ID: 927644420

View in Genome Browser
Species Human (GRCh38)
Location 2:24867873-24867895
Sequence ACTAATAAGCAGAAAGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2442
Summary {0: 1, 1: 0, 2: 2, 3: 125, 4: 2314}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927644420 Original CRISPR ACTAATAAGCAGAAAGTGGG GGG Intronic
Too many off-targets to display for this crispr