ID: 927641561

View in Genome Browser
Species Human (GRCh38)
Location 2:24848886-24848908
Sequence TGAGCTCTGCTTACTGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927641552_927641561 20 Left 927641552 2:24848843-24848865 CCAGGGTCAGCACAAACCCTCTG 0: 1
1: 0
2: 1
3: 20
4: 188
Right 927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 210
927641557_927641561 3 Left 927641557 2:24848860-24848882 CCTCTGGGTCACTCAGCCTGGTC 0: 1
1: 0
2: 2
3: 21
4: 281
Right 927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 210
927641556_927641561 4 Left 927641556 2:24848859-24848881 CCCTCTGGGTCACTCAGCCTGGT 0: 1
1: 0
2: 1
3: 15
4: 253
Right 927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927641561 Original CRISPR TGAGCTCTGCTTACTGCAGG TGG Intronic
901315305 1:8303374-8303396 AGAGCTCTGATTCCTGCATGTGG - Intergenic
902220317 1:14960482-14960504 TGAGCTCTGCAGACTGTGGGTGG + Intronic
903474310 1:23608914-23608936 TGAACTCTGCGTACTACACGAGG + Intronic
903545672 1:24121977-24121999 TGGGCTCTGGTTTCTCCAGGAGG + Intronic
904171409 1:28594077-28594099 TGAGTGCTGCTTCCTGCTGGGGG - Exonic
904795873 1:33055991-33056013 TGGTCTCTGCTTACGGTAGGTGG + Intronic
907163268 1:52387199-52387221 TGAGCTCTGCCTTCTGCTAGAGG + Intronic
907323244 1:53618865-53618887 TGGGCTCTGCTTCCTGCCTGGGG - Intronic
907675021 1:56510179-56510201 TGAGCTTTGCTCTCAGCAGGAGG - Intronic
907988416 1:59555492-59555514 TGTGATGTGCTTACTGCATGTGG - Intronic
908813965 1:68012637-68012659 AGAGCTGTGCCTGCTGCAGGTGG - Intergenic
909137782 1:71822909-71822931 TCAGCTATGCTTTCAGCAGGCGG - Intronic
911012536 1:93296697-93296719 TGAGCTGTGCTAACTGGAGTTGG + Intergenic
911841455 1:102687170-102687192 GGATCTCTGCTAACTCCAGGAGG + Intergenic
919930346 1:202217202-202217224 TGACCTCTTCTTACTGAAAGGGG - Intronic
921160441 1:212468538-212468560 CGATCTCGGCTCACTGCAGGAGG + Intergenic
922033434 1:221825900-221825922 TTAGCTCTGCTGTCTGCAGATGG - Intergenic
922152280 1:223016782-223016804 AAAGCTCTGCTTACTACACGAGG - Intergenic
923196459 1:231673030-231673052 TGACCTCTGGTGAGTGCAGGGGG + Intronic
923923668 1:238598844-238598866 TGAACTCTGCTTCCTGCACAGGG - Intergenic
924013293 1:239691098-239691120 TGAGCTCTTCCTGCTGCTGGGGG + Intronic
924679698 1:246219665-246219687 TTAGCTCTGCTCTCTGCAGACGG - Intronic
1062807703 10:436731-436753 TGAGCTCTGCTTCCTGGACATGG + Intronic
1064501247 10:15976054-15976076 TGAGCTGTGCTTCATGCAGTGGG - Intergenic
1067662786 10:48249127-48249149 TCAGCCCTGCTTTCTGCAGCTGG - Exonic
1067789769 10:49278865-49278887 TCAGCTTTGCTTGCAGCAGGAGG + Intergenic
1069875928 10:71562790-71562812 TCTGCTCCGCTCACTGCAGGTGG + Intronic
1071195456 10:83153800-83153822 TCAGCTTTGCTATCTGCAGGCGG - Intergenic
1075936913 10:126350819-126350841 TGAGCTCTGCCCACTGCCAGAGG - Intronic
1077698490 11:4417789-4417811 TGATCTCTGCTTACTGCTTATGG - Intergenic
1077841921 11:5984642-5984664 TGAGCTGTTTTTATTGCAGGAGG - Intergenic
1078907151 11:15698065-15698087 TGAGATCTGATTACTTCATGTGG + Intergenic
1081457810 11:43242655-43242677 TGAACTCTGCTTAGTTCAGCTGG - Intergenic
1081554047 11:44141087-44141109 TGAGTTCTGGTATCTGCAGGAGG - Intronic
1083149818 11:60784901-60784923 TGAGTTTTGCTTACTTCTGGGGG + Intergenic
1083408979 11:62478684-62478706 TGATCACGGCTCACTGCAGGAGG - Intronic
1083682234 11:64356997-64357019 TGAGATCTGCTTCCCTCAGGAGG - Intronic
1084667341 11:70583501-70583523 TGAGCTCTGATTCTTGCAAGGGG + Intronic
1086538798 11:87883103-87883125 TTTTCTCTGGTTACTGCAGGAGG + Intergenic
1087159823 11:94937822-94937844 TGAGTTGTGCTTCCTGCAGTAGG + Intergenic
1087264618 11:96046610-96046632 TGAACTCTGCTTACATCAGAAGG + Intronic
1087299242 11:96413320-96413342 TGAGCTCTACTTCCTGGAGTTGG - Intronic
1088375233 11:109133552-109133574 TGAGCACTGCTTCCTCCAGAGGG - Intergenic
1089073910 11:115721742-115721764 GGAGCTCTGCTTCCTGCTGGTGG - Intergenic
1090498067 11:127234160-127234182 TGAGCCCTGCTTCCTGCAATGGG + Intergenic
1091255163 11:134177434-134177456 TAAGCTGTGCTTACAGCACGAGG - Exonic
1091853595 12:3720937-3720959 TGAGTTCTGCATCCTGCATGGGG - Intronic
1092049060 12:5455095-5455117 GGGGCTGTGCTCACTGCAGGAGG - Intronic
1093749214 12:22779394-22779416 TTAGCTCTGCTGTCTGCAGACGG + Intergenic
1094736092 12:33235555-33235577 TGAGCTGTGTTTACTCCAGGGGG + Intergenic
1097545725 12:60998874-60998896 AAAGCTCTGATAACTGCAGGAGG + Intergenic
1099499615 12:83397448-83397470 TGAGTTTTGCTGACTGCATGGGG + Intergenic
1099852045 12:88112235-88112257 TGAGCTCTGCTCCCTACATGGGG + Intronic
1100686835 12:96995656-96995678 TGAGCTCTGTTTGCTGAAAGAGG + Intergenic
1101295232 12:103416360-103416382 TGAGCTCTGCCCAGTGCAGTGGG - Intronic
1101539743 12:105654072-105654094 TTAGCTCTCCTTTCAGCAGGTGG - Intergenic
1101875834 12:108596600-108596622 GAGGCTCTGCTGACTGCAGGTGG - Intronic
1103871339 12:124094540-124094562 TGAGGACTGCTTGCTGCAGAGGG + Intronic
1104129558 12:125880058-125880080 TGAGGTTTGCTTACTCCAGTGGG - Intergenic
1104974684 12:132547129-132547151 AGAGCTCTGCTTACTGAAAACGG + Intronic
1105116604 13:16707733-16707755 TGAACTCAGCTAACAGCAGGTGG + Intergenic
1105767400 13:23575305-23575327 TGAGCTCCACTTACAGGAGGGGG + Intronic
1105952944 13:25248622-25248644 TGTGCTCTCATTACTGCTGGGGG - Exonic
1106948391 13:34854531-34854553 TGTGATCTGCTTACTTCAGTGGG + Intergenic
1107642183 13:42454628-42454650 TGAGGTCTTCTTAATGCGGGAGG + Intergenic
1108558725 13:51622152-51622174 TGTGCTGTGATTGCTGCAGGAGG + Intronic
1108795762 13:54028373-54028395 TGGTGTCTGCATACTGCAGGTGG + Intergenic
1110390324 13:74965905-74965927 TTTGCTCTGCTTATTGCAGTTGG - Intergenic
1111587937 13:90306931-90306953 AGATTTCTTCTTACTGCAGGTGG - Intergenic
1112688951 13:101867115-101867137 TGAGATCTGATTTCTGCATGCGG + Intronic
1115354795 14:32435810-32435832 GGAGCTCTGGTTACTGCATGTGG + Intronic
1116423226 14:44758147-44758169 TGAGCTATAATTACTGCTGGAGG + Intergenic
1118194277 14:63610380-63610402 TCAGCTCTACTTTCTACAGGGGG - Intronic
1118619848 14:67604622-67604644 TAAGCCCAGCTTACTGTAGGAGG + Intergenic
1122074167 14:99224996-99225018 TCAGCTCTGCTATCTGCAGTGGG - Intronic
1122263978 14:100538265-100538287 AGAGCCCTGCTTCCTGCGGGCGG - Exonic
1122717985 14:103706802-103706824 TGGGCTCAGCTGACAGCAGGAGG - Intronic
1202903716 14_GL000194v1_random:56902-56924 TGAGCTCAGCTTCCTGAGGGAGG + Intergenic
1124156340 15:27228218-27228240 TGGGGTCTGCTTAAGGCAGGAGG - Intronic
1125125746 15:36218610-36218632 TGAGATATGCTGAGTGCAGGAGG + Intergenic
1125158705 15:36618736-36618758 TGAGTTGTGCTTAATGCAGTAGG - Intronic
1125197920 15:37069893-37069915 TTGGTTCTGCTTGCTGCAGGTGG - Intronic
1125499731 15:40232145-40232167 TGAGCTCTGCCTCCTGCAAGGGG - Intergenic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1131709542 15:95037981-95038003 TTAGCTCTGCTGTCTGCAGACGG - Intergenic
1132362886 15:101232819-101232841 AGAGCTCTGGGCACTGCAGGTGG + Intronic
1132671467 16:1103769-1103791 TGAGCTCAGCTTCCTGGATGAGG + Intergenic
1133138711 16:3729454-3729476 TGAGCTGGGCCTGCTGCAGGCGG + Exonic
1135887905 16:26329047-26329069 TTAGCTCTGTTGACTGCAGATGG + Intergenic
1137503291 16:49028236-49028258 TGGGCATTGCTTACTGCAGCTGG + Intergenic
1143681759 17:8481074-8481096 TGAGCCCTGCACACCGCAGGGGG - Intronic
1149382897 17:56111247-56111269 TGATCACTCCTTACTGGAGGTGG - Intronic
1151733999 17:75927529-75927551 TGTCTTCTGCTTCCTGCAGGGGG - Exonic
1152451615 17:80385029-80385051 TCAGCTCTGCTTCCTGGAGAAGG - Exonic
1152520067 17:80850467-80850489 TGATCTCGGCTCACTGCAGCCGG + Intronic
1152829888 17:82490774-82490796 TGCGCAGTGGTTACTGCAGGAGG - Intergenic
1157446335 18:47749265-47749287 TGAGCTCTGCTGACCCCTGGCGG + Intergenic
1160216480 18:76937054-76937076 TGAATGCTGCTTCCTGCAGGTGG + Intronic
1160562434 18:79766994-79767016 AGAGCTCTGCTCATCGCAGGAGG + Intergenic
1160587848 18:79922722-79922744 TGACCTCTCCTTACAGCAGCAGG + Intronic
1160624059 18:80190842-80190864 TGAGCTCTGTTTCCTGCTCGTGG - Intronic
1162061213 19:8096622-8096644 TGAGCTCTCCCTACTGCAATGGG + Intronic
1165112090 19:33508374-33508396 TTAGGTCTGCTTTCTGCAGGAGG - Intronic
1167954979 19:53057324-53057346 TGAGCTCTGTTTTCTGAATGTGG - Intergenic
925686711 2:6480736-6480758 TCTGCTCTGCTCACTGCAGTAGG + Intergenic
925998324 2:9309957-9309979 TGAGCTCTGGCTCCTGGAGGTGG + Intronic
927641561 2:24848886-24848908 TGAGCTCTGCTTACTGCAGGTGG + Intronic
928682616 2:33717821-33717843 TGTTCTCTGCACACTGCAGGTGG - Intergenic
929892365 2:45928943-45928965 TGAGTTGTGCTTATTGTAGGCGG + Intronic
930309040 2:49714515-49714537 TCAGCTTTGCTGTCTGCAGGTGG - Intergenic
931609189 2:64080534-64080556 TGACCTCTGCTTATTTCAGAGGG + Intergenic
934502942 2:94873510-94873532 TGAGCTCGGCTTCCTGAGGGAGG - Exonic
935330806 2:101976194-101976216 TGAGCTCTACTCACTGCATCAGG + Intergenic
935619015 2:105112661-105112683 TGAGCGGAGCTGACTGCAGGGGG + Intergenic
936935212 2:117833367-117833389 TGAGCACTGCCTTCTGAAGGAGG - Intergenic
938097002 2:128470855-128470877 TGAGCCCTGCTCATTGCAGTGGG + Intergenic
939359418 2:141149418-141149440 TAAGTTCTGCTTTATGCAGGTGG - Intronic
942077867 2:172373513-172373535 TGAGCACTGCTGCCTGGAGGGGG - Intergenic
943988362 2:194653620-194653642 TAAGCTCTGCTTTCTGGAGTGGG - Intergenic
945201864 2:207289861-207289883 TGAGTCCTGCTTTCTGCAAGAGG + Intergenic
947001168 2:225458197-225458219 TGTACTCTGCGTACTACAGGTGG + Intronic
948513609 2:238489137-238489159 AGAGCTGTGCTCTCTGCAGGGGG + Intergenic
949035328 2:241813521-241813543 TGGGGTCTGCTTGTTGCAGGCGG - Intronic
1168909856 20:1439042-1439064 TGAGCTTTTCCTGCTGCAGGTGG + Intergenic
1169369950 20:5021022-5021044 TCCTCTCTGCTTCCTGCAGGTGG + Intergenic
1170566713 20:17611859-17611881 AGAGTTCTGCCTCCTGCAGGCGG + Intergenic
1175678980 20:60970854-60970876 TGAGCATTGCTTTCTGCCGGAGG - Intergenic
1176366301 21:6034958-6034980 AGAGCTCTGTTCACTGCAGGGGG + Intergenic
1177555129 21:22679233-22679255 TTAGCTCTGCTCTCTGCAGATGG - Intergenic
1178447393 21:32658591-32658613 TTAGCTCTGCTGCCTGCAGATGG - Intronic
1178702775 21:34847583-34847605 TGAGTTCTGCCTACTGCACAGGG - Intronic
1179498180 21:41788313-41788335 TAAGATCTTTTTACTGCAGGTGG - Intergenic
1179579555 21:42332437-42332459 TGACATCTGCTAACAGCAGGTGG - Intergenic
1179757216 21:43503587-43503609 AGAGCTCTGTTCACTGCAGGGGG - Intergenic
1180787054 22:18553211-18553233 AGAGCTCTGGGTCCTGCAGGAGG + Intergenic
1181167283 22:20990632-20990654 TGAGCTCTGCAAACAGCAGGAGG + Intronic
1181234686 22:21442095-21442117 AGAGCTCTGGGTCCTGCAGGAGG - Intronic
1181243963 22:21492736-21492758 AGAGCTCTGGGTCCTGCAGGAGG + Intergenic
1182593034 22:31397051-31397073 TGGGCTCTCCTTGCTGCAGTTGG + Intergenic
1184313147 22:43661680-43661702 TGAGCTCTGCCTCCACCAGGAGG + Intronic
1184812129 22:46843267-46843289 TGAGCGCTGCTCTGTGCAGGTGG - Intronic
952840027 3:37638528-37638550 TCAGCTCTGCTTCCTGCAGTGGG - Intronic
954444124 3:50537479-50537501 TGAGTTCTGCCTCCTCCAGGAGG - Intergenic
954686231 3:52371764-52371786 TGTGCCCTGCTTTCTGCATGGGG - Intronic
956301235 3:67774931-67774953 TTAGCTCTGCTGTCTGCAGATGG + Intergenic
957602326 3:82353845-82353867 TTAGGTATGCGTACTGCAGGAGG - Intergenic
959039525 3:101405156-101405178 TGTACTCTGCTTCCTTCAGGAGG - Intronic
961695677 3:128702668-128702690 TGAGCCCTGATTAATGCAGAAGG - Intergenic
969481760 4:7450109-7450131 TGGGCTCTGCAGACTGCATGTGG + Intronic
970079423 4:12263920-12263942 TCAGCTCTTCGTTCTGCAGGAGG + Intergenic
972774045 4:42225158-42225180 TGGTCTCTGCTTCCTGGAGGAGG + Intergenic
973883225 4:55294758-55294780 AGAACTCTGCTTTCTGCAGAAGG + Intergenic
974086850 4:57270589-57270611 TGAGCTCTGCTTGCTGCCTCTGG - Intergenic
975254925 4:72222816-72222838 TGAACTCTTCTTGCTGCTGGGGG - Intergenic
979188639 4:117831575-117831597 TCAGCTTTGCTGTCTGCAGGTGG + Intergenic
980299737 4:130973147-130973169 TTAGCTCTGCTGTCTGCAGATGG - Intergenic
980519677 4:133915654-133915676 GGAACTCTCCTTACTGCTGGTGG + Intergenic
980744829 4:137000481-137000503 TGTGCTTTCCTTACTGCAGCTGG - Intergenic
981615609 4:146640256-146640278 TGAGCGCTGCTTGGTGCATGGGG - Exonic
983738334 4:171091673-171091695 GGAGCTCAGGTTATTGCAGGAGG - Intergenic
984069194 4:175091597-175091619 TGAATTCTGCTTAATTCAGGTGG + Intergenic
984507268 4:180635413-180635435 TGATCTCTGCCTTTTGCAGGAGG + Intergenic
985625003 5:980998-981020 TGAGGTCTGCTTACTCCAAGAGG + Intronic
986259899 5:6134942-6134964 TGAGATCTCCTTACTGGGGGAGG - Intergenic
988795995 5:34654341-34654363 TAAGTTCTGCCAACTGCAGGGGG - Intergenic
990023507 5:51158150-51158172 TGAGCTCTTCTTTCAACAGGAGG + Intergenic
990805812 5:59660309-59660331 TGAGCTCTGCTTACTAAACATGG - Intronic
990994038 5:61713247-61713269 TCAGCTCTGCTTACTGGGAGGGG + Intronic
992671296 5:79063636-79063658 TGAGCTCTGATTTCTCCAGCAGG + Exonic
992937028 5:81718480-81718502 TGACCTCTGCTTCCGGTAGGAGG - Intronic
993400263 5:87440841-87440863 TCAGCTGTGCTTGCTGAAGGTGG - Intergenic
998131967 5:139655852-139655874 TGCGCTCTGCTTAGAGCAGCGGG + Intronic
999536974 5:152528493-152528515 TCAGCTTTGCTGTCTGCAGGCGG + Intergenic
1000470173 5:161630890-161630912 TCAGCTTTGCTGTCTGCAGGTGG + Intronic
1002197314 5:177508502-177508524 TGGGCTCTGCTGTATGCAGGAGG - Exonic
1005813610 6:29533410-29533432 TTGGCTCTACTCACTGCAGGAGG + Intergenic
1005886908 6:30103868-30103890 TGAGCTCTACATACAGCAGGAGG + Intronic
1009534382 6:64861333-64861355 TCAACTCTGCTCACTGGAGGGGG + Intronic
1013543767 6:111135873-111135895 TCAGCTCTGCTCACAGCAGAGGG + Intronic
1014310282 6:119791667-119791689 TGAGCTCTGCTTCCAGTATGAGG - Intergenic
1015556862 6:134471697-134471719 AGACCTATGCTTCCTGCAGGAGG - Intergenic
1017557568 6:155588288-155588310 TGCGCTATGCTTACTGCACATGG + Intergenic
1018483433 6:164215000-164215022 TGAGCCAAGCCTACTGCAGGTGG - Intergenic
1022359801 7:29646967-29646989 TCAGCCCTGCTCAGTGCAGGAGG - Intergenic
1022374560 7:29801530-29801552 TTAGCTCTGCTGTCTGCAGATGG - Intergenic
1023472830 7:40543212-40543234 TGATCTCTGCTTCCTACAGCAGG - Intronic
1024512179 7:50212907-50212929 GGAGCCCTGCATACTGCAGAGGG + Intergenic
1029427578 7:100506013-100506035 TGATCTCGGCTCACTGCAAGTGG - Intergenic
1029976340 7:104838046-104838068 TAAGCTCTGATTACTGGAGCTGG - Intronic
1031432538 7:121690056-121690078 TGAGCTTTGCATCCTGCAGAAGG + Intergenic
1032695128 7:134329215-134329237 TGAGCTCAGCATGCTGCAAGGGG - Intergenic
1033840885 7:145371757-145371779 GGAGTTCTGCCTACTGCAGGTGG + Intergenic
1034966046 7:155391636-155391658 TGAGGTCTGTTCCCTGCAGGTGG - Intronic
1035389362 7:158495470-158495492 TGCGCCCTGCCCACTGCAGGGGG + Intronic
1035738543 8:1907670-1907692 TCAGCTGTGCTTACTGCTAGAGG + Intronic
1037882935 8:22581677-22581699 TGGGCTCTGCTTCCTGCAGCAGG + Intronic
1037923563 8:22827011-22827033 TGAGCTCTCCTTGCTGCAAAGGG - Intronic
1038954923 8:32457286-32457308 TGTGTTCTGCTTACTGTATGTGG - Intronic
1040038679 8:42896169-42896191 AGAACTCTCCTTAATGCAGGAGG - Intronic
1040806570 8:51403265-51403287 TGAGCTCTTGGTACTGAAGGAGG + Intronic
1043599837 8:81923771-81923793 TCAGCTTTGCCTTCTGCAGGTGG - Intergenic
1044163539 8:88950915-88950937 TAAGCACTGCTTATTGCAAGTGG + Intergenic
1044208731 8:89523525-89523547 TGATCTCGGCTCACTGCAGCGGG + Intergenic
1046670908 8:117055144-117055166 TGAGCTCTGCTCCCTGGAGAGGG - Intronic
1047923189 8:129656241-129656263 TCAGCTCTGTTTAATACAGGAGG - Intergenic
1048541037 8:135342318-135342340 TGAACTCTGCCTACTGCAAAAGG + Intergenic
1048915091 8:139175138-139175160 GGAGGTCTGCTTACTTTAGGGGG + Intergenic
1049163495 8:141112318-141112340 TGAGAGCTGCTTCCTGGAGGAGG + Intergenic
1049271928 8:141700606-141700628 GCAGCTCTGCTGACAGCAGGAGG - Intergenic
1049615668 8:143574897-143574919 TGTCCTCTGCTCCCTGCAGGTGG - Exonic
1050683560 9:8141809-8141831 TCAGCACTTCTTACTGCTGGTGG + Intergenic
1052249861 9:26385357-26385379 TGAGGTCTCCTTACTGCAATAGG - Intergenic
1056803622 9:89711428-89711450 TGAGCTCTGCTTCCAGGAGCTGG + Intergenic
1057693435 9:97307366-97307388 TGAGAGGTGCTTTCTGCAGGCGG + Intronic
1058128317 9:101221697-101221719 TGTGTACTGCTTCCTGCAGGTGG - Intronic
1059414287 9:114153889-114153911 TGTGCGCTGCTTCCTGCAGAGGG - Intergenic
1060857716 9:126928102-126928124 TGAGCTCAGCTTACAGAAGCAGG + Intronic
1061276684 9:129572767-129572789 TGAGGTCTGTTTACTGCAGCTGG - Intergenic
1185515826 X:698333-698355 TGAGCTGTGAATATTGCAGGAGG + Intergenic
1186629551 X:11334422-11334444 GGAACTCTCCTTACTGCAGTTGG + Intronic
1186782060 X:12922694-12922716 TGAGCTCTGATTGCTTCAGTTGG + Exonic
1188691463 X:33134171-33134193 TGAGCTCTGTTTGATGAAGGAGG - Intronic
1197862942 X:130989548-130989570 TGTGCTATGCCTACTGCATGGGG + Intergenic
1201159597 Y:11157111-11157133 TGAGCTCAGCTTCCTGAGGGAGG + Intergenic
1201725941 Y:17152319-17152341 TTAGCTCTGCTGTCTGCAGATGG + Intergenic