ID: 927640377

View in Genome Browser
Species Human (GRCh38)
Location 2:24841880-24841902
Sequence GGTCCCCAGGCACCACAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927640377_927640385 4 Left 927640377 2:24841880-24841902 CCTCCCTGTGGTGCCTGGGGACC 0: 1
1: 0
2: 2
3: 28
4: 268
Right 927640385 2:24841907-24841929 CACACTGCCCACTCCTGCCCAGG 0: 1
1: 0
2: 5
3: 60
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927640377 Original CRISPR GGTCCCCAGGCACCACAGGG AGG (reversed) Intronic
900780607 1:4615144-4615166 TGTCCCCAGGCACCACACTGGGG - Intergenic
901296954 1:8168174-8168196 GGTGACCAGTCACCACAGGAAGG - Intergenic
901678905 1:10901995-10902017 GGTCCTCAGGCACGGAAGGGAGG - Intergenic
902300680 1:15500586-15500608 GGCCCCCAGCCTCCAAAGGGGGG + Intronic
902537944 1:17132278-17132300 TGTCCCCAGGAACCAAAGTGAGG - Intergenic
902709344 1:18227926-18227948 CGTCTCCAGCCACCACAGGGGGG - Exonic
903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG + Intergenic
904477994 1:30776898-30776920 TGTCCCCAGACTCCTCAGGGAGG + Intergenic
904603170 1:31684580-31684602 GAACGCCGGGCACCACAGGGCGG - Exonic
905863594 1:41365411-41365433 GGTGTCCAGGCAAGACAGGGAGG + Intronic
906675214 1:47688392-47688414 GGCCCCCTGGCACCACACGGGGG - Intergenic
912708006 1:111929191-111929213 GGTGCCCAGGTACCAGAGGTGGG - Intronic
913314583 1:117539320-117539342 GGTCCCCTGTCCTCACAGGGAGG + Intergenic
914324116 1:146594674-146594696 GGTTACCAGGCATCAGAGGGTGG + Intergenic
915252821 1:154602691-154602713 GTTCCACAGGCAGCAAAGGGAGG - Intronic
915476068 1:156153656-156153678 GGTTCCCAGGCCCCAGAGGCAGG - Exonic
920313580 1:205062384-205062406 GGACCACAGGAGCCACAGGGAGG - Intronic
922170012 1:223146161-223146183 GATCCCCAAGCCCTACAGGGAGG - Intergenic
1063180503 10:3594158-3594180 GGTTTCCAAGCACCACAGGCAGG + Intergenic
1063301178 10:4850177-4850199 GGTCTCCAGGCCCCAGAGTGGGG - Intergenic
1065434660 10:25694405-25694427 GGTCCCCAGGCAATGCTGGGAGG + Intergenic
1067567738 10:47350551-47350573 GGTCCCCAGACACCTCCTGGAGG - Exonic
1067791030 10:49287979-49288001 GGATATCAGGCACCACAGGGTGG - Intergenic
1067831405 10:49612984-49613006 GGTCCTCAGGCTCCCCCGGGCGG - Intronic
1068949394 10:62762047-62762069 GGTACCCAGGGACCCCAGAGAGG + Intergenic
1069071719 10:63996316-63996338 AGTCTCCAGGCACCAGAGAGAGG + Intergenic
1069826802 10:71259738-71259760 CTTGCCCAGGCCCCACAGGGAGG + Intronic
1069862455 10:71480173-71480195 AGTCCCCTGGCACTTCAGGGGGG - Intronic
1070537889 10:77393015-77393037 AGTCCCCAGCCAGCTCAGGGAGG + Intronic
1071447245 10:85759954-85759976 AGTCCCCAGGCACCACACTTTGG - Intronic
1071463329 10:85918963-85918985 GGTCCCCAGGCCCCACTGCTAGG + Intronic
1071463940 10:85922875-85922897 GGCCCCCAGGAGACACAGGGTGG - Intronic
1071531488 10:86392931-86392953 GGGGCCCAGGACCCACAGGGAGG - Intergenic
1075623618 10:123946268-123946290 GGTCCCAAGGGACTACATGGAGG + Intergenic
1075723070 10:124598490-124598512 GATGCCCAAGCACCTCAGGGGGG - Intronic
1075782406 10:125026046-125026068 GGTCCCCAGGCAGGGCAGGCGGG + Intronic
1076233047 10:128838009-128838031 GGGCTCCTGGCAGCACAGGGTGG + Intergenic
1076236190 10:128865142-128865164 AGTCCGCAGGCAACACTGGGTGG + Intergenic
1076615422 10:131751470-131751492 GGTCCCTAGGCCCCAGTGGGAGG - Intergenic
1077374098 11:2197549-2197571 GGTCCCCAGGACCCCGAGGGAGG + Intergenic
1077463827 11:2724066-2724088 GGCCCCCAGGCACCACCGGAGGG - Intronic
1077531074 11:3095203-3095225 GGTCTCCAGGCTCCACGGAGAGG + Intronic
1077863693 11:6205550-6205572 GAACCCCAGGCAGCCCAGGGAGG - Exonic
1079244186 11:18741129-18741151 GGTCCCCAGGAAGCTCAGAGAGG + Intronic
1082252584 11:49997935-49997957 GGTCCCTAGGCAAAAAAGGGAGG + Intergenic
1083372343 11:62192374-62192396 GGTCACCTGGGACCACAGGGTGG + Intronic
1083378231 11:62243603-62243625 GGTCACCTGGGGCCACAGGGTGG + Intronic
1085614220 11:77982870-77982892 GGTCACCAGGCACAATAAGGAGG + Intronic
1087770626 11:102205946-102205968 GCTCCCCAGAGCCCACAGGGAGG + Exonic
1088688569 11:112305408-112305430 GCTCCCCAGTCACCAGAGGGTGG - Intergenic
1088755397 11:112881569-112881591 GCTCCCCAGGCAGCAGAGCGAGG - Intergenic
1089921524 11:122213558-122213580 GGTTCCCAGCCACCCCAGGGAGG - Intergenic
1090330408 11:125926947-125926969 GGGACCCAGGCAGCACAGGAGGG - Intergenic
1091259070 11:134219435-134219457 CCTCCCCAGGGACCTCAGGGAGG - Intronic
1091267415 11:134281945-134281967 GGGCCACACGCATCACAGGGTGG - Intronic
1093262332 12:16954121-16954143 GGGCCCCAGGCAGCCCAGGAGGG + Intergenic
1095094418 12:38138203-38138225 GGTCCCCAGGGGCAACAGGAGGG - Intergenic
1095952000 12:47786605-47786627 GGTCACCCGGCCCCACTGGGTGG - Exonic
1096387419 12:51204101-51204123 GCTCCCCAGGGACCACAGGAGGG + Intronic
1096993315 12:55822378-55822400 GGATTCCAGGCACCAGAGGGCGG - Exonic
1097917894 12:65039488-65039510 TGTCCTCTGGCCCCACAGGGTGG + Intergenic
1103178816 12:118889739-118889761 GGGCCCCAGGTACAACTGGGTGG + Intergenic
1104329559 12:127831704-127831726 GGTCCACATGCCCCCCAGGGTGG - Intergenic
1104623652 12:130336963-130336985 GGTCTGCAGGCTCCACAGGTGGG - Intergenic
1104651614 12:130538839-130538861 GATCCCCAGGCAATACGGGGAGG - Intronic
1106248839 13:27969030-27969052 GGTCCCCAGGCAGCATGGTGAGG - Exonic
1108512572 13:51169620-51169642 TGTCCCCAGGCTGCACAGAGTGG - Intergenic
1113539466 13:111095122-111095144 GGAGCCCAGGCTCGACAGGGAGG + Intergenic
1113587398 13:111474766-111474788 GGTCCCCAGGCTCCTTGGGGAGG + Intergenic
1113898538 13:113782746-113782768 TGTCCCCAGAGACCACAGGTTGG + Intronic
1114645168 14:24252049-24252071 AGTGGCCAGTCACCACAGGGGGG + Intronic
1119671639 14:76524333-76524355 GGTCCCAAGGAACAACATGGAGG - Intergenic
1121328335 14:93034575-93034597 GGCCCCCAGGCAGCTCAGGCTGG - Intronic
1121335108 14:93073141-93073163 GGTCCCCTGGCACCATTGTGAGG - Intronic
1122643743 14:103177680-103177702 GGACCCCACCCACCCCAGGGGGG + Intergenic
1122939046 14:104973084-104973106 GGACCCCTGGCACCACGTGGTGG + Intronic
1123405594 15:20018005-20018027 GGTCTCGGGGCCCCACAGGGTGG - Intergenic
1123429311 15:20201380-20201402 GGCCCCCAGCCACCACTGGCAGG - Intergenic
1123514924 15:21024653-21024675 GGTCTCGGGGCCCCACAGGGTGG - Intergenic
1123716358 15:23035684-23035706 GGTCCCCAACCCCCACATGGTGG - Intronic
1125671526 15:41476900-41476922 GAACCCCAGGCCTCACAGGGTGG - Intronic
1127167035 15:56254485-56254507 GGACCCCAGGAGGCACAGGGAGG + Intronic
1127398650 15:58563970-58563992 GGTCCTCAGGCTCCAGAGGCAGG - Intronic
1128146867 15:65336824-65336846 CTTCCCCAGGCATTACAGGGTGG - Intronic
1128147036 15:65337564-65337586 GATCCCCAGGGAGCACTGGGAGG + Intronic
1128228405 15:66018418-66018440 GGGCTACAGGCAGCACAGGGTGG + Intronic
1128254771 15:66188588-66188610 GGACCCCAGGGCCCAGAGGGAGG + Intronic
1128890963 15:71331508-71331530 GCTCCACAGGCACCATGGGGCGG + Intronic
1129326489 15:74802678-74802700 GCTCCCCAGGCCCCACAGGTGGG - Exonic
1129540046 15:76341557-76341579 GGTCCCCAGGCGCACGAGGGGGG - Intronic
1129616765 15:77104983-77105005 AGTCACCAGGCCCCCCAGGGAGG - Exonic
1130255881 15:82325896-82325918 GGTCCCCAGAGGCCCCAGGGAGG + Intergenic
1130546112 15:84858346-84858368 GGTCCCCAGGGACTCCAGGGCGG + Exonic
1131657589 15:94477668-94477690 GGTTCCCTGGCAGCTCAGGGAGG + Intronic
1132332661 15:101023560-101023582 GATCCCGAGGAATCACAGGGTGG - Intronic
1132526220 16:416494-416516 GGTTCCCTGGCACCAGAGAGCGG - Intergenic
1134142304 16:11731369-11731391 TGTCCCCAGGCACAACTGGAGGG - Intronic
1135406494 16:22201858-22201880 TGGCCGCAGGCACCACAGGAAGG - Intergenic
1135425856 16:22335540-22335562 CAGCCCCAGGCAGCACAGGGTGG + Intergenic
1136234562 16:28905737-28905759 TGTCCTCAGGCTGCACAGGGAGG + Exonic
1136282622 16:29222660-29222682 GGTCCCCAGGCACCACTGCCAGG + Intergenic
1136855007 16:33648352-33648374 GGCCCCCAGCCACCACTGGCAGG + Intergenic
1137715497 16:50595821-50595843 GGGCCCGTGTCACCACAGGGTGG - Intronic
1138460255 16:57143740-57143762 TGCCCCCAGGCTCCCCAGGGAGG + Intronic
1139183003 16:64770181-64770203 GGTCCACAGCCACAACTGGGAGG - Intergenic
1139752974 16:69120325-69120347 GGTTCCCTGGGACCACAGGGGGG - Exonic
1140009443 16:71116171-71116193 GGTTACCAGGCATCAGAGGGTGG - Intronic
1141909002 16:87045748-87045770 GGTCCCCAGGGAACACGGCGTGG + Intergenic
1141917528 16:87109921-87109943 GGGCCCCAGGCAAAACGGGGTGG + Intronic
1142015648 16:87745369-87745391 GGGGCAGAGGCACCACAGGGCGG - Intronic
1142086996 16:88188585-88188607 GGTCCCCAGGCACCACTGCCAGG + Intergenic
1142088505 16:88197622-88197644 GGGCCCCAGGAACCATGGGGAGG - Intergenic
1203116586 16_KI270728v1_random:1496837-1496859 GGCCCCCAGCCACCACTGGCAGG + Intergenic
1142902348 17:3019944-3019966 GGGCCACAGGCACCAATGGGCGG - Intronic
1143575821 17:7792533-7792555 GATCCCCAGGCCCCACAGGAGGG + Intronic
1144624727 17:16838892-16838914 GGACCCCAGGCTCTACAGGAGGG + Intergenic
1144881703 17:18433829-18433851 GGACCCCAGGCTCTACAGGAGGG - Intergenic
1145150530 17:20510557-20510579 GGACCCCAGGCTCTACAGGAGGG + Intergenic
1145244922 17:21262424-21262446 GGTTCCCTGGCCCCACAGTGGGG - Intergenic
1145910230 17:28538032-28538054 GGTCCACAGACAACCCAGGGAGG - Exonic
1146398647 17:32487274-32487296 GGTCCCCAGGCGCAGCCGGGAGG - Intronic
1147920518 17:43913804-43913826 TGTCCTCAGGCACCTCAGAGAGG - Intergenic
1147937908 17:44024170-44024192 GCCCCCCAGGCGCCACAGGCTGG + Intergenic
1149654340 17:58302403-58302425 GGTCCCCAGGGCCCCCAGGTGGG - Exonic
1150005030 17:61463963-61463985 CGCCCCCAGGCCCCATAGGGGGG + Intronic
1151403675 17:73873011-73873033 GGTCCCCTGGCACAAGAGGTGGG - Intergenic
1151786293 17:76276641-76276663 GGCCCCCAGGCACCTCACGTGGG - Intronic
1151882743 17:76904893-76904915 GGTTCCCAGCCATGACAGGGAGG - Intronic
1154016028 18:10618665-10618687 GGACCCCAGGAACCACAGATAGG - Intergenic
1154065239 18:11101322-11101344 GGTCCCCACGCACCACTTGCTGG + Intronic
1154105074 18:11515637-11515659 GGTTCCCAGGCAGCACAGGGGGG - Intergenic
1155153859 18:23142492-23142514 AGACCCCAGACACCACAGAGGGG + Intronic
1157444622 18:47735320-47735342 GCACACCAGTCACCACAGGGAGG + Intergenic
1159129143 18:64260068-64260090 GGTCTCAAGGCCCCAGAGGGTGG + Intergenic
1160328574 18:77971692-77971714 GGTCACCAGGTACAACAGGAGGG + Intergenic
1160578095 18:79868313-79868335 GGTCACCAGGCCCCACGCGGAGG - Intronic
1160578108 18:79868368-79868390 GGTCACCAGGCCCCACGCGGAGG - Intronic
1160598422 18:79993978-79994000 GGTCCCCAGGCAGCACACTTTGG + Intronic
1160985087 19:1834909-1834931 GGAGCCCAGTGACCACAGGGAGG - Intronic
1161299528 19:3536077-3536099 GGTTCCCAAGCACAGCAGGGTGG - Intronic
1161324829 19:3658570-3658592 GGTCCCCTGGCCTCCCAGGGAGG - Intronic
1161612873 19:5252943-5252965 GTTCCCCTGGCATCAGAGGGTGG + Intronic
1162936179 19:13982858-13982880 AGTCCACAGCCAGCACAGGGTGG - Intronic
1163426509 19:17243704-17243726 GGGCCCCAGGTACCCGAGGGTGG - Intronic
1164735245 19:30536306-30536328 AGTCCCCAGGGACCACCTGGAGG - Intronic
1165032446 19:33007952-33007974 GGTCCCCTGGTGCCACCGGGTGG + Intronic
1165441470 19:35830866-35830888 GGTCCCCAGGCTCCAGACGGGGG + Exonic
1166617178 19:44260583-44260605 CATCCCCAGGCACCACATGGAGG - Intronic
1166668970 19:44698454-44698476 GGTGCCCAGGGACATCAGGGAGG + Intergenic
1166976156 19:46606198-46606220 GCTCTGCAGGCCCCACAGGGAGG - Intronic
1167097321 19:47381294-47381316 TGCCCCCAGGCCCCACAGGATGG + Exonic
1168136028 19:54352359-54352381 GGCCCCCAAGCACCACCTGGGGG - Exonic
925277983 2:2663791-2663813 CGTCTCCCGGCCCCACAGGGAGG - Intergenic
925426281 2:3751329-3751351 TGTCCCCAGGCCCCAGCGGGAGG + Intronic
927492080 2:23527319-23527341 GCCCCCCAGCCACCCCAGGGTGG + Intronic
927640377 2:24841880-24841902 GGTCCCCAGGCACCACAGGGAGG - Intronic
933759822 2:85665635-85665657 GGGCCCCGGGCAGCACAGGGAGG + Exonic
938115935 2:128602997-128603019 GCTTCCCAGGCCCCACAGTGAGG + Intergenic
941443179 2:165564079-165564101 GCTTCCCAGGTACCACAAGGGGG - Intronic
947727667 2:232410008-232410030 GGTCCCCAGGGTGCACCGGGAGG - Exonic
947871310 2:233440447-233440469 GGTCCCCCGGCACTTCAGTGGGG + Intronic
948588718 2:239036451-239036473 GGCTCACAGGCACCACAGTGGGG + Intergenic
948801922 2:240436917-240436939 GCTCCTCCGGGACCACAGGGAGG - Intronic
948845613 2:240681542-240681564 GTGCTCCAGGCACCACAGGAAGG - Intronic
948848242 2:240693188-240693210 GTGCTCCAGGCACCACAGGAAGG + Intronic
948913977 2:241020904-241020926 AGTCCCCTGACACCACAGGACGG + Intronic
949010069 2:241673213-241673235 GGTGGGCAGACACCACAGGGTGG + Exonic
1169186034 20:3618017-3618039 GCTTCCCAGGCCCCACAGGGAGG - Intronic
1169305326 20:4484866-4484888 GCTCCCCAGGGACCATAGGCGGG - Intergenic
1170721970 20:18889539-18889561 GGTCCTCAGGCACCATATGAAGG + Intergenic
1172277076 20:33685822-33685844 GGTCACCCCGCACCCCAGGGCGG + Intronic
1172898407 20:38316576-38316598 GGTTCCCAGGCAGCGCAGTGAGG + Intronic
1172976227 20:38907977-38907999 TGCACCCAGGCACCACAGGCAGG - Intronic
1173646183 20:44634476-44634498 GGTGCCCAGTAAGCACAGGGCGG - Intronic
1178840859 21:36136448-36136470 GGTCCCCATGCACAACAATGCGG - Intronic
1179147057 21:38777226-38777248 GGTCCCCAAGAACCCCAGCGTGG + Intergenic
1179786974 21:43735611-43735633 GGCTCCCAGGAACCACAGGCTGG - Intronic
1179913613 21:44462778-44462800 GGCCACCAGGCACCAGTGGGAGG - Intergenic
1180103549 21:45601735-45601757 GGTCCCCAGGGCCCACAGCAAGG + Intergenic
1180956508 22:19743699-19743721 TGTCCCCCAGCACCCCAGGGTGG + Intergenic
1180978822 22:19869044-19869066 GGTGCCCAGGCATGTCAGGGCGG - Intergenic
1181171597 22:21013028-21013050 GGGCCCCAGGTACCACTGGAAGG - Intronic
1181177759 22:21047490-21047512 GGGCCCCAGGTACCACTGGAGGG + Exonic
1181507353 22:23368813-23368835 TGTCCTCAGGCACCTCAGTGGGG + Intergenic
1181522713 22:23458758-23458780 CCTCCCCAGGAGCCACAGGGCGG - Intergenic
1182501848 22:30753646-30753668 GGTCAGCAGCCACCACAGAGCGG + Intronic
1182557616 22:31137724-31137746 GGCCTCCAGGGCCCACAGGGTGG - Exonic
1183403761 22:37619890-37619912 GGTCTCCAGGCTGCCCAGGGAGG - Intronic
950291090 3:11785077-11785099 GATGCTCAGTCACCACAGGGAGG + Intergenic
953981407 3:47414980-47415002 TGTCCTCAGGGACCCCAGGGCGG - Exonic
954390942 3:50267642-50267664 GGTCCCCAGCGGCCCCAGGGTGG + Intronic
955032403 3:55233770-55233792 GAGCCACAGGCACCACAGAGAGG - Intergenic
958636170 3:96750192-96750214 GGTCCCCCAGTAGCACAGGGAGG - Intergenic
959345610 3:105191193-105191215 GGGTTCCAGGCACCACTGGGGGG + Intergenic
961318426 3:126056287-126056309 GGTCTCCTGGCACCACAGACAGG - Intronic
962311689 3:134331422-134331444 GAGCCCCAGGCTCCACAGAGGGG + Intergenic
962377590 3:134871405-134871427 GGTCCCCAGGCACTGGAGTGAGG + Intronic
962825518 3:139096787-139096809 GGGCCCCAGGCACCATGGTGGGG - Intronic
967747901 3:193080769-193080791 GGACCCCTGGTACCACAGGAAGG - Intergenic
968870100 4:3237568-3237590 GCTCTCCAGACGCCACAGGGAGG + Intronic
968984788 4:3869239-3869261 AGGACCCAGCCACCACAGGGAGG - Intergenic
969460223 4:7325115-7325137 GGTCCCCAGGCCCCCTTGGGTGG + Intronic
971405899 4:26320750-26320772 GCTCCCCATGGACCACACGGAGG + Exonic
973230777 4:47837275-47837297 GATCCCCAGGCACCAACTGGGGG + Intronic
980649783 4:135697411-135697433 ACTCCACAGGCACCACAGGTAGG + Intergenic
982118755 4:152119118-152119140 GGTCCGGAGCCACCACAGTGGGG - Intergenic
983650510 4:170032026-170032048 TGTCCCCAGGCTTGACAGGGAGG + Intronic
985420552 4:189781192-189781214 GAGCCCCAGGGACCTCAGGGAGG + Intergenic
985496262 5:208264-208286 GGACCCCAGGAACAACACGGGGG + Intronic
985575807 5:673081-673103 GGTCCCCAAGCTCCTGAGGGAGG + Intronic
985652643 5:1114016-1114038 GGTCCACAGCCAGCACATGGCGG - Intergenic
985760531 5:1746479-1746501 GGTCCCCGGGCAGCCCAGGCAGG - Intergenic
985952853 5:3236717-3236739 TGTGGCCGGGCACCACAGGGTGG - Intergenic
992071240 5:73151235-73151257 GGTCCCCAGGGCCCACAAAGCGG - Intergenic
995456030 5:112353499-112353521 AGTCCCCAGGCAGCACAGGTAGG + Intronic
995699924 5:114923961-114923983 GGTCTCCAGGGGCCAGAGGGAGG + Intergenic
998274285 5:140737297-140737319 GCTCCCCTGACACCACAGTGAGG - Intergenic
998818181 5:146034338-146034360 CCTCTCCAGGCACCACAGGCTGG + Intronic
1001046371 5:168375233-168375255 GGTCTCCAGACAACAGAGGGTGG + Intronic
1001149840 5:169217562-169217584 GGCCCCCAGGAACCCCAGGCTGG - Intronic
1001489390 5:172144912-172144934 AGTCCCAAGGCACCTCAGGATGG + Intronic
1001587943 5:172845903-172845925 TGTCCCCAGGCTCCTCTGGGTGG + Intronic
1002044842 5:176536178-176536200 GGCCTCCAGGCACCACACGTTGG - Intronic
1002373120 5:178770174-178770196 GGGGCCCAGCCTCCACAGGGAGG - Intergenic
1002888564 6:1316030-1316052 GGTCCCCTGGAACCAGAGGTGGG - Intergenic
1003162016 6:3644160-3644182 GGTCACCAGTCCCCACAGGCGGG - Intergenic
1006332887 6:33405046-33405068 GCTCCCCCGGCAGGACAGGGCGG - Exonic
1007040213 6:38715130-38715152 GGACCCCAGGCACTGAAGGGCGG - Intergenic
1007498598 6:42279102-42279124 TGACCCCAGGCCTCACAGGGTGG + Intronic
1007691252 6:43702947-43702969 AGTACACAGGCCCCACAGGGCGG + Intergenic
1011300453 6:85867239-85867261 TGACCCCAGGCACCACCGGGAGG - Intergenic
1011769925 6:90664106-90664128 GGTCCTGAGTCACCACATGGTGG + Intergenic
1016753623 6:147659879-147659901 TTTCCACAGGCACAACAGGGCGG - Intronic
1016847922 6:148587486-148587508 GGTCTCCAGGACCCACAGGCTGG + Intergenic
1017721635 6:157247016-157247038 GCTTCCCAGGCACCACACAGGGG - Intergenic
1018727891 6:166627487-166627509 GGGCACCTGGAACCACAGGGCGG - Intronic
1018912620 6:168111674-168111696 GGTCACCAGGAACCACTGAGGGG + Intergenic
1018952435 6:168387815-168387837 GGTCCCCAGGGAGGAGAGGGTGG + Intergenic
1019588612 7:1817779-1817801 CCTCCCCAGGAGCCACAGGGCGG + Intronic
1019636334 7:2078063-2078085 GGCCCCCACTCACCACAGAGAGG + Intronic
1019746495 7:2703059-2703081 GGTCCCCAGACACTCCTGGGTGG - Intronic
1019764893 7:2843330-2843352 GGTCCCCAGGCACCCTAGAGAGG + Intronic
1019974975 7:4573885-4573907 GGTCCTCAGGCACCCCAGGTGGG + Intergenic
1021785127 7:24143729-24143751 TGTTTCCAGGCTCCACAGGGTGG + Intergenic
1023885273 7:44349617-44349639 GGTCCCCAGGTGGCACAGGAGGG - Intergenic
1024948199 7:54833170-54833192 CGTCCCCTGGCTGCACAGGGCGG - Intergenic
1025025705 7:55514671-55514693 GGTACCCATGCACCAAAGAGGGG + Intronic
1026393609 7:69928385-69928407 GGTCCCAAGGCAGGAAAGGGTGG - Intronic
1029156046 7:98518702-98518724 GGTCTCCAGGCACCACGTGGAGG + Intergenic
1029664121 7:101983435-101983457 GGGCCCAGGGCACCCCAGGGTGG - Intronic
1034559852 7:151872827-151872849 GGGCCCCAGGCACCAGGAGGAGG + Intronic
1035295429 7:157864571-157864593 CTTCCAGAGGCACCACAGGGTGG - Intronic
1035657194 8:1319151-1319173 GGGCCCCAGGCACTGCAGGGAGG - Intergenic
1035699533 8:1627382-1627404 GGTCCCTGGGCACCACGGGAGGG + Intronic
1037742140 8:21616391-21616413 GACCCCCAGGGGCCACAGGGAGG + Intergenic
1038504368 8:28071848-28071870 GATCCCCAAGAATCACAGGGAGG + Intronic
1038623455 8:29167444-29167466 GGTCCTCATTCACCACAGCGTGG + Exonic
1039838474 8:41276811-41276833 GGACCCCAGACACCTCAGGAAGG + Intronic
1043270711 8:78329733-78329755 GGGTCCCAGGGACCACAAGGAGG - Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1048888961 8:138931280-138931302 AGGCCCCAGGCACCAAAGGGTGG + Intergenic
1049250626 8:141586987-141587009 GGTTGCCAGGCACCACAGGGAGG + Intergenic
1049410070 8:142469927-142469949 TGTCCCCAGGTCCCACAGCGAGG - Intronic
1049641743 8:143719067-143719089 GGTCCTCAGGCCCCTCGGGGAGG - Exonic
1049740992 8:144240792-144240814 GGCCCTCAGCCACCACAAGGAGG - Intronic
1050545298 9:6704272-6704294 GGTCCTCGGGCGCCGCAGGGAGG + Intergenic
1052321922 9:27176850-27176872 GGTTCCCAGGGACTACAGGGTGG - Intronic
1056245398 9:84689793-84689815 GGTTGCCAGGCACTAGAGGGAGG - Intronic
1057276858 9:93680709-93680731 GGGTCCCAGGCACCACCTGGGGG - Intergenic
1057299055 9:93865914-93865936 GGTGCCCAGGCCCTCCAGGGAGG + Intergenic
1057483179 9:95461750-95461772 GGTCTCCAGAGAGCACAGGGTGG + Intronic
1057953120 9:99385801-99385823 GGTCCCCAGGGTCCCCAGGCTGG - Intergenic
1059401119 9:114071165-114071187 GGTCCACAGCCACAGCAGGGCGG - Intronic
1059421944 9:114197625-114197647 GGAGCCCTGGCACCCCAGGGAGG - Intronic
1060268413 9:122125597-122125619 GGGCCCCAGGCAGGACGGGGAGG + Intergenic
1060402007 9:123354806-123354828 GGTCCCCAGGGACCAAAGGAGGG - Intergenic
1060477316 9:123996591-123996613 CGTCCCCAGGGTCCCCAGGGGGG - Intergenic
1060868944 9:127023618-127023640 GGTCCCCTGGTAGCAGAGGGAGG - Intronic
1060976968 9:127770595-127770617 GGTCCCGGGGCACCAGAAGGGGG + Intronic
1061899783 9:133666896-133666918 GGGCCCCAGAAACCGCAGGGTGG + Intronic
1062044722 9:134419740-134419762 TTTCCCCAGGCCACACAGGGAGG + Intronic
1062115333 9:134805464-134805486 GCTCCACAGGCAACACAGAGTGG - Intronic
1062290431 9:135791946-135791968 AGGCCACAGGCACCACAGTGGGG + Intronic
1062464277 9:136674294-136674316 GGTGCCCAGGCAGGACAGTGGGG - Intronic
1062483106 9:136761674-136761696 GGTCGCCAGGCAGAACAGCGGGG + Intronic
1062688622 9:137829044-137829066 GGCATCCAGGCACCACGGGGAGG + Intronic
1186195642 X:7108379-7108401 GGTCTCCAGTGTCCACAGGGTGG - Intronic
1186459979 X:9740175-9740197 GCTCCCTTGGCAGCACAGGGTGG - Intronic
1187773672 X:22730801-22730823 GGTCTACAGGCTCCACAGGCAGG - Intergenic
1187960905 X:24565188-24565210 AGACCCCAGGCAGCACAGGCAGG - Intronic
1189794419 X:44633772-44633794 GGTTCCCTGGGACGACAGGGGGG + Intergenic
1190745070 X:53317656-53317678 GGTCCCCAGGCTCCCCCTGGTGG - Intronic
1195065426 X:101234665-101234687 ACTCCCCAGGCAGCACAGGTAGG + Intronic
1196983328 X:121239803-121239825 TGGCCCCTGGCACCACAGGTGGG + Intergenic
1197962458 X:132022250-132022272 GGTCTCTACGCACCACACGGTGG - Intergenic
1199483347 X:148322690-148322712 GGTCCACAGGCAACACATAGAGG + Intergenic
1200068344 X:153515641-153515663 TGCCCTCAGGCACCACAGGAGGG - Intergenic
1200212634 X:154353620-154353642 AGTCCCCCGGCAGCACAGGCAGG + Exonic
1202189331 Y:22224458-22224480 GGTCCACAGCCACCACAGTGGGG + Intergenic