ID: 927646076

View in Genome Browser
Species Human (GRCh38)
Location 2:24877775-24877797
Sequence CTCTCTGTCTGGTGGTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 270}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927646076_927646082 -7 Left 927646076 2:24877775-24877797 CCATCTGACCACCAGACAGAGAG 0: 1
1: 0
2: 1
3: 15
4: 270
Right 927646082 2:24877791-24877813 CAGAGAGGGAAGAGGCTCCTTGG 0: 1
1: 0
2: 6
3: 54
4: 460
927646076_927646085 0 Left 927646076 2:24877775-24877797 CCATCTGACCACCAGACAGAGAG 0: 1
1: 0
2: 1
3: 15
4: 270
Right 927646085 2:24877798-24877820 GGAAGAGGCTCCTTGGCCTGGGG 0: 1
1: 0
2: 5
3: 78
4: 431
927646076_927646083 -2 Left 927646076 2:24877775-24877797 CCATCTGACCACCAGACAGAGAG 0: 1
1: 0
2: 1
3: 15
4: 270
Right 927646083 2:24877796-24877818 AGGGAAGAGGCTCCTTGGCCTGG 0: 1
1: 0
2: 1
3: 29
4: 345
927646076_927646084 -1 Left 927646076 2:24877775-24877797 CCATCTGACCACCAGACAGAGAG 0: 1
1: 0
2: 1
3: 15
4: 270
Right 927646084 2:24877797-24877819 GGGAAGAGGCTCCTTGGCCTGGG 0: 1
1: 0
2: 5
3: 30
4: 339
927646076_927646087 12 Left 927646076 2:24877775-24877797 CCATCTGACCACCAGACAGAGAG 0: 1
1: 0
2: 1
3: 15
4: 270
Right 927646087 2:24877810-24877832 TTGGCCTGGGGCGAGACAGCTGG 0: 1
1: 0
2: 2
3: 8
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927646076 Original CRISPR CTCTCTGTCTGGTGGTCAGA TGG (reversed) Intronic
901293849 1:8145678-8145700 CTCTCTTCCTGGTGTGCAGATGG - Intergenic
901458489 1:9377409-9377431 CTCTCTTTCTGATTCTCAGAAGG - Intergenic
901886717 1:12228831-12228853 CACTCTGTCTGGAGTGCAGAGGG + Intergenic
902256762 1:15194362-15194384 CTTGCTGTCAGGTGGCCAGAGGG - Intronic
902579393 1:17398794-17398816 CTCTTGGGCTGCTGGTCAGAGGG - Exonic
902622323 1:17657715-17657737 CGCTCTGTCTGACGGTGAGAAGG - Intronic
903733817 1:25517325-25517347 CTCTCTACCTGGTGGCAAGAAGG + Intergenic
907300715 1:53484877-53484899 ATCCCTGTCTGTTGGTCAGGAGG + Intergenic
910279933 1:85488350-85488372 CTCTCTTCCTGGTTTTCAGATGG + Intronic
911155163 1:94629379-94629401 CCCTCTGTCAGGTGGGGAGAGGG + Intergenic
911368134 1:96964886-96964908 CTCCCTGTCTGATGGGCGGATGG + Intergenic
913997967 1:143667042-143667064 TTCTGTGTCTGGTGGTCAAGTGG - Intergenic
914050014 1:144123736-144123758 CTCTCTCTCTGCTGGCTAGAGGG - Intergenic
914129168 1:144841715-144841737 CTCTCTCTCTGCTGGCTAGAGGG + Intergenic
914695502 1:150074992-150075014 CACTCTGTCTGGGTGACAGAGGG - Intronic
915071969 1:153277327-153277349 CTCTCTTTCTGGTTTGCAGATGG - Intergenic
919832659 1:201552883-201552905 TTCCCTGTCTGAGGGTCAGATGG + Intergenic
920695015 1:208175311-208175333 TTCACTGTCTGGTGCTCAGCTGG - Intronic
924753280 1:246917676-246917698 CTCTCTGCCTGCTGGGAAGATGG + Intronic
1063914171 10:10864548-10864570 CTCTCTTTCTGGTTTGCAGAAGG + Intergenic
1064878248 10:20019683-20019705 CTCTCTTCCTGGTCTTCAGATGG - Intronic
1065117674 10:22498236-22498258 CTCTATGTATGCAGGTCAGAGGG + Intergenic
1066352144 10:34645609-34645631 CATACTGTCTGCTGGTCAGATGG - Intronic
1066515088 10:36149770-36149792 CTCTCTTTCTGGTTAACAGATGG + Intergenic
1067173398 10:43925603-43925625 CTCTCTTTCTGGTTTGCAGATGG + Intergenic
1067564563 10:47327247-47327269 TGCTCTGGCTGGAGGTCAGAGGG - Intergenic
1068698888 10:59999189-59999211 CTTTCTGTGTGGTGATCAGCAGG + Intergenic
1069873195 10:71545710-71545732 ATCTATGTCTGCTGGTGAGAAGG + Intronic
1070740902 10:78902631-78902653 CTCTCTGTCTAATGGTGGGAGGG - Intergenic
1071124446 10:82318058-82318080 CTTTGTGTCTGGTGGGCAGGGGG + Intronic
1072449835 10:95531141-95531163 CTCGCAGTTTGGTGGGCAGAGGG - Intronic
1073544099 10:104334695-104334717 CTATCTTTCTGCTGGTGAGAGGG + Intronic
1074346657 10:112692864-112692886 CTCACTGTCTGGTGGGGAGATGG - Intronic
1075200630 10:120400714-120400736 CTCTCTTTCTGGTTTGCAGATGG - Intergenic
1075510915 10:123072597-123072619 CTCTATGACTAGTGATCAGAAGG + Intergenic
1076291886 10:129351805-129351827 CTCCCAGTCTGGAGGCCAGAAGG - Intergenic
1077117043 11:889893-889915 ATCTCTGACAGGTGGGCAGAGGG - Intronic
1079225472 11:18601009-18601031 CACTCTGTGTGGTGACCAGAAGG - Intergenic
1080302182 11:30797111-30797133 CTTTCTGTCTGGTCATCTGATGG - Intergenic
1080639117 11:34148558-34148580 CACTCTGTCTGGGGGCCAGATGG - Intergenic
1084006355 11:66325572-66325594 CTCCCTTTCTTGTGGGCAGATGG - Intergenic
1084448709 11:69219461-69219483 CCCGATTTCTGGTGGTCAGAGGG - Intergenic
1084899681 11:72300351-72300373 CTCTCTGCCTGGTAGACAGGTGG - Intronic
1084960336 11:72713087-72713109 CTCTCTGTCTGGTAGTCCTCAGG + Intronic
1085289469 11:75387433-75387455 TTCTCTGTCTGGTGTGGAGAAGG - Intergenic
1088425883 11:109701930-109701952 CATTCTGACTGGTGGTAAGATGG - Intergenic
1093906167 12:24694110-24694132 CTCTCTGTCTTCAGGTCACATGG - Intergenic
1095589725 12:43889940-43889962 CTCCCTGTGTGGTGCTCATAGGG - Intronic
1097959539 12:65519000-65519022 ATTTCTGGCTGGTGGTTAGATGG - Intergenic
1100258143 12:92904973-92904995 CTCTATGCCTGAAGGTCAGAGGG + Intronic
1102220637 12:111192036-111192058 CTCTATTGCTGGTGGTCACAGGG - Intronic
1103195671 12:119041804-119041826 TGCTCTGGATGGTGGTCAGAGGG + Intronic
1104167422 12:126247066-126247088 CTCTGTGCCTGGTACTCAGATGG - Intergenic
1104866421 12:131958277-131958299 CTCTCTGCCGGGTGGTGGGAGGG + Intronic
1106437742 13:29738833-29738855 CTCTCTCTTTGGTGTGCAGAAGG + Intergenic
1107015139 13:35702246-35702268 CTCTCTGCCTGGTGGTCTTCAGG + Intergenic
1107189144 13:37558973-37558995 CTGTCTGTCTGCCGCTCAGAAGG + Intergenic
1110061213 13:71040116-71040138 CTATCTGTCTGCTGGTCTGCTGG + Intergenic
1110148560 13:72223046-72223068 CTCTCTGTCAGTTGGTCATGTGG + Intergenic
1111260746 13:85737201-85737223 CATTCTGACTGGTGGTGAGATGG - Intergenic
1117558722 14:56912914-56912936 CTCTCTCTCTGCTGGTCTGTTGG + Intergenic
1117792749 14:59358339-59358361 CTCCCTCTCTGGTGGTGACAGGG - Intronic
1118763283 14:68893744-68893766 CTCTCTGTCTTGTTGCCAGGCGG - Exonic
1119649314 14:76372430-76372452 CTCTTTACCTGGTGGACAGAGGG - Intronic
1119895788 14:78218941-78218963 CTCTCTCCTTGGTGGGCAGATGG + Intergenic
1120617833 14:86729948-86729970 CTCTCTTTCTGTTTGGCAGATGG - Intergenic
1121649558 14:95547746-95547768 CACTCTGTATGCTGGCCAGAGGG - Intergenic
1123419878 15:20122983-20123005 CTCTCTCTCTGCTGGCTAGAGGG - Intergenic
1123445982 15:20330549-20330571 CTCTCTCTCTGCTGGCTAGAGGG + Intergenic
1123529100 15:21129519-21129541 CTCTCTCTCTGCTGGCTAGAGGG - Intergenic
1124598368 15:31110514-31110536 CTCTTTGTCTGGAAGGCAGAGGG + Intronic
1126066430 15:44829618-44829640 CTCTCTACCTGGTGGTGAGGAGG + Intergenic
1126093452 15:45071251-45071273 CTCTCTACCTGGTGGTGAGGAGG - Intronic
1126968638 15:54084264-54084286 CTCTCTTTCTATTGGTCAGTTGG + Intronic
1127001605 15:54514779-54514801 CTCTCTGTATGGAGTTCAAATGG + Intronic
1127295385 15:57604504-57604526 CTCTCTGTCTTCTGGGAAGACGG - Intronic
1127966464 15:63926285-63926307 CTCTCTGTCGGGTGCTTAGGAGG - Intronic
1129079152 15:73024104-73024126 ACCTCTGGCTGCTGGTCAGATGG - Intergenic
1129269520 15:74412011-74412033 GTCTGTGTATGGTGGACAGAGGG + Exonic
1131433194 15:92402837-92402859 CTCTCTCTCTGGTAATGAGATGG - Intronic
1131731514 15:95287030-95287052 CTTTCTGTCTGGTAGGCAGGGGG - Intergenic
1132841642 16:1980988-1981010 TTCTCTGTGCGCTGGTCAGACGG - Exonic
1133567962 16:7012936-7012958 CTCTCTTTGTGGTTGGCAGATGG + Intronic
1133677203 16:8085121-8085143 ATCTGTGCCTGGTTGTCAGAGGG - Intergenic
1133876739 16:9741993-9742015 CTTTCTGGCTGTTGGCCAGAGGG - Intergenic
1134076568 16:11296182-11296204 CGCCCTGTCTGGAGGTGAGAGGG - Intronic
1135111703 16:19695377-19695399 CTCTTTCTCTGGTGGAGAGAGGG + Intronic
1135517813 16:23149698-23149720 CTCTGTCTTTGCTGGTCAGATGG + Intergenic
1136088692 16:27903305-27903327 CTCTCTGTGTGGCAGCCAGAGGG - Intronic
1136720785 16:32318126-32318148 CTCTCTCTCTGTTGGCTAGAGGG - Intergenic
1136839165 16:33524407-33524429 CTCTCTCTCTGTTGGCTAGAGGG - Intergenic
1138027890 16:53537107-53537129 CCCTCTGCCAGGAGGTCAGAAGG - Intergenic
1139344821 16:66296234-66296256 CTCTCAGGCAGGAGGTCAGATGG - Intergenic
1140809765 16:78566084-78566106 CTCTCTTTCTGGTTCCCAGATGG + Intronic
1140834734 16:78782562-78782584 CTCTTTGGCTGGTGGACGGAAGG - Intronic
1141677227 16:85524185-85524207 CTCTCTGGCTGGCAGTCAGGTGG + Intergenic
1141985379 16:87576495-87576517 CTCTCACTCTGGAGGCCAGAAGG + Intergenic
1203005647 16_KI270728v1_random:199644-199666 CTCTCTCTCTGTTGGCTAGAGGG + Intergenic
1203137197 16_KI270728v1_random:1735764-1735786 CTCTCTCTCTGTTGGCTAGAGGG + Intergenic
1203149330 16_KI270728v1_random:1824694-1824716 CTCTCTCTCTGTTGGCTAGAGGG - Intergenic
1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG + Intronic
1143331341 17:6138064-6138086 CTGTCTTGCTGGTGCTCAGAAGG + Intergenic
1143399617 17:6635583-6635605 CACTCTGTCAGGTGGCCCGAAGG + Intronic
1143674008 17:8417586-8417608 CTCTGTGTATGGTGATCAAATGG + Intronic
1146745110 17:35321816-35321838 TGCTCTGTCTGGTGGGGAGAGGG - Intergenic
1147932718 17:43992916-43992938 CTCACTGTCTGGAGGCCGGAAGG - Intronic
1148814618 17:50318657-50318679 CTATTTGTCTGGTGGCCAGGAGG - Intergenic
1149383854 17:56122680-56122702 CTTTCTTTCTGATGGCCAGAGGG - Intronic
1149500178 17:57146609-57146631 CTCTCTGCCTGCTGCTCAGAAGG - Intergenic
1150852019 17:68712524-68712546 CTTTCTGTTTGGTGTTCAAAAGG + Intergenic
1152489364 17:80619254-80619276 CTCTCAGTGTGGGGGACAGAAGG + Intronic
1153909707 18:9696227-9696249 CTGTCTGCCTTGTGGTCAGGTGG - Intergenic
1155488335 18:26371702-26371724 CTCTAGGTCTGGTGAACAGATGG + Intronic
1155550999 18:26964927-26964949 CTTTCTGCCTAGTGGTCAGAAGG + Intronic
1156544248 18:37947691-37947713 CTCACAGTCTGGAGGCCAGAAGG - Intergenic
1156855970 18:41781633-41781655 CCTTCTGTCTGGAGTTCAGAAGG - Intergenic
1157397793 18:47357184-47357206 CTCTCTGCCTGGTGTGCAGATGG + Intergenic
1157675068 18:49562557-49562579 CTGTCTCTCTGCTGGTCTGATGG + Intronic
1158096911 18:53783334-53783356 CTTTCTGTATGGTGGTCTCAGGG - Intergenic
1158349623 18:56551626-56551648 AGCTCTGTGTGGTGGTGAGATGG + Intergenic
1158945682 18:62445154-62445176 GTATCTGTCCAGTGGTCAGAGGG - Intergenic
1159329447 18:66971308-66971330 GTCCCAGTCTGGTTGTCAGATGG - Intergenic
1160431591 18:78816790-78816812 CTGTCAGCCTGGTGGGCAGAAGG - Intergenic
1161918807 19:7250851-7250873 CTCTGAGTCTGGAGCTCAGAGGG + Intronic
1162176932 19:8837570-8837592 TTCTCTGGCTGGAGGGCAGAAGG + Intronic
1163112323 19:15169282-15169304 CTCTCTTCCTGGTGTGCAGATGG - Intronic
1163263917 19:16207065-16207087 CTCTCTGGCTGCTGAGCAGAAGG + Intronic
1163321077 19:16575283-16575305 TTTTTTGTCTGGTGGTCTGATGG + Exonic
1163679528 19:18672629-18672651 CTCTCATTCTGGTGGCCAGCCGG + Intergenic
1167449905 19:49560927-49560949 CTCTTTGTTTGGAGGTAAGAGGG + Intronic
1168133487 19:54336138-54336160 TTCCCTCTGTGGTGGTCAGAGGG - Intronic
1202689403 1_KI270712v1_random:76299-76321 CTCTCTCTCTGCTGGCTAGAGGG - Intergenic
926008781 2:9392566-9392588 CTCTCCGTCTGGTGGTCCAGGGG + Intronic
927646076 2:24877775-24877797 CTCTCTGTCTGGTGGTCAGATGG - Intronic
930150263 2:48052050-48052072 ATCTCTGGCTGCTGCTCAGATGG - Intergenic
932797810 2:74712622-74712644 CGATCTGTCTGGTGGTCACATGG + Intergenic
933879024 2:86649349-86649371 CAGTCTGGCTGGTGGTAAGAGGG - Intronic
933957031 2:87379793-87379815 CTCTCTCTCTGCTGGCTAGAGGG + Intergenic
933993889 2:87653414-87653436 CTCTGTGTCTGGTGGCTATAGGG + Intergenic
934241151 2:90271682-90271704 CTCTCTCTCTGCTGGCTAGAGGG + Intergenic
934272025 2:91545004-91545026 CTCTCTCTCTGCTGGCTAGAGGG - Intergenic
936148006 2:109994611-109994633 CTCTCTCTCTGCTGGCTAGAGGG - Intergenic
936149085 2:110001822-110001844 CACTCAGTCTGATGATCAGATGG - Intergenic
936195596 2:110369548-110369570 CACTCAGTCTGATGATCAGATGG + Intergenic
936196686 2:110376836-110376858 CTCTCTCTCTGCTGGCTAGAGGG + Intergenic
936299974 2:111297469-111297491 CTCTGTGTCTGGTGGCTATAGGG - Intergenic
936959617 2:118059206-118059228 CTCTGTGCCTTGTGGTCACAGGG + Intergenic
937335868 2:121062111-121062133 CGCTCTTTCTGGAGGTCAGAGGG + Intergenic
939146751 2:138424923-138424945 TTCTCTGTATGGTTGTCAGATGG - Intergenic
940835281 2:158514524-158514546 CTTTCTGTCTGGTCTTCAGCAGG - Intronic
942120942 2:172776300-172776322 ATCACTTTCTGGTGGTCACAGGG + Intronic
944111052 2:196131577-196131599 CTCTCTGTCCTTTGTTCAGAGGG - Intergenic
944423810 2:199558224-199558246 CTCTGTGTTTGGTGGTGAGTGGG + Intergenic
945208041 2:207353050-207353072 CTCTCTGTCTGAAGAACAGATGG - Intergenic
945293512 2:208147909-208147931 CACTCTATCAGCTGGTCAGAAGG + Intergenic
946161168 2:217836878-217836900 CTCTCTGTCTGCTCTTCAGCTGG - Intronic
948850311 2:240702408-240702430 CACTTTGTGTGGAGGTCAGAGGG - Intergenic
1169254186 20:4084829-4084851 CTCTGGGTCTGATGGTCAGGAGG + Intergenic
1172084191 20:32366568-32366590 TTCTGTGTCTGGTAGTGAGATGG + Intronic
1174515715 20:51090919-51090941 CGCTCTGTCTGTTGGTAATAAGG + Intergenic
1175305205 20:57971190-57971212 CTCTCCATCTGGTCGTCAGTGGG - Intergenic
1175529024 20:59661491-59661513 CACTCTGTCTGGTTCTCACAGGG - Intronic
1175575388 20:60057076-60057098 CTCTCTCTCTGGTGCTCTGGTGG + Intronic
1175587891 20:60159976-60159998 TTCACTATCTGGAGGTCAGAGGG - Intergenic
1176302719 21:5106225-5106247 GCCTCTGCCTGGTGGGCAGAGGG - Intergenic
1177949181 21:27512341-27512363 CTCTCTTTCTGGTTTGCAGATGG + Intergenic
1178116864 21:29426843-29426865 CTCTTTGTCTGGAGGGGAGAAGG - Intronic
1178350921 21:31872906-31872928 CTCCCTGTCTGGCGCTCAGGTGG + Intergenic
1178747297 21:35265363-35265385 CTCTCTTCCTGGTTATCAGACGG - Intronic
1179854305 21:44155698-44155720 GCCTCTGCCTGGTGGGCAGAGGG + Intergenic
1180007167 21:45028104-45028126 CCGTCTGTCTGGGGGTCACAGGG + Intergenic
1180007178 21:45028140-45028162 CCGTCTGTCTGGGGGTCACAGGG + Intergenic
1180007232 21:45028352-45028374 CCGTCTGTCTGGGGGTCACAGGG + Intergenic
1180007282 21:45028568-45028590 CCGTCTGTCTGGGGGTCACAGGG + Intergenic
1180007324 21:45028748-45028770 CCGTCTGTCTGGGGGTCACAGGG + Intergenic
1180007335 21:45028784-45028806 CCGTCTGTCTGGGGGTCACAGGG + Intergenic
1180583668 22:16866413-16866435 CACTCAGTCTGATGATCAGATGG + Intergenic
1181352012 22:22265744-22265766 CTCTCTCTCTGCTGGCTAGAGGG - Intergenic
1181715697 22:24726012-24726034 CACAATGTCAGGTGGTCAGATGG - Intronic
1185078447 22:48695930-48695952 CTGTCTGTGTGGTGGTCAGCAGG - Intronic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
950707112 3:14789723-14789745 CTGTCTGTCTGGGGGCAAGACGG + Intergenic
950860324 3:16142084-16142106 CTCTCTTTCTGGTTTGCAGATGG + Intergenic
954387263 3:50250676-50250698 CTCCCTGGCTGGGGGCCAGAGGG - Intronic
954867783 3:53744316-53744338 CTCACAGTCTGGTGGAGAGATGG - Intronic
955541954 3:59985935-59985957 CTCTCTCTCTGTTTGTGAGAGGG - Intronic
955728524 3:61959018-61959040 CTTTCTGTCTCTTGGTCTGATGG + Intronic
956731349 3:72199475-72199497 CCCTGTGTCTGGTGGTGAGTGGG + Intergenic
962107583 3:132408072-132408094 CTCTCTTTCTGGTTGGTAGATGG - Intergenic
966949701 3:184805039-184805061 CTCACTGGTTGTTGGTCAGAGGG - Intergenic
968447387 4:658550-658572 CTCTCTGTGTGGTGGGGACACGG + Intronic
969849573 4:9945651-9945673 CCCTGAGTCTGGTGGTCTGATGG - Intronic
971028751 4:22613814-22613836 CTTTCTGCCTAGTGGTCAGAAGG + Intergenic
972769538 4:42184323-42184345 CTCTCTGTTTGGGGGTAAGAGGG + Intergenic
976698889 4:87947615-87947637 CTCTCTTTCTGGTTCACAGATGG + Intergenic
976803329 4:89018328-89018350 CTCTCTCTTTGGTGTGCAGATGG - Intronic
977366586 4:96076564-96076586 CCCTCTTTCTGGTTCTCAGATGG - Intergenic
977883106 4:102228731-102228753 CTCTCTGTGTGGTGAGCAGCAGG - Intergenic
979881321 4:125963456-125963478 CTCTCTGCCAGATGGTCAGGTGG - Intergenic
986057592 5:4154060-4154082 CACTCTTCCTGGTGGACAGATGG - Intergenic
986171279 5:5316806-5316828 CACCCTTTCTGGTGGTCCGACGG - Intronic
986702372 5:10423202-10423224 CACTCTGTCTGGTGGAGAGCTGG + Intronic
988028771 5:25735167-25735189 CTCTCTGACTGCAAGTCAGAGGG + Intergenic
989541945 5:42628127-42628149 CCATCTGTCTGCTGGTCAGCTGG + Intronic
991417983 5:66411228-66411250 CTCTCTGTCTCAAGGTCAGCTGG - Intergenic
991587820 5:68216796-68216818 CTCTTTGTCTTGTGATCTGAGGG - Intronic
992786811 5:80177796-80177818 CACAGTGTCTGGTGGGCAGATGG + Intronic
993432891 5:87853755-87853777 CTCTCTTTCTGGTGTTGACAAGG - Intergenic
995726009 5:115180546-115180568 CTCACTGTCTGGAGGTGCGAGGG + Intronic
995768214 5:115641390-115641412 CTAGGTGTCTTGTGGTCAGAAGG + Intergenic
996020514 5:118586315-118586337 CTCTGTGTCTGTTGGTGATAAGG - Intergenic
996023691 5:118619838-118619860 CTCTCTGTCTGCTAGTGGGAAGG - Intergenic
997363337 5:133309434-133309456 GTCTCTTTCTGATTGTCAGATGG - Intronic
997370214 5:133354817-133354839 CTCACTCTCTGGTGGAAAGATGG - Intronic
999654704 5:153800361-153800383 CTCCCTGTTTGTTGTTCAGAAGG - Intronic
999780404 5:154844967-154844989 CTTACTTTCTGGTGGTGAGAAGG + Intronic
1000325627 5:160169932-160169954 CTGTCTGTCTGGTGGGCACTGGG - Intergenic
1000421488 5:161043122-161043144 CTCTCATTCAGGTGATCAGAAGG + Intergenic
1000425077 5:161080747-161080769 CTCTCATTCAGGTGATCAGAAGG - Intergenic
1002681418 5:180968255-180968277 CTATCCTTGTGGTGGTCAGATGG + Intergenic
1004210364 6:13635146-13635168 CTCTCTGTCGTGTGGTGAAAAGG - Intronic
1004338536 6:14786352-14786374 AGCTCAGGCTGGTGGTCAGATGG - Intergenic
1004704538 6:18112004-18112026 CTCTATGCCTGGTGGGCACATGG + Intergenic
1005601752 6:27433078-27433100 ATGTCTGTCTGGTGCTCAGTTGG - Intergenic
1009773796 6:68178862-68178884 CTCCCTGTCCGCTGGCCAGAGGG - Intergenic
1011312014 6:85989808-85989830 CTCTATGTCTGGTGGTATGCTGG + Intergenic
1012482448 6:99682105-99682127 CTCTTTGTCTCATGGTCACAAGG - Intergenic
1013547910 6:111177826-111177848 CTCTCTGTTTAGTGGTCTAATGG - Intronic
1014783723 6:125593789-125593811 CTCTCTGTCTGGAGGAAGGAAGG + Intergenic
1015601110 6:134911630-134911652 CTGTCTGGGTGGTGGTCAGAGGG - Intergenic
1017123115 6:151042590-151042612 GTCTTTGTCTTGTGGTCACATGG + Intronic
1019213431 6:170424245-170424267 ATCTCTGGCTGGTCGTCAGTGGG + Intergenic
1019256816 7:57572-57594 CTCTCTGCCTGGGTTTCAGAAGG + Intergenic
1019640021 7:2098394-2098416 CTTTGTGTCTGGTTGTCACAGGG - Intronic
1020924582 7:14309737-14309759 GTATTTGTCTGGTTGTCAGAGGG - Intronic
1021724939 7:23539625-23539647 CTCTCTGCTTGCTGGTCAAAAGG - Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1023564839 7:41513814-41513836 CTTCCTCTCTGGTGGACAGAAGG - Intergenic
1024568119 7:50700917-50700939 GTCTCTGTCTGTTGGGTAGAGGG + Intronic
1024812409 7:53227696-53227718 CTCTCTGTCTGGCTTGCAGATGG - Intergenic
1027312271 7:76961853-76961875 TTCTCTGTCTGGTGCAGAGAAGG + Intergenic
1027839056 7:83284123-83284145 TTGTCTGTCTTGTGGTCAGGTGG - Intergenic
1029025552 7:97413476-97413498 CTCACTTTCTGTGGGTCAGAAGG + Intergenic
1029036482 7:97527610-97527632 CTCTCTTTCTGGATTTCAGATGG - Intergenic
1029601571 7:101566594-101566616 CTCTCTTTCTGGTTTGCAGATGG + Intergenic
1030182068 7:106720624-106720646 GTATCTGTCTGATTGTCAGAAGG + Intergenic
1030334413 7:108308984-108309006 CTCTCTGTCCTGGGGTCAGATGG - Intronic
1031095131 7:117408135-117408157 CTCTCTCTGTGGAGGTCAGGGGG + Intronic
1033230670 7:139595013-139595035 CTCTCTGACTGGTGGAGAGACGG + Intronic
1033552279 7:142458288-142458310 CTATCTGTCTCTTGGTTAGAGGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1035088748 7:156286300-156286322 CTCTCTTCCTGGTGTGCAGACGG - Intergenic
1037838146 8:22226727-22226749 CACGCTGCCTGGTGGACAGAAGG + Intronic
1039224736 8:35376323-35376345 CTCTCTGGCCTGTGGTCAGAAGG - Intronic
1039494734 8:37972389-37972411 CTCTCTGCCTTCTGGTTAGATGG - Intergenic
1042159852 8:65881690-65881712 CTCTCTGTGTGCTGCTCACATGG + Intergenic
1046084396 8:109414728-109414750 CTCTCTGTCTGGGTGTCAAGAGG - Intronic
1047542529 8:125784638-125784660 CTCTCTGTGTGCTGGTGATATGG + Intergenic
1048931224 8:139316758-139316780 ACCTCTGTCAGCTGGTCAGAAGG - Intergenic
1049340598 8:142110380-142110402 CACTGTGTCTTTTGGTCAGAGGG - Intergenic
1049340657 8:142110788-142110810 TGCCCTGTCTGCTGGTCAGAGGG - Intergenic
1049744751 8:144258515-144258537 CTCTCAGGCTGGTGGCCAGGTGG + Intronic
1050135729 9:2461701-2461723 CACTCTTTCTGGTGGTTATATGG + Intergenic
1055931553 9:81564666-81564688 CCCTCTGTCTGGTTGCCACATGG - Intergenic
1057845004 9:98516296-98516318 CACTCTGCCTGCTGGACAGAGGG - Intronic
1059342951 9:113609845-113609867 CTCTCAGTCTGGGGGTCAAGAGG - Intergenic
1059510328 9:114839391-114839413 CTGTCTGTGTGGAGGCCAGAGGG + Intergenic
1061486018 9:130920847-130920869 CTCCCAGCCTGGTGGACAGAAGG - Intronic
1061817398 9:133205362-133205384 CTCTGTGTCTGGTGGTAGGGTGG + Exonic
1062243005 9:135549864-135549886 CTCTGTGTCTGGTGGTAGGGTGG - Exonic
1062443148 9:136582482-136582504 CTCTGTGTCTGGTGTACAGCTGG - Intergenic
1062455403 9:136634814-136634836 CTCTCTGTCTGTTAGTTAGCTGG - Intergenic
1185949707 X:4419163-4419185 GTCTCTGTCTTGTGTTCATATGG + Intergenic
1187335256 X:18376110-18376132 CTCTCTGTCTAGTGGAGACAGGG - Intergenic
1188262161 X:28034634-28034656 CAGGCTGACTGGTGGTCAGAAGG + Intergenic
1189297701 X:39930363-39930385 CTCTGTGTGTGCTGGACAGATGG + Intergenic
1189520348 X:41760563-41760585 CTGTCTGTCTCCTGGTCAGTTGG - Intronic
1189911183 X:45811904-45811926 CTCTCTGACTTGTGGGCATATGG - Intergenic
1191145029 X:57156726-57156748 CTCTCTTTCTGCTAATCAGATGG + Intergenic
1192417581 X:70997280-70997302 CCCTCTGTCTGGGTGACAGAGGG - Intergenic
1196931678 X:120687863-120687885 CTCACTTTCTGGTTCTCAGATGG - Intergenic
1197133159 X:123029546-123029568 CTGTCTGTCTGCTGTTCACAAGG + Intergenic
1197386958 X:125813806-125813828 CTCTCTGTCTGGTAGGGTGAGGG - Intergenic
1198882310 X:141294879-141294901 CTCTGTGTATGGGGGTCAGCTGG - Intergenic
1199947781 X:152681726-152681748 CGCTCTGTCTGTTAATCAGATGG - Intergenic
1199961898 X:152786728-152786750 CGCTCTGTCTGTTAATCAGATGG + Intergenic
1201250454 Y:12052557-12052579 CTCTCTTTTTGGTTTTCAGATGG + Intergenic