ID: 927653788

View in Genome Browser
Species Human (GRCh38)
Location 2:24928655-24928677
Sequence CAGCAGTACTGGAGGGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927653781_927653788 4 Left 927653781 2:24928628-24928650 CCATGGGAAAGACAAAGCAGGAG No data
Right 927653788 2:24928655-24928677 CAGCAGTACTGGAGGGGAGGCGG No data
927653779_927653788 18 Left 927653779 2:24928614-24928636 CCAGAAGGGGTGGGCCATGGGAA No data
Right 927653788 2:24928655-24928677 CAGCAGTACTGGAGGGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927653788 Original CRISPR CAGCAGTACTGGAGGGGAGG CGG Intergenic
No off target data available for this crispr