGGGACCACAGGGTGGG + Intronic
1084220355 11:67674156-67674178 TTCCCCAGGAGCCCCAGGGATGG - Intronic
1084524458 11:69687003-69687025 GACCCCAGGAACCACAGGGCAGG + Intergenic
1084641790 11:70430603-70430625 GTCCCCAGACCCCATGGGGAGGG - Intronic
1085305952 11:75486228-75486250 TTCCCCAGTCAGAACAGGGAGGG - Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1088469289 11:110176498-110176520 GTCCCCAGGCACCCCGTGGCTGG - Intronic
1089149147 11:116351338-116351360 GCCCCCAGGGACCACAAGGATGG + Intergenic
1090330425 11:125927012-125927034 GACACCAGGCAACACAGTGAGGG - Intergenic
1091219044 11:133919837-133919859 GTCCCCAGGCCCAGCAGGGGCGG + Exonic
1092860572 12:12716741-12716763 GCCCCCAGCCTCCCCAGGGATGG + Intronic
1096234640 12:49917877-49917899 TTGCCCAGGCAGCCCAGGGAAGG + Intergenic
1099007839 12:77256102-77256124 GTCGCCTTGTACCACAGGGAGGG - Intergenic
1101401100 12:104387684-104387706 GTGCCCAGGAATCACAGGCAAGG + Intergenic
1101598704 12:106189757-106189779 GTGCCCAGGCTCCCCAGGGCTGG + Intergenic
1102045910 12:109830158-109830180 GACCCCAGGCACCCCAATGAGGG + Intronic
1104651613 12:130538838-130538860 ATCCCCAGGCAATACGGGGAGGG - Intronic
1104743846 12:131198141-131198163 GTCCCCATTAACCACAGGAAGGG - Intergenic
1104790494 12:131478598-131478620 ATCCCCATTAACCACAGGGAGGG + Intergenic
1113539467 13:111095123-111095145 GAGCCCAGGCTCGACAGGGAGGG + Intergenic
1113574000 13:111381926-111381948 GTCCTCAGTCACCACAGGCCTGG - Intergenic
1113715952 13:112508052-112508074 GGCCCCAGGCAGCACTGGGATGG - Intronic
1113895940 13:113764523-113764545 ATCACCAGGCCCCTCAGGGAAGG + Intronic
1113898539 13:113782747-113782769 GTCCCCAGAGACCACAGGTTGGG + Intronic
1114646507 14:24259299-24259321 GTCCCCATGGACCACATGGCAGG - Intronic
1117989753 14:61421967-61421989 GACCCCAGGCTAGACAGGGATGG + Intronic
1119536756 14:75409127-75409149 GACCCCAGGCCCCACAGGCCAGG - Intergenic
1121529383 14:94641634-94641656 CTCCTCAGGCACCACGGTGAGGG - Intergenic
1121864263 14:97347666-97347688 TTCCTCAGGGACCACAGGGGAGG + Intergenic
1122218962 14:100222998-100223020 GTCCCCTTGAACCACAGGGCTGG - Intergenic
1122220801 14:100238433-100238455 GGCCCCGGGCACCACGGGGGCGG - Intronic
1122366569 14:101198054-101198076 GTCCCCGGGCAGCAAAGGGGAGG + Intergenic
1122900057 14:104778688-104778710 GTCCCCAGGCTGGGCAGGGAAGG - Intronic
1122972044 14:105156273-105156295 GACCACAGGCTCCACAGAGAAGG + Intronic
1202848812 14_GL000225v1_random:2629-2651 TTCTCTAGGCTCCACAGGGAAGG - Intergenic
1202867872 14_GL000225v1_random:135013-135035 TTCTCTAGGCTCCACAGGGAGGG + Intergenic
1123479264 15:20616043-20616065 GTCCCCAGGGAGCAGGGGGATGG + Intergenic
1123638749 15:22384342-22384364 GTCCCCAGGGAGCAGGGGGATGG - Intergenic
1123930977 15:25171549-25171571 GCTCCGAGGCACCACTGGGATGG - Intergenic
1124653147 15:31487408-31487430 TTCCCCAGCGCCCACAGGGAGGG - Intronic
1125821805 15:42638170-42638192 TTCCAGAGTCACCACAGGGATGG + Intronic
1126406865 15:48331354-48331376 GTGCCCCGGCAGCCCAGGGATGG - Intronic
1127402873 15:58608254-58608276 GCCACCAGGCACCACTGGAAAGG + Intronic
1127973946 15:63983501-63983523 GTCCCCAGGACCCACAGGGTTGG - Intronic
1128146866 15:65336823-65336845 TTCCCCAGGCATTACAGGGTGGG - Intronic
1128254772 15:66188589-66188611 GACCCCAGGGCCCAGAGGGAGGG + Intronic
1129193209 15:73949605-73949627 CTCCCCAGGCAGGAAAGGGACGG - Intronic
1129393691 15:75233208-75233230 GGCTCCAGGGACCACGGGGAAGG - Intergenic
1129616764 15:77104982-77105004 GTCACCAGGCCCCCCAGGGAGGG - Exonic
1130135224 15:81176665-81176687 GGCTCCAGGCCCAACAGGGAAGG + Intronic
1130546113 15:84858347-84858369 GTCCCCAGGGACTCCAGGGCGGG + Exonic
1131152961 15:90058350-90058372 GTGTCCAGGCAGCATAGGGAAGG - Intronic
1132344855 15:101102047-101102069 ATCCCCAGCCAGCACTGGGATGG + Intergenic
1132715687 16:1288920-1288942 GTCCCCACCCACCCCAGGGCTGG + Intergenic
1132724584 16:1333365-1333387 GACCCCACGCGCCACGGGGAGGG + Intergenic
1133120236 16:3602050-3602072 ATCCCCAAGCACCCCAGGGCTGG - Intronic
1133504612 16:6399183-6399205 GTCCCGAGGCAGCACAGAGCAGG + Intronic
1133556568 16:6911408-6911430 GTTGCCAGCAACCACAGGGAGGG - Intronic
1133849093 16:9485276-9485298 GTCCCCAGGCTCCAGTGAGATGG + Intergenic
1134142303 16:11731368-11731390 GTCCCCAGGCACAACTGGAGGGG - Intronic
1134677171 16:16098865-16098887 ATTCCCAGGCAGCACAGTGATGG + Intronic
1135406493 16:22201857-22201879 GGCCGCAGGCACCACAGGAAGGG - Intergenic
1136282623 16:29222661-29222683 GTCCCCAGGCACCACTGCCAGGG + Intergenic
1137352563 16:47726425-47726447 ATCCAGAGGCACCACGGGGAGGG - Intergenic
1137923208 16:52512556-52512578 GTCCCCAGTCACCAAGGGCATGG - Intronic
1139632026 16:68236696-68236718 GTCACCAGGGATCACAGGGAAGG + Intronic
1141133012 16:81447717-81447739 GTCACCAAGCACTACAGGCAGGG + Intronic
1141572137 16:84940690-84940712 GGCCCCATGCATCCCAGGGAAGG + Intergenic
1141604582 16:85145534-85145556 TTCCCCAGGCCCCGCTGGGATGG - Intergenic
1141990419 16:87606070-87606092 GTCCCCAGGCAGCCCATGGAAGG + Intronic
1142005870 16:87689398-87689420 AGGCCCAGGCACCACAGGAAGGG - Intronic
1142086997 16:88188586-88188608 GTCCCCAGGCACCACTGCCAGGG + Intergenic
1142088504 16:88197621-88197643 GGCCCCAGGAACCATGGGGAGGG - Intergenic
1142841135 17:2631474-2631496 CTTGCCTGGCACCACAGGGAGGG - Intronic
1143623518 17:8094993-8095015 TACCACGGGCACCACAGGGATGG + Intergenic
1143892756 17:10115249-10115271 GTCACCAGCCAGCAGAGGGAAGG + Intronic
1143972721 17:10807111-10807133 GTCCCCAGGAGAGACAGGGAGGG - Intergenic
1144396516 17:14849189-14849211 GTCCCCAGGCAGGCCAGGCAAGG + Intergenic
1144481322 17:15631793-15631815 TTCCCCAGGAAGCCCAGGGAAGG - Intronic
1144916983 17:18731938-18731960 TTCCCCAGGAAGCCCAGGGAAGG + Intronic
1145094171 17:20009861-20009883 CCCCCAAGGCACAACAGGGAGGG - Intronic
1146398646 17:32487273-32487295 GTCCCCAGGCGCAGCCGGGAGGG - Intronic
1147834439 17:43319940-43319962 GTCCCCAGGCTGCACAGAGCAGG + Intergenic
1148079090 17:44957652-44957674 ATCTCCAGACCCCACAGGGAAGG + Intergenic
1148225698 17:45896567-45896589 GTCCCCAATCTCCGCAGGGAAGG - Intronic
1148895735 17:50838030-50838052 GTCCTTGGGCACCAGAGGGAAGG - Intronic
1149221358 17:54418354-54418376 GTGTGCAGGCACCACAGGCAGGG + Intergenic
1149481297 17:57005469-57005491 GTCCCCAGGAGGCACAGGCAAGG - Intronic
1151426736 17:74035574-74035596 ATCCCAAGGAACCACAGTGAAGG - Intergenic
1151674276 17:75589696-75589718 TTCCCCAGGATCCACAGGGCAGG + Intergenic
1151923502 17:77175540-77175562 CTGCCCGGGCACCACAGTGAAGG - Intronic
1152186680 17:78861207-78861229 GTGCCCAGGCTGGACAGGGAAGG - Intronic
1152530949 17:80918767-80918789 GCACCCAGGCAGCACAGGGACGG - Intronic
1152562199 17:81084156-81084178 GTCCCCAGGGCCCTCAGCGATGG + Intronic
1153359177 18:4174275-4174297 GTCCACAGGCAGCTCAGGGCAGG - Intronic
1154470152 18:14692994-14693016 GGCCACAGGCACCATATGGAGGG - Intergenic
1155918161 18:31576247-31576269 GCCCCATGGCACCACAGGGATGG + Intergenic
1157444623 18:47735321-47735343 CACACCAGTCACCACAGGGAGGG + Intergenic
1160403442 18:78628459-78628481 GTCCCCAGCCATGATAGGGAGGG + Intergenic
1160520829 18:79507105-79507127 GTCGCCAGGCACTGCGGGGAGGG + Intronic
1160578094 18:79868312-79868334 GTCACCAGGCCCCACGCGGAGGG - Intronic
1160578107 18:79868367-79868389 GTCACCAGGCCCCACGCGGAGGG - Intronic
1161324828 19:3658569-3658591 GTCCCCTGGCCTCCCAGGGAGGG - Intronic
1161649999 19:5478461-5478483 TTCCACAGGCGCCGCAGGGACGG - Intergenic
1161680700 19:5678381-5678403 GGCCCCAGGGAGCACAGGGTTGG - Intronic
1161982597 19:7637609-7637631 GTGTCCAGGCCCCACAGGGGTGG + Intronic
1163662947 19:18589370-18589392 GTCCCCAGACACCAGAGGGGAGG - Intronic
1165391554 19:35542077-35542099 GTACCCAGGCATAACAGGGGTGG + Intronic
1165441471 19:35830867-35830889 GTCCCCAGGCTCCAGACGGGGGG + Exonic
1165520582 19:36311165-36311187 GTCCCCAAGCAACAGAGTGAGGG + Intergenic
1165623489 19:37267419-37267441 GTCCCCAAGCAACAGAGTGAGGG - Intergenic
1165996094 19:39845262-39845284 GTGCTCAGGCACCACCGAGAAGG + Intronic
1166253731 19:41587747-41587769 CTCCCCAGGGCCCTCAGGGAAGG - Intronic
1166752077 19:45169044-45169066 GTCCTCAGGCACAGCAGGGCCGG + Intronic
1167097322 19:47381295-47381317 GCCCCCAGGCCCCACAGGATGGG + Exonic
1168175240 19:54623850-54623872 TTCCCCCGGCCCCGCAGGGAGGG + Intronic
925067162 2:937545-937567 ATCAGCAGGCTCCACAGGGAAGG + Intergenic
927283309 2:21330732-21330754 GGCTCCAGGCACCAGAGAGAAGG - Intergenic
927640376 2:24841879-24841901 GTCCCCAGGCACCACAGGGAGGG - Intronic
927673578 2:25089037-25089059 GTCCACAGGCCCTCCAGGGAAGG - Intronic
929532496 2:42761769-42761791 GCCCTCTGTCACCACAGGGAAGG - Intergenic
930214973 2:48685884-48685906 GACCCCCAGCCCCACAGGGAAGG - Intronic
930740884 2:54831629-54831651 AAGCCCAGGCACCACAGGGCAGG - Intronic
931637247 2:64351789-64351811 ATACCCAGGTACTACAGGGAAGG + Intergenic
934857725 2:97739456-97739478 GCCCCCAGGCAGCACACAGAAGG + Exonic
935205196 2:100890880-100890902 GACCCCTGGCTGCACAGGGAGGG + Intronic
936151476 2:110024428-110024450 GTCCCCAGGCTCCCCAGGTGAGG + Intergenic
936193198 2:110346941-110346963 GTCCCCAGGCTCCCCAGGTGAGG - Intergenic
940237484 2:151526835-151526857 GTCCCCAGGGACACCAGGGAAGG - Intronic
940419402 2:153461706-153461728 CTGCCAAGGCTCCACAGGGAAGG + Intergenic
940855148 2:158723680-158723702 GGCCCCAGGCACTCCAGGGCTGG + Intergenic
942286663 2:174424310-174424332 GTCCCCAGGGAAGACAGGCATGG + Intronic
944524395 2:200603769-200603791 GTCCCCAGACTCCAAAGAGAAGG + Intronic
945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG + Intronic
946203848 2:218089421-218089443 GCCCCCACCCACCCCAGGGAAGG + Intronic
946248964 2:218401702-218401724 GCCCCCACGCACCTTAGGGATGG - Exonic
947523638 2:230865881-230865903 GTCCCCCGACCCCACGGGGAGGG + Intronic
947686569 2:232091143-232091165 GTCCCTAAGCTCCACATGGATGG - Intronic
947727666 2:232410007-232410029 GTCCCCAGGGTGCACCGGGAGGG - Exonic
948056894 2:235015436-235015458 GTCCCCATCGACCATAGGGAGGG - Intronic
948375929 2:237520151-237520173 CTCCCAAGGCATGACAGGGAAGG + Intronic
948801921 2:240436916-240436938 CTCCTCCGGGACCACAGGGAGGG - Intronic
948811834 2:240482338-240482360 GCAGGCAGGCACCACAGGGAGGG - Intronic
948845612 2:240681541-240681563 TGCTCCAGGCACCACAGGAAGGG - Intronic
948848243 2:240693189-240693211 TGCTCCAGGCACCACAGGAAGGG + Intronic
948913978 2:241020905-241020927 GTCCCCTGACACCACAGGACGGG + Intronic
948992619 2:241562494-241562516 GTCCCATGGGACCTCAGGGAGGG + Intronic
1168853157 20:990229-990251 GTCCCGAGGCACACCAGGGATGG + Intronic
1171048266 20:21831938-21831960 GTGCGCCTGCACCACAGGGAAGG + Intergenic
1173566027 20:44039290-44039312 GTCCCCAGGGAGCTCTGGGAAGG + Intronic
1175519111 20:59588402-59588424 GGCCCCAGGGACCAGGGGGACGG - Intronic
1175636187 20:60586443-60586465 GTCCCCAGGGACCCCTGGGGAGG - Intergenic
1175828397 20:61949504-61949526 GGATCCAGGCACCACAGGGTTGG + Intergenic
1175862483 20:62157727-62157749 GCCCACAGGCCACACAGGGAAGG - Intronic
1176160310 20:63644168-63644190 GTGGGCAGGCACCGCAGGGAAGG + Intronic
1178263820 21:31124338-31124360 ATCCCCAGGAGCCACTGGGAAGG + Intronic
1179910228 21:44443589-44443611 GCCTCCAGGTGCCACAGGGAAGG + Intergenic
1180103550 21:45601736-45601758 GTCCCCAGGGCCCACAGCAAGGG + Intergenic
1180127581 21:45802730-45802752 GTCCCCAAGGACCCCAGGCAGGG + Intronic
1180937873 22:19637892-19637914 GGCCCGAGGGACCCCAGGGAAGG + Intergenic
1181075903 22:20376596-20376618 GTCCCCAGGCTGGAGAGGGATGG - Intronic
1181175719 22:21033703-21033725 CTGCTCAGGCAACACAGGGATGG - Intergenic
1183190901 22:36321618-36321640 GTCCCCTAGCTCCACAGAGAAGG + Intronic
1183403760 22:37619889-37619911 GTCTCCAGGCTGCCCAGGGAGGG - Intronic
1183641604 22:39096250-39096272 GTCCCCAGATAGCACTGGGAGGG - Intergenic
1184386070 22:44175413-44175435 ATCCCCGGCCACCGCAGGGACGG + Intronic
1184600912 22:45542801-45542823 CTCCCCAGGACCCACAAGGAGGG - Intronic
1184836871 22:47029181-47029203 GTCCCCGGGCCCCATGGGGAGGG - Intronic
1185048062 22:48538864-48538886 GTCCCCAGGGCCCACAGAGCAGG + Intronic
1185292497 22:50034241-50034263 GGCCCACAGCACCACAGGGAAGG - Intronic
1185376272 22:50483874-50483896 GTCCCCCGTCCCCCCAGGGAAGG - Exonic
950440598 3:13008055-13008077 CACCCCAGGAACCCCAGGGAGGG + Intronic
950664536 3:14487286-14487308 GTCCCCAGGCCCCGCCTGGAAGG + Exonic
952750277 3:36819407-36819429 GACCCCTGGTACAACAGGGACGG + Intergenic
953235370 3:41101946-41101968 GTGCCCACGCTGCACAGGGAAGG + Intergenic
953981406 3:47414979-47415001 GTCCTCAGGGACCCCAGGGCGGG - Exonic
955370528 3:58347392-58347414 GTTCCCAGGGACCAGAAGGAGGG - Intronic
957982255 3:87525405-87525427 GTCCCAAGGCTGCACAGAGATGG - Intergenic
959962013 3:112308220-112308242 GTGCCTGGGCACCACAGTGAAGG + Intergenic
961318425 3:126056286-126056308 GTCTCCTGGCACCACAGACAGGG - Intronic
962377591 3:134871406-134871428 GTCCCCAGGCACTGGAGTGAGGG + Intronic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
967412531 3:189181109-189181131 GTCCCTAGGCTGCACAAGGATGG + Intronic
967900927 3:194451593-194451615 GTGGCCAGGAAGCACAGGGAAGG + Intronic
968510308 4:992643-992665 GTCCCGAGGCAGCACCGAGAGGG + Intronic
968619929 4:1599459-1599481 GGCCCCAGGCCCCACAGCCACGG + Intergenic
969030015 4:4204310-4204332 CTTCCCAGGCACCTCGGGGAAGG - Intronic
969514160 4:7637316-7637338 GTCCCCAGGGAACTCAGGGCAGG - Intronic
971405900 4:26320751-26320773 CTCCCCATGGACCACACGGAGGG + Exonic
971620466 4:28848891-28848913 GCCCCCTGGCACCACAGCTAAGG - Intergenic
975272784 4:72456852-72456874 GCCCCAAGCCAACACAGGGAGGG + Intronic
979078373 4:116303525-116303547 GTCCCTAGGCAGCACAGAGCAGG - Intergenic
979295619 4:119030224-119030246 GTTACCAGACACCACAGGCAAGG + Exonic
980137761 4:128876388-128876410 GTCCCCAGGAGCCAAAGGAAGGG + Intronic
983421746 4:167527096-167527118 GTGCCCAGGTACCACACTGAGGG - Intergenic
984880875 4:184409053-184409075 GTCCACAGGCACCTCAGGGCTGG - Intronic
985510251 5:309567-309589 GTCCCCGTGCACCCCAGTGATGG + Intronic
985510260 5:309595-309617 GTCCCCGTGCACCCCAGTGATGG + Intronic
985510286 5:309679-309701 GTCCCCGTGCACCCCAGTGAGGG + Intronic
985510295 5:309707-309729 GTCCCCGTGCACCCCAGTGATGG + Intronic
985510304 5:309735-309757 GTCCCCGTGCACCCCAGTGATGG + Intronic
985510313 5:309763-309785 GTCCCCGTGCACCCCAGTGATGG + Intronic
985510322 5:309791-309813 GTCCCCGTGCACCCCAGTGATGG + Intronic
985510331 5:309819-309841 GTCCCCGTGCACCCCAGTGATGG + Intronic
985510340 5:309847-309869 GTCCCCGTGCACCCCAGTGATGG + Intronic
985510349 5:309875-309897 GTCCCCGTGCACCCCAGTGATGG + Intronic
985510358 5:309903-309925 GTCCCCGTGCACCCCAGTGATGG + Intronic
985510367 5:309931-309953 GTCCCCGTGCACCCCAGTGATGG + Intronic
985588993 5:755197-755219 CTCCCCAGGCCGCACAGGGCTGG - Intronic
985603673 5:847713-847735 CTCCCCAGGCCGCACAGGGCTGG - Intronic
985674999 5:1226395-1226417 TTCCCCAGGCAACACGGGCAGGG + Intronic
985709572 5:1420721-1420743 GTCACCAGGCTGCACAGGCAGGG + Intronic
985727732 5:1524577-1524599 GGCCTCAGGCCCCGCAGGGATGG + Intergenic
986374207 5:7113728-7113750 GTCCCCAGGCTAGAAAGGGAGGG - Intergenic
986385260 5:7226997-7227019 TTCCCCAGGCATCCCAGAGATGG + Intergenic
987696544 5:21341337-21341359 GGCCTCAGCCAGCACAGGGAGGG - Intergenic
992504244 5:77369744-77369766 GTTCAAAGGCACCACAGGGAAGG - Intronic
993889833 5:93460319-93460341 GACCCCACGCAGCACCGGGAAGG + Intergenic
996695615 5:126391730-126391752 GTTCCCAGGGACTGCAGGGAAGG + Intronic
997074113 5:130651783-130651805 GATCCCAGGAACAACAGGGAAGG + Intergenic
997341046 5:133144813-133144835 CTCCCCAGGGCCCTCAGGGATGG - Intergenic
997719185 5:136064434-136064456 GGCCCCAGGCCACACAGGTAGGG - Intergenic
998012936 5:138709662-138709684 GTCCCCGGGCAGCAGAGGAAGGG - Intronic
998227894 5:140341135-140341157 ATCCCTAGGGACCACTGGGAAGG + Intronic
998753681 5:145352466-145352488 GTCCCGAGGCCCCATAGAGAAGG + Intergenic
998818182 5:146034339-146034361 CTCTCCAGGCACCACAGGCTGGG + Intronic
999134846 5:149311763-149311785 GTCCTCAGGCAACCCAAGGAGGG + Intronic
1001295528 5:170496188-170496210 GCCCCCAGGCACTAAAAGGATGG + Intronic
1001587944 5:172845904-172845926 GTCCCCAGGCTCCTCTGGGTGGG + Intronic
1007498599 6:42279103-42279125 GACCCCAGGCCTCACAGGGTGGG + Intronic
1007691253 6:43702948-43702970 GTACACAGGCCCCACAGGGCGGG + Intergenic
1008208628 6:48694021-48694043 GTGTCCAGGCACCCCAGGCAGGG - Intergenic
1010262117 6:73829456-73829478 GCCCCCAGGAATCACTGGGAAGG - Intergenic
1013987240 6:116209612-116209634 TTCACCAGGCAGCAGAGGGAAGG + Intronic
1015817356 6:137224429-137224451 GTGCCCAGGGAGCACAGTGAGGG - Intergenic
1016994025 6:149948211-149948233 TTCCACAGGCACCACTGGGCTGG + Intronic
1017159474 6:151351424-151351446 CTCCCCAGACACCACAGAGGAGG + Exonic
1017456717 6:154607273-154607295 TTCCCCAGGAAACACAGGCATGG + Intergenic
1017559893 6:155615666-155615688 GGCCCCAGGCCCCACATGGCTGG - Intergenic
1018469403 6:164082563-164082585 AACCCCAGCCACCATAGGGAGGG + Intergenic
1018715554 6:166530130-166530152 GTCCCCAGCAACTACAGGCAGGG - Intronic
1018910569 6:168098899-168098921 GTCCCCAGGCAAGACAGGCCTGG + Intergenic
1019142340 6:169956819-169956841 GCCTCTGGGCACCACAGGGAAGG - Intergenic
1019476837 7:1248405-1248427 GTGCCCAGGCCCCTCCGGGAAGG - Intergenic
1019764894 7:2843331-2843353 GTCCCCAGGCACCCTAGAGAGGG + Intronic
1021111547 7:16700039-16700061 GGCCCCAGGGAACACAGGAAGGG + Intronic
1023545290 7:41312077-41312099 GGCCCAAGCCACCCCAGGGAGGG - Intergenic
1024633642 7:51269110-51269132 GTCCCCAAGCACTCCTGGGATGG + Intronic
1024948198 7:54833169-54833191 GTCCCCTGGCTGCACAGGGCGGG - Intergenic
1027219621 7:76205609-76205631 GCCCCCAAGGACCACAGGCATGG - Intronic
1029595128 7:101533644-101533666 GACCCCAGGCAGCACTGGGCAGG + Intronic
1029598069 7:101548255-101548277 GGCTCCCTGCACCACAGGGAGGG + Intronic
1031347945 7:120692330-120692352 GTCCCCAAGCACCACAGTCAAGG - Intronic
1031530039 7:122865064-122865086 CTCACCACCCACCACAGGGAGGG - Intronic
1032080024 7:128854139-128854161 GTCCCCAAACACAGCAGGGAAGG - Exonic
1034556895 7:151855758-151855780 GGCGGCAGGAACCACAGGGATGG + Intronic
1035084857 7:156249367-156249389 ATACCAAGGCACCACCGGGAAGG + Intergenic
1035278456 7:157762810-157762832 GGCCCCAGGCACCGCATGCAGGG + Intronic
1036152702 8:6313430-6313452 GTCCCCAAGCCTTACAGGGAAGG + Intergenic
1036532618 8:9608605-9608627 GTCCCCAGGGATCACATGGCTGG - Intronic
1037742141 8:21616392-21616414 ACCCCCAGGGGCCACAGGGAGGG + Intergenic
1037877499 8:22555133-22555155 GTCAGCAGGCTCCGCAGGGAGGG - Intronic
1038219278 8:25592268-25592290 GTCCCCAGGACAGACAGGGAAGG + Intergenic
1038577486 8:28717435-28717457 CTCCCCCAGCACCACCGGGACGG - Exonic
1039506718 8:38057463-38057485 GGGCCCAGGCACCTCAGGAAAGG + Intronic
1040593203 8:48815278-48815300 GCCACCAGGCACCACTGGGCAGG - Intergenic
1041854710 8:62438425-62438447 GCCCCCAGGAGCCACAGAGAGGG - Intronic
1043270710 8:78329732-78329754 GGTCCCAGGGACCACAAGGAGGG - Intergenic
1045422181 8:102027030-102027052 GTCCCAAGGCTGCACAGGGCAGG + Intronic
1046778700 8:118192062-118192084 TGCCCCAGGCACCTCAGGGTTGG - Intronic
1047698655 8:127428875-127428897 CTCCCCAGGCTCCTTAGGGAAGG + Intergenic
1048558360 8:135505369-135505391 GTCCCAAGGGACCACAAGCAGGG - Intronic
1048861173 8:138725318-138725340 GTCCCCAGGTCCCACAGGCCAGG + Intronic
1048888962 8:138931281-138931303 GGCCCCAGGCACCAAAGGGTGGG + Intergenic
1049192096 8:141294205-141294227 GTCCCCAGGAAGCTCAGGCAGGG - Intronic
1049250627 8:141586988-141587010 GTTGCCAGGCACCACAGGGAGGG + Intergenic
1049270400 8:141692666-141692688 GCCCACAGGCACCGAAGGGAAGG - Intergenic
1049410069 8:142469926-142469948 GTCCCCAGGTCCCACAGCGAGGG - Intronic
1050545299 9:6704273-6704295 GTCCTCGGGCGCCGCAGGGAGGG + Intergenic
1052927868 9:34032442-34032464 GTCCCAAGGCTTCACAGGAAAGG + Intronic
1053222805 9:36325959-36325981 GCCCCCAGGCAGCCCTGGGATGG + Intergenic
1054461819 9:65469257-65469279 GTCTCCGGGGAGCACAGGGATGG - Intergenic
1055008870 9:71540985-71541007 GTCTCCAGGCAGCACACGGTAGG + Intergenic
1056490057 9:87097336-87097358 GTTGCCAGGCACTGCAGGGAGGG - Intergenic
1056714132 9:89014281-89014303 GACCCCAGGGACCACAGTGCAGG - Intronic
1058149889 9:101452561-101452583 GTCCCTAGGCTGCACAGGGCAGG - Intergenic
1058893531 9:109381278-109381300 GTACTCAGGCACCACACGGGTGG + Intronic
1059695255 9:116724427-116724449 GCCCCCAGGGACAAAAGGGAAGG + Intronic
1060868943 9:127023617-127023639 GTCCCCTGGTAGCAGAGGGAGGG - Intronic
1061068780 9:128295881-128295903 GTCCCCAGGGACAACAGTGCAGG - Intergenic
1061296671 9:129680565-129680587 TTCCCCAAGCCCCACAGGAAGGG + Intronic
1061338817 9:129962216-129962238 GCCCCCAGGCCTCACAGGGCTGG - Intronic
1061418025 9:130458568-130458590 GTCCCACGGCGCCACAGGAAAGG + Exonic
1061854377 9:133433522-133433544 AACCCCAGGTACCGCAGGGAGGG + Exonic
1062039745 9:134398797-134398819 GGCCCTAGGCACCCCTGGGAAGG - Intronic
1062478806 9:136742227-136742249 GACCCCAGGCAGCAAAGGGCTGG + Intronic
1062634814 9:137485148-137485170 GTCCCCAGGCCCCACACAGCAGG + Intronic
1203736899 Un_GL000216v2:145254-145276 TTCTCTAGGCTCCACAGGGAGGG - Intergenic
1185505359 X:629683-629705 GTCCCCAGGCCCCGCCGGGGAGG + Intronic
1186412349 X:9354965-9354987 GTGCCCAGGCAAGACAGGTAAGG + Intergenic
1187407079 X:19013984-19014006 GGCCCGAGGCACCACTGGGATGG + Exonic
1187773671 X:22730800-22730822 GTCTACAGGCTCCACAGGCAGGG - Intergenic
1189031289 X:37453584-37453606 GACCACAGGCACCATAGGAATGG - Exonic
1189249641 X:39590460-39590482 TTCCCCAGGAGCCACAGGCAGGG - Intergenic
1190259902 X:48791119-48791141 GTCCCCAGGGACCCCAGGCCAGG - Exonic
1192558400 X:72108541-72108563 GCCCCCAGGCAGCAGAGCGAAGG - Intergenic
1193271759 X:79537232-79537254 GTCCCCAGGCTACACAGAGCAGG - Intergenic
1196512806 X:116532296-116532318 ATCCCAAGGCTCCACAGAGAAGG + Intergenic
1197872056 X:131070060-131070082 GACCCTAGGCACTGCAGGGATGG + Intronic
1200053874 X:153448688-153448710 AGCCCCAGGCACCACCAGGATGG + Intronic
1200125251 X:153810440-153810462 GCCCCCAGTCAGCACAGAGAGGG + Intronic
1201149216 Y:11086328-11086350 GCCCCCAGGTACCACAGGACAGG - Intergenic
1201176106 Y:11308947-11308969 TTCTCTAGGCTCCACAGGGAGGG - Intergenic