ID: 927640471

View in Genome Browser
Species Human (GRCh38)
Location 2:24842384-24842406
Sequence GACCCTCTCCTGCCCCTCAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 292}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927640471_927640474 -8 Left 927640471 2:24842384-24842406 CCTGTGAGGGGCAGGAGAGGGTC 0: 1
1: 0
2: 2
3: 42
4: 292
Right 927640474 2:24842399-24842421 AGAGGGTCAGAGGCAAAGGTAGG 0: 1
1: 0
2: 4
3: 62
4: 619
927640471_927640475 4 Left 927640471 2:24842384-24842406 CCTGTGAGGGGCAGGAGAGGGTC 0: 1
1: 0
2: 2
3: 42
4: 292
Right 927640475 2:24842411-24842433 GCAAAGGTAGGCCCTGCTAGAGG 0: 1
1: 0
2: 0
3: 8
4: 86
927640471_927640479 24 Left 927640471 2:24842384-24842406 CCTGTGAGGGGCAGGAGAGGGTC 0: 1
1: 0
2: 2
3: 42
4: 292
Right 927640479 2:24842431-24842453 AGGCAAGTTCAGATACTTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 169
927640471_927640478 23 Left 927640471 2:24842384-24842406 CCTGTGAGGGGCAGGAGAGGGTC 0: 1
1: 0
2: 2
3: 42
4: 292
Right 927640478 2:24842430-24842452 GAGGCAAGTTCAGATACTTCTGG 0: 1
1: 0
2: 1
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927640471 Original CRISPR GACCCTCTCCTGCCCCTCAC AGG (reversed) Exonic
900315967 1:2056462-2056484 CACCGTCTCCTGCCCCACCCAGG + Exonic
900663276 1:3796634-3796656 GCCGCTCTCCAGCCCCTCCCCGG - Intergenic
900919909 1:5663465-5663487 GACCCTCTGCTGCCCTGCCCTGG + Intergenic
901037592 1:6345640-6345662 CACCCTCTCTGGGCCCTCACTGG - Intronic
902026872 1:13390413-13390435 GGCCCTCTCCTGCTCCCCAGAGG + Exonic
902287606 1:15416656-15416678 AATCCTATTCTGCCCCTCACTGG - Intronic
902364323 1:15961587-15961609 GAGCCTCTCCTAATCCTCACTGG - Intronic
902539549 1:17144164-17144186 GACACTCCCCTGCACCTCAGTGG + Intergenic
903016510 1:20365526-20365548 GACCCTCTGCTGAGCCACACTGG - Intergenic
903226048 1:21894691-21894713 AACCATCTCCAGCCCCTCCCCGG - Intronic
903655104 1:24944150-24944172 AGCTCTCTCCTGCCCCTCAACGG - Intronic
904415449 1:30358745-30358767 AACCCTCTCCTTCCCAGCACAGG + Intergenic
904789085 1:33004993-33005015 GGCCCACTCCAGCACCTCACTGG + Intergenic
905453304 1:38070903-38070925 GTCCCTCTCCTGCTCCTCATAGG - Intergenic
906805452 1:48775978-48776000 CACACTCTCCTGCCCCTCCCTGG - Intronic
907525132 1:55049632-55049654 GCCCCTTTCCAGCCTCTCACTGG + Intronic
910443122 1:87273243-87273265 GACCCGCTCCTGTTCCTCAAGGG + Intergenic
911455162 1:98113102-98113124 GACTTTCTCCTGTCCCTCACAGG + Intergenic
914852974 1:151328305-151328327 GGCCCTGTCCAGCCCCTCCCTGG - Intergenic
915463489 1:156082760-156082782 GACCCGCTCCTGCCCCGCGCCGG + Intronic
915594558 1:156888691-156888713 AACCCTCTCCGGCCCCTTCCAGG + Intergenic
915893405 1:159792169-159792191 AGTCCTCTCCTGTCCCTCACAGG + Intergenic
916392248 1:164343174-164343196 GACTCATTCCTGCCCGTCACTGG + Intergenic
922813908 1:228435567-228435589 GACCCCCTCCTGCCCCTCAATGG + Intergenic
922816437 1:228452795-228452817 GACCCTCCACTGGCCCTCAGTGG + Intergenic
1063604174 10:7508239-7508261 GGGCCTCTCCTTCCCCCCACAGG - Intergenic
1065288351 10:24206813-24206835 GACCCTCCCCTCCCCCATACGGG - Intronic
1070913521 10:80137960-80137982 GACCTGCTCCTGCCTCTCAAGGG + Intronic
1072422449 10:95300453-95300475 GATGTTCTTCTGCCCCTCACTGG - Intergenic
1072503843 10:96044287-96044309 GACCCTCTGCGCCCCCTCCCCGG - Intronic
1072671506 10:97433219-97433241 GAAGCACTCCTGCCCCTCAGAGG - Exonic
1074855786 10:117472491-117472513 AACCATCTCTTGCTCCTCACGGG + Intergenic
1075933793 10:126322596-126322618 GCCTCTCTCCTGTCCCTCACCGG - Intronic
1076818588 10:132926881-132926903 GACCCTCCCGTGCCGCTCTCAGG - Intronic
1077308011 11:1876512-1876534 GACCCTCTCCAGCCGCCCTCTGG + Intronic
1077481184 11:2815432-2815454 GACCCTCTCCTGGCCCTGTGGGG + Intronic
1077530580 11:3092935-3092957 GAGGCTCTCCTGCCGCTCACGGG + Exonic
1079115914 11:17640626-17640648 GCCCCCCTCCTGCCCACCACAGG + Intronic
1079612986 11:22456184-22456206 CCCCCTTTCCTGTCCCTCACAGG - Intergenic
1080426074 11:32155395-32155417 AGCCCTCTCCTGCCTCTTACAGG + Intergenic
1081799504 11:45848016-45848038 GCCCCTGTTCTGCCACTCACTGG - Intronic
1081905927 11:46670026-46670048 GGCACTCTTCTGCCCCTCAGAGG - Intronic
1083332700 11:61906338-61906360 GAGCCTGTCCTGCGCCTCTCTGG - Intronic
1083659892 11:64247019-64247041 GACCCTCCCCTACCCCTGCCCGG - Intergenic
1083821568 11:65174325-65174347 GAAGCACTCCTGCCCCTCAGAGG + Intergenic
1083922739 11:65789268-65789290 GGCCCTCTCCTGCACCTGACAGG - Intronic
1084970048 11:72766493-72766515 TGCCCTTTCCTGCCCCTCAGTGG - Intronic
1087192454 11:95269263-95269285 GACCCTGTCCTCTCCATCACTGG + Intergenic
1088810334 11:113387716-113387738 GAGCCGCTCCTGCCCCGCAAAGG - Intergenic
1088813450 11:113406560-113406582 TTCCCTCTCCTGCGCCTCTCTGG + Intergenic
1089124479 11:116167152-116167174 GACCCTGTCCTGACCCACCCAGG + Intergenic
1090080463 11:123609063-123609085 TACCCTGTCCCTCCCCTCACAGG + Intronic
1090334683 11:125954556-125954578 GACTCTTTCCTGTCCCTCCCTGG + Intergenic
1090986380 11:131770031-131770053 GGCCCTCTTCTCCCTCTCACTGG - Intronic
1091450837 12:571074-571096 GCCCCTCCCCTGCCACTCAAGGG + Intronic
1091610539 12:2004181-2004203 CAACGTCTCCTCCCCCTCACCGG + Intronic
1092916751 12:13196379-13196401 GCCCCTTTCCTCCCCCTCCCAGG + Intergenic
1094063500 12:26340092-26340114 GACCCTCTGTCTCCCCTCACCGG + Intronic
1096087462 12:48875275-48875297 AACCCTCCCCTGCCCATCCCTGG + Intergenic
1096782096 12:53997440-53997462 GCTCCTCTCCTGCCCCTCCCAGG - Intronic
1098305609 12:69099580-69099602 GAGCCTCTCATGCCTCTCAAAGG - Intergenic
1098322482 12:69260022-69260044 AACCCTTTCCTTTCCCTCACAGG + Exonic
1100336881 12:93640101-93640123 GAAGCACTCCTGCCCCTCAGAGG + Intergenic
1101361580 12:104032242-104032264 GAAGCACTCCTGCCCCTCAGAGG - Intronic
1101666659 12:106822936-106822958 GACCATCTTCTGCTCCTCAAGGG - Intronic
1102962049 12:117099313-117099335 GTCCCTCTCAGGCCCCGCACTGG + Exonic
1103562053 12:121797978-121798000 GACCCAGCCCTGGCCCTCACAGG + Intronic
1104777707 12:131400982-131401004 CATCCTCTTCTGCCCCTCACAGG + Intergenic
1105388872 13:19958185-19958207 GACCCGCTCCAGCGCCTCCCCGG + Intergenic
1105879538 13:24592050-24592072 GTCTGTCTCCTGCCCCTCCCTGG + Intergenic
1107710483 13:43145997-43146019 GATCCTCTTCTGCCCCTCCCAGG + Intergenic
1112703099 13:102034726-102034748 GTCCTGGTCCTGCCCCTCACAGG + Intronic
1113074598 13:106455328-106455350 GACCTCCTCCTGCCCCACAGGGG - Intergenic
1113331870 13:109335154-109335176 GACACTCTCCTTTCCATCACAGG + Intergenic
1113613118 13:111661939-111661961 GCCCGTCTCCTGCCTCCCACAGG + Intronic
1114075048 14:19157358-19157380 GTCCCTCACCTTCCCCTCATTGG - Intergenic
1114087221 14:19242618-19242640 GTCCCTCACCTTCCCCTCATTGG + Intergenic
1115051322 14:29067185-29067207 TACCATCTTCTGTCCCTCACTGG + Intergenic
1119179256 14:72593922-72593944 GACCCTCAGTTTCCCCTCACAGG - Intergenic
1119494772 14:75069417-75069439 AAGCCTCTCCCGCCCCTCCCCGG + Exonic
1119878580 14:78081295-78081317 GACCCTCTCTTCCCACTCCCAGG - Intergenic
1121326106 14:93020453-93020475 CACCCTTCCCTGCACCTCACAGG + Intronic
1121441847 14:93954483-93954505 GACCCACTCCTTCCTCTCACAGG - Exonic
1122269099 14:100560433-100560455 GTGCCTCTTCTGGCCCTCACCGG + Intronic
1122865719 14:104603210-104603232 GCCCCTCTTCTTCCCCTCTCTGG + Intronic
1123012311 14:105355431-105355453 GAGCCTGTCCTGCCCTTCAGTGG + Intronic
1124646018 15:31437960-31437982 GAGCCTCCTCTGCCCCTCATGGG - Intergenic
1125271803 15:37947375-37947397 GGCCCCATCCTGCCCCTAACTGG + Intronic
1126115238 15:45201966-45201988 GAGCCTCTCCAGCTCCTCTCAGG + Intergenic
1128224559 15:65993007-65993029 GCTCCTCTCCTGCCTCTCATGGG - Intronic
1128306745 15:66603858-66603880 GAGTCTCTCCTGCCCCTCCTGGG - Intronic
1129230438 15:74194186-74194208 GATTCCCTCCTGCCCCCCACTGG + Intronic
1129350946 15:74955800-74955822 GATCCTCTCCTGCCACTCCTGGG + Exonic
1129948417 15:79562440-79562462 TGGCCACTCCTGCCCCTCACTGG + Intergenic
1131312855 15:91306524-91306546 GATCAGCTCCTGCCCCTCATTGG - Intergenic
1131841302 15:96440823-96440845 GAAGCACTCCTGCCCCTCAGAGG + Intergenic
1132215991 15:100061984-100062006 CTCCCTCTCCTGCCCATCAAAGG - Intronic
1132547721 16:540943-540965 CACCCCGTCCTGGCCCTCACTGG + Intronic
1132985689 16:2766128-2766150 GAGCCTCTCCAGCCACTCACCGG + Exonic
1133229580 16:4360167-4360189 AAACCATTCCTGCCCCTCACTGG - Intronic
1134070220 16:11255942-11255964 GACCCTCGCCGGCCCCACCCAGG - Intronic
1135047040 16:19164498-19164520 AAGCCTCTCCTGCCTTTCACGGG - Intronic
1135303659 16:21351015-21351037 AACCTTCCCCTGCCCCTCAAAGG - Intergenic
1136074282 16:27806221-27806243 CACCATCTCCTGTCCCTCACAGG + Intronic
1136300404 16:29330210-29330232 AACCTTCCCCTGCCCCTCAAAGG - Intergenic
1136574141 16:31113278-31113300 TACCATCTCCTACCCTTCACGGG + Intergenic
1137753245 16:50881997-50882019 TGACCTCTTCTGCCCCTCACTGG + Intergenic
1138200450 16:55084415-55084437 TCACCTCTCCTGCCCCTGACTGG + Intergenic
1138478423 16:57285227-57285249 GACCCTCCCCTTCCCCGCGCTGG - Intergenic
1139314316 16:66055627-66055649 GACCCTCCCCTGCCTCTCCCCGG + Intergenic
1139422356 16:66856535-66856557 GACCCTGTCCAGCCCCTCCCAGG + Intronic
1139602112 16:67993257-67993279 GCCCCTCGCCCGCCCCTCTCAGG - Exonic
1139956796 16:70697084-70697106 GGCCCCTTCCTGCCCCTCAGAGG + Intronic
1141622390 16:85243354-85243376 GCCCGTGTCCTTCCCCTCACAGG - Intergenic
1141624640 16:85254783-85254805 GGCCAGCTCCTGCCCCTGACTGG - Intergenic
1142062129 16:88036976-88036998 AACCTTCCCCTGCCCCTCAAAGG - Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1142747560 17:1967489-1967511 CTCACTCTCCTGCCCTTCACAGG + Intronic
1143088262 17:4433226-4433248 GACACCCTCCTGCCTCTCACAGG + Intergenic
1143343353 17:6231604-6231626 GCACCCCTCCTGCCCCACACAGG - Intergenic
1143719716 17:8801110-8801132 GCCCTACTCCTGCCCCTCCCTGG + Intergenic
1145956834 17:28860555-28860577 CACCCTCTACTGACCCTCCCAGG + Exonic
1145974840 17:28978001-28978023 GACCCTCTCCTACCCCTGTTGGG - Intronic
1147188644 17:38726226-38726248 TGCCCTCTCCTCCCCATCACGGG - Exonic
1148127366 17:45243769-45243791 TCCCCTCTCCTCCCTCTCACAGG + Exonic
1148475876 17:47928217-47928239 CCCCCTCTCCTGCACCTCCCTGG + Exonic
1150226413 17:63527039-63527061 CACCCACGCCTGCCCCGCACTGG + Intronic
1151042329 17:70876815-70876837 GTCCCTTTCCTACCCATCACTGG - Intergenic
1152216383 17:79035054-79035076 GCCCGCCTCCTGCCCATCACCGG + Intronic
1152244034 17:79176026-79176048 GACCCTGTCCTGCCCTTCCTGGG - Intronic
1152755323 17:82084766-82084788 GACACTGCCCTGCCCCTCCCGGG - Intronic
1152845457 17:82597010-82597032 CACCAGCCCCTGCCCCTCACCGG - Intronic
1152944618 17:83192167-83192189 GACCCCAGCCTGCCCCACACTGG + Intergenic
1153568878 18:6448186-6448208 GCCCTTCTCCCGCCCCTCTCAGG + Intergenic
1153988265 18:10372544-10372566 GACCCTCCCCTAACGCTCACTGG + Intergenic
1154147010 18:11874857-11874879 CGCCCTCCCCTGCCCATCACTGG + Intronic
1154940765 18:21111256-21111278 TACCCGCTCCTGCCCATCTCGGG - Exonic
1156370003 18:36464752-36464774 AACCCTCTCCTCCTCCTCCCAGG - Intronic
1156596831 18:38557211-38557233 AACCCTTTCCTGCCCCTTCCAGG + Intergenic
1157114826 18:44852791-44852813 CAGCTTCTCCTTCCCCTCACTGG + Intronic
1157521047 18:48345690-48345712 GACCCTCTCCAGCCTCCCAGAGG - Intronic
1158118855 18:54026164-54026186 GCCCCTTTCCTCCCCCACACAGG - Intergenic
1158237757 18:55338297-55338319 GACTCTCTCCTGGCCCTCCTTGG + Intronic
1158564998 18:58547355-58547377 GTCTCTTTCCTGCCCCTCTCTGG - Intronic
1159991512 18:74914224-74914246 GAACCTCTCCTGGCCCTCACAGG - Intronic
1160445628 18:78925066-78925088 GGCCTTTTCATGCCCCTCACTGG + Intergenic
1160665255 19:325148-325170 GACCCTCTCTTGCCCCTTTGAGG - Intronic
1160786133 19:900905-900927 AACCCGCTCCTGCTCCTCCCCGG + Exonic
1162029067 19:7909646-7909668 GACCCTCACCTTCCCCTCCTGGG - Intronic
1162374143 19:10295226-10295248 GATCCTCTTCTGCCCATCAGAGG + Intronic
1162804304 19:13129064-13129086 GTCCCTCTCCTGCCCCACCCCGG - Intronic
1163296091 19:16413764-16413786 GACCCTTACCTGCACCTCGCTGG + Exonic
1163439542 19:17314718-17314740 GTCCCTCATCTGCCACTCACTGG + Intronic
1163517401 19:17773489-17773511 GCCCCACTCTTGCCCTTCACAGG + Intronic
1165306234 19:35004708-35004730 GACGCTCTGCTGACCCTGACAGG - Intronic
1167288875 19:48613938-48613960 GACCCTCTCCTTCCACTGTCTGG + Intronic
1167358341 19:49017215-49017237 GAGCCACTCCTGCGCCTCCCTGG - Intergenic
1167387679 19:49173632-49173654 GACCCTCCCCAGCCTCTCCCAGG - Intronic
1167425418 19:49427611-49427633 GTCCGGCTCCTGCCCCTCACCGG - Exonic
1168287102 19:55340463-55340485 GTCCCTCTCCTGGCACTCCCTGG + Intronic
925688435 2:6495772-6495794 GAGCCTGACCTGCACCTCACGGG - Intergenic
926158207 2:10469674-10469696 AGCCCTTTCCTTCCCCTCACTGG - Intergenic
926765826 2:16322104-16322126 TATCCTCTGCTGCCCCTCACTGG + Intergenic
926958027 2:18323153-18323175 GCCCCTCTGCAGCCCCTAACTGG + Intronic
927502661 2:23592786-23592808 GACCATCTCCTGGCCCCCAAAGG + Intronic
927640471 2:24842384-24842406 GACCCTCTCCTGCCCCTCACAGG - Exonic
929178568 2:39008052-39008074 GTCCTGCTCCTGCACCTCACCGG - Intronic
929460623 2:42100353-42100375 GACACCCTCCTGCCCTTCTCTGG - Intergenic
932593209 2:73079533-73079555 GACCCTCACCTGCCCCACAAAGG + Intronic
933765631 2:85706748-85706770 TGCCCTCTCCTGCCACTCATGGG + Intergenic
933991359 2:87636290-87636312 CACCCTCTCCCTGCCCTCACCGG - Intergenic
934942286 2:98511462-98511484 GACCCTCTCCTGCCCTGTGCAGG + Intronic
935187602 2:100748138-100748160 CACCCTCTCCTCCCCCTGCCTGG - Intergenic
936302483 2:111314532-111314554 CACCCTCTCCCTGCCCTCACCGG + Intergenic
936484397 2:112914043-112914065 GAGCATCACCTGCCCCTCCCCGG - Intronic
937095700 2:119233997-119234019 GGCCCTCCCCTGCCCCTCAGTGG - Intronic
937273644 2:120670918-120670940 GGCCCTCTCCTTCCCCAGACAGG + Intergenic
938219873 2:129556891-129556913 GACCCTGCCCTGTCCCTCACAGG + Intergenic
938247730 2:129792057-129792079 GCCTCACTCCTGCCCCTCGCTGG + Intergenic
938266051 2:129929076-129929098 GACCTGCTCCTGCCTCTCAAGGG - Intergenic
938406898 2:131037725-131037747 GACGCTCCCCTGCCTCTCCCAGG - Intronic
940369634 2:152886495-152886517 GACACTCTCCTCCTCCTTACTGG + Intergenic
942448215 2:176092500-176092522 ACCCCTCTCCTGCCCCTTGCAGG - Intergenic
945222109 2:207495005-207495027 GACCCCCCACTGGCCCTCACTGG - Intergenic
946469019 2:219939454-219939476 GAGGCTGTCCTGCCCATCACAGG + Intergenic
948135789 2:235635200-235635222 GACCCACTGCTGCCACACACAGG - Intronic
948294512 2:236850606-236850628 GACCCTCACTAGCACCTCACTGG + Intergenic
948307807 2:236962690-236962712 GACCATCTCCTGCTCCTCCTAGG - Intergenic
948370965 2:237488758-237488780 CACCACCTCCAGCCCCTCACTGG - Intronic
1169379606 20:5095317-5095339 AAACCTATCCTGCCTCTCACTGG + Intronic
1170958593 20:21004126-21004148 CACCATCTCCTGTCCTTCACTGG + Intergenic
1172067654 20:32233142-32233164 CATCATCTCCTGCCCCTGACTGG - Intronic
1173551891 20:43938240-43938262 GCCCTTCTCCTGGCCATCACTGG - Intronic
1173580743 20:44144918-44144940 GACCCTCTCCTAGGCCCCACGGG + Intronic
1173751429 20:45479848-45479870 GCCCCCCCACTGCCCCTCACTGG - Intronic
1173852416 20:46227488-46227510 GGCCCCGCCCTGCCCCTCACCGG + Exonic
1174578585 20:51555070-51555092 GCAGCTCTCCTGCCCCACACTGG + Intronic
1176057060 20:63154563-63154585 CACCCCCACCTGCCTCTCACTGG - Intergenic
1176411352 21:6451064-6451086 GCCCCTCTCCTGGACCTCACTGG + Intergenic
1179381974 21:40908298-40908320 CTCCCTCCCCTGCCTCTCACTGG + Intergenic
1179418400 21:41216567-41216589 GACCCGGTCCTGCCTCTCAGGGG - Intronic
1179686845 21:43059386-43059408 GCCCCTCTCCTGGACCTCACTGG + Intronic
1179722368 21:43322961-43322983 GACACACTCCTGTCCCTCACTGG - Intergenic
1179801481 21:43813375-43813397 GCCCCTCCCCTGCCCCTGCCTGG - Intergenic
1180028651 21:45185260-45185282 GTCCTGCTGCTGCCCCTCACGGG - Intronic
1180290696 22:10850273-10850295 GTCCCTCACCTTCCCCTCATTGG - Intergenic
1180353794 22:11823397-11823419 GTGCCTCACCTTCCCCTCACTGG + Intergenic
1180384451 22:12168962-12168984 GTGCCTCACCTTCCCCTCACTGG - Intergenic
1180493497 22:15879694-15879716 GTCCCTCACCTTCCCCTCATTGG - Intergenic
1180955845 22:19740861-19740883 GAACCAATCCTGCCCCTCCCTGG + Intergenic
1181234881 22:21442855-21442877 CCCCCTCCCCTGCGCCTCACCGG - Exonic
1181939417 22:26463881-26463903 GACCTTCTCCTGCCCCTCTGCGG - Intronic
1182347345 22:29675593-29675615 GAGCCTCTCCTGCTCCTCCAGGG - Intronic
1183379327 22:37483099-37483121 GACCTGCTCCTCCCTCTCACTGG + Intronic
1184162251 22:42703938-42703960 GACCCACCTCTGCCCCTCCCTGG + Intronic
1184858535 22:47160317-47160339 GGCCCTCCCTTGCCGCTCACTGG + Intronic
1184987683 22:48146530-48146552 GTGCCTCTCCTCCCCCTCACTGG - Intergenic
1185196455 22:49473500-49473522 GAGCAGCTCCTGCCCTTCACTGG + Intronic
1185331058 22:50252218-50252240 TGCCCTGCCCTGCCCCTCACTGG + Intronic
949935013 3:9109846-9109868 CTCCCTCTCCTGCTCCTCCCTGG - Intronic
950321262 3:12056273-12056295 GACCCCCTCCTTCCCCGCAAAGG - Intronic
950441925 3:13015504-13015526 GACAGTCGCCAGCCCCTCACAGG + Intronic
951989598 3:28662037-28662059 GACCCTCTTCTGCCCCTGTCTGG - Intergenic
952516234 3:34106969-34106991 CACCCTCTTCTGCCCCCTACTGG - Intergenic
953850664 3:46463708-46463730 CTTCCTCTCCTGCCCCTCCCAGG + Intronic
954459258 3:50617192-50617214 CCGCCTCTCCTGCCCCTCGCCGG + Intronic
956588110 3:70885217-70885239 CACCCTCACCTGCCTGTCACTGG - Intergenic
961318882 3:126058819-126058841 GAACTTCTCATGACCCTCACGGG + Intronic
961698709 3:128725306-128725328 GCCCCTCTCCTGCCCTGCTCAGG + Intergenic
961815316 3:129547304-129547326 GACCCTCACCCACCCCCCACGGG + Intronic
962736518 3:138329953-138329975 GACTCCCTCCTGCCTCTCCCTGG - Intergenic
965637870 3:170802528-170802550 TTCCTTCTCCTGCCCCTAACTGG + Intronic
968596696 4:1489636-1489658 CACCCTCTCCTGCCCCTGCCAGG + Intergenic
968735954 4:2296701-2296723 GGGCCTCCCCTCCCCCTCACTGG - Intronic
969102019 4:4776498-4776520 GAGCCTCTCCTGCATGTCACAGG + Intergenic
969608872 4:8216171-8216193 GGCCGTCTCCTCCTCCTCACTGG - Exonic
969615525 4:8250514-8250536 CACCCTCACATGACCCTCACAGG - Intergenic
969676389 4:8616615-8616637 TACCCTCACCAGCCCCTCACCGG - Intronic
969721607 4:8895397-8895419 GCCCCTCCCCTGCCCCACACTGG - Intergenic
973374383 4:49277254-49277276 GTGCCTCACCTTCCCCTCACTGG - Intergenic
973383028 4:49332987-49333009 GTGCCTCACCTTCCCCTCACTGG + Intergenic
973386649 4:49518030-49518052 GTGCCTCACCTTCCCCTCACTGG + Intergenic
975118475 4:70704872-70704894 GACCCTCTGCTCCCCCGCCCAGG + Intronic
975723083 4:77267047-77267069 TGCTCACTCCTGCCCCTCACTGG + Intronic
976314392 4:83643725-83643747 CACCAACTCCTGTCCCTCACTGG + Intergenic
978061441 4:104344890-104344912 GACCCTCCCCTTCCCCACCCAGG - Intergenic
985563100 5:601847-601869 GGCCATCACCTGCCCCTCACTGG - Intergenic
985628178 5:1000929-1000951 GACCCACTCCTTCCCCTGCCCGG - Intergenic
985716785 5:1467436-1467458 GGCTCTCTCCTGAGCCTCACAGG + Intronic
985789714 5:1918983-1919005 GACTCCTTCCTGCCCCTCCCAGG + Intergenic
985800823 5:2004591-2004613 GCCACTTTCCTGCCCCACACAGG - Intergenic
985800835 5:2004631-2004653 GCCCCTTTCCTGCCCCACACAGG - Intergenic
985801009 5:2005286-2005308 GCCCCTTTCCTGCCCCACACAGG - Intergenic
985801032 5:2005366-2005388 GCCCCTTTCCTGCCCCACACAGG - Intergenic
985801042 5:2005406-2005428 GCCCCTTTCCTGCCCCACACAGG - Intergenic
986305250 5:6509503-6509525 ACCCCTCTCCTGCTCCTCCCCGG + Intergenic
986365772 5:7029085-7029107 TACCCTCTCCACCCCCTGACAGG - Intergenic
986514264 5:8544087-8544109 GCCCCTCTTCTCTCCCTCACTGG - Intergenic
995523434 5:113031832-113031854 GACTCTCTCCTGCCCTTCTGGGG - Intronic
997042888 5:130278316-130278338 GAAGCTCTCCTGCCCCCAACAGG - Intergenic
997526293 5:134555252-134555274 GGGCCTGTCCTGCCCCTCACTGG + Intronic
997650033 5:135510189-135510211 CGCCCTCTCCTCCACCTCACTGG + Intergenic
998139918 5:139693949-139693971 GGCCCTCTCCTGCCCTGCAGTGG + Intergenic
998140423 5:139696914-139696936 CACCCTCCCCTGCCCACCACAGG - Intergenic
1001087413 5:168710853-168710875 CACCCTCCCCTGCCCCTCTTGGG - Intronic
1002904287 6:1436407-1436429 GGACCTCTCCTTCCCCTCTCGGG - Intergenic
1003565316 6:7217152-7217174 CACCCTCCCCTGCCCATCTCGGG - Intronic
1003995925 6:11538599-11538621 CCCCCGCTCCTGCCCCGCACGGG + Intronic
1004460400 6:15829787-15829809 GGCCCTCTCCAGCCCCCCACAGG - Intergenic
1006437582 6:34034201-34034223 CCCCTTCTCCTGCCCCTCCCAGG + Intronic
1007114725 6:39335585-39335607 CACCCTCCGCTGCCCCTCCCTGG + Exonic
1007309667 6:40935301-40935323 CACCAACTCCTGTCCCTCACTGG + Intergenic
1007416300 6:41693485-41693507 GACCCTCTCCTCCCCAGCATGGG - Intronic
1008052855 6:46917665-46917687 AACCCTCACCCGCCCCCCACAGG + Intronic
1010178479 6:73056542-73056564 GAAGCACTCCTGCCCCTCAAAGG - Intronic
1010365892 6:75050659-75050681 AAAGCCCTCCTGCCCCTCACAGG + Intergenic
1010536244 6:77035330-77035352 GACCCTCTTCTACCCCACCCTGG + Intergenic
1013559688 6:111291876-111291898 GCCCCTCTGCTACCTCTCACTGG + Intergenic
1015538872 6:134295110-134295132 GACATTCTCCTGCCCCCCAAGGG + Intronic
1015767779 6:136737441-136737463 GACCCTCACCAGCCCCACAATGG + Intronic
1016988099 6:149910097-149910119 GACCCTCCCCTCCCCCACCCTGG + Intergenic
1017058938 6:150462979-150463001 GAACCTCTCCTGCCTCTGGCAGG + Intergenic
1018101094 6:160441169-160441191 GACCATCTCCTGCCACTCCCGGG - Intronic
1018640058 6:165897444-165897466 GACCCTCTCATTCTCCTCCCTGG - Intronic
1018720286 6:166566784-166566806 GCCCCACTCCTGCACCTGACAGG + Intronic
1018812188 6:167306328-167306350 GACCCTGCCCTGCCCCACCCTGG - Intronic
1022949535 7:35322689-35322711 TTCCCACTCCTGCCCTTCACAGG + Intergenic
1025255552 7:57381904-57381926 GGCCCTTACCTGCCCCTCCCAGG - Intergenic
1029190027 7:98765226-98765248 CACAGTCTCCTGTCCCTCACCGG - Intergenic
1029436870 7:100568534-100568556 GAGCCTCTCCTGCACCCCAGTGG + Intergenic
1029546450 7:101212805-101212827 TGCCCTCTCGTGCCCCTCCCTGG + Intronic
1029595168 7:101533816-101533838 GCATCTCTCCTGCTCCTCACTGG + Intronic
1030087973 7:105833201-105833223 TAGACTCTCCTGACCCTCACTGG + Intronic
1032088104 7:128894100-128894122 CACCCTCTCCTGGCCTTCATGGG + Intronic
1032094798 7:128932636-128932658 GTCCCTCTCTGGCCCCTGACGGG - Intergenic
1032096006 7:128938833-128938855 TACCCGCTCCCGCCCCTCCCGGG - Intronic
1034217521 7:149420026-149420048 CCCCCTCTGCTGCCCCACACTGG - Intergenic
1034425312 7:151010856-151010878 GCCCCTCTCTGGCCCCTCACCGG + Intronic
1037310492 8:17550491-17550513 GACCCTCTGCTACCACACACGGG - Intronic
1039266296 8:35827632-35827654 GACTCTCTGCTGCCCCTTCCTGG + Intergenic
1039471821 8:37818212-37818234 GCCCCTGCCCTGCCCCTCTCAGG + Intronic
1041383336 8:57275066-57275088 GGCCATCTCCTGCCTCTCAGAGG + Intergenic
1041545783 8:59040832-59040854 GACCCTCCCACTCCCCTCACTGG + Intronic
1044729615 8:95219466-95219488 GGCCCTCTCCTCCTTCTCACTGG + Intergenic
1047014287 8:120706727-120706749 GTCTCTCTCTTGCCCCTTACAGG + Intronic
1047019507 8:120759851-120759873 GATCCTCTCCAGCCCTTGACAGG + Intronic
1048581145 8:135730800-135730822 GATCCTATCCTGCCCCTGATTGG + Intergenic
1049357255 8:142195044-142195066 CCCCCTCTCCTTCCCCACACTGG - Intergenic
1049379415 8:142304595-142304617 GACCCTCCCCAGGCCCACACAGG - Intronic
1049981254 9:905670-905692 CACCCTCCTCTTCCCCTCACGGG - Intronic
1051593205 9:18797139-18797161 GCCCCTCTCCTCCCCTTCCCTGG - Intronic
1056831996 9:89924764-89924786 TCCCCTCTCCTGCCACCCACTGG + Intergenic
1057904101 9:98971265-98971287 GCCCCTCACGTGCCCCTGACAGG + Intronic
1058047662 9:100373917-100373939 CTCCCTCTCCTGCCTCCCACTGG + Intergenic
1059061371 9:111038188-111038210 GTCCCTCTCCTGCCGCCCCCGGG + Intronic
1060189220 9:121581714-121581736 CAGCCTCTCCTGCCTCTCCCTGG - Intronic
1060206815 9:121687042-121687064 TACCCTCTGCTGCCCCCAACTGG - Intronic
1060932277 9:127496744-127496766 GAGACTCTCCTGCCCCTCCCTGG + Intronic
1061412118 9:130427479-130427501 GACCCCTTCCTGCCCCAGACAGG + Exonic
1061617991 9:131792717-131792739 CACCCTCTCCTTTCCCTCAAGGG - Intergenic
1061627823 9:131851922-131851944 TGCCCTCTCCTGCCCTTCCCAGG + Intergenic
1061746482 9:132743977-132743999 GTCCCTCTCCTGATCCTCACTGG - Intronic
1062359370 9:136180315-136180337 GACCCTCTGCACCCCCTCCCTGG + Intergenic
1062479498 9:136744796-136744818 GACCCTTCCCAGCCCCTCCCCGG - Intronic
1062612938 9:137383128-137383150 GACCGCCCCCTGCCCCACACAGG + Intronic
1062724855 9:138066209-138066231 TGCACTCTCTTGCCCCTCACTGG - Intronic
1203698050 Un_GL000214v1:115162-115184 GTGCCTCACCTTCCCCTCACTGG - Intergenic
1203551154 Un_KI270743v1:165819-165841 GTGCCTCACCTTCCCCTCACTGG + Intergenic
1186463387 X:9765775-9765797 GACCTTCTGCTGCCCCACGCGGG - Exonic
1187717848 X:22121263-22121285 GACCCCCTCATTCTCCTCACTGG - Intronic
1189134311 X:38533038-38533060 GACCCACTACTGCTCCTCCCTGG + Intronic
1189379108 X:40489126-40489148 CACCAACTCCTGCCCCTCAGTGG - Intergenic
1193135605 X:77968160-77968182 GAAGCACTCCTGCCCCTCAGAGG + Intronic
1194530619 X:95044529-95044551 AACCCTCCCCTACTCCTCACAGG + Intergenic
1195614799 X:106903618-106903640 GCTCCTCTCCTTCCCCTCTCAGG - Intronic
1198667475 X:139040489-139040511 GATCTTCTCCTACCCCTCCCAGG - Intronic
1199298612 X:146187004-146187026 AAACCACTCCTGACCCTCACAGG - Intergenic