ID: 927655903

View in Genome Browser
Species Human (GRCh38)
Location 2:24946306-24946328
Sequence GAGGCAAGTGTGGATCCTTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 126}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927655903_927655914 19 Left 927655903 2:24946306-24946328 CCCAAAGGATCCACACTTGCCTC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 927655914 2:24946348-24946370 CAAGGCTTAGAAGAGGGAGGAGG 0: 1
1: 0
2: 4
3: 46
4: 447
927655903_927655908 1 Left 927655903 2:24946306-24946328 CCCAAAGGATCCACACTTGCCTC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 927655908 2:24946330-24946352 GATCAACCAGATTCAGGCCAAGG 0: 1
1: 0
2: 0
3: 2
4: 116
927655903_927655906 -5 Left 927655903 2:24946306-24946328 CCCAAAGGATCCACACTTGCCTC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 927655906 2:24946324-24946346 GCCTCTGATCAACCAGATTCAGG 0: 1
1: 0
2: 0
3: 9
4: 93
927655903_927655911 13 Left 927655903 2:24946306-24946328 CCCAAAGGATCCACACTTGCCTC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 927655911 2:24946342-24946364 TCAGGCCAAGGCTTAGAAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 174
927655903_927655915 25 Left 927655903 2:24946306-24946328 CCCAAAGGATCCACACTTGCCTC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 927655915 2:24946354-24946376 TTAGAAGAGGGAGGAGGCAGTGG 0: 1
1: 0
2: 12
3: 88
4: 1040
927655903_927655910 12 Left 927655903 2:24946306-24946328 CCCAAAGGATCCACACTTGCCTC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 927655910 2:24946341-24946363 TTCAGGCCAAGGCTTAGAAGAGG 0: 1
1: 0
2: 2
3: 19
4: 676
927655903_927655912 16 Left 927655903 2:24946306-24946328 CCCAAAGGATCCACACTTGCCTC 0: 1
1: 0
2: 1
3: 11
4: 126
Right 927655912 2:24946345-24946367 GGCCAAGGCTTAGAAGAGGGAGG 0: 1
1: 0
2: 3
3: 28
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927655903 Original CRISPR GAGGCAAGTGTGGATCCTTT GGG (reversed) Exonic
900076871 1:825022-825044 GAGGCAAGTATGGATCGTTTAGG - Intergenic
900514147 1:3073308-3073330 GAGGCAATTAGGGATCCTTGGGG + Intronic
902207120 1:14877088-14877110 AATGCCAGTGTGGATCCTTCAGG + Intronic
902382094 1:16057582-16057604 GACCCAAGTGTGGCTCCTTGGGG + Intergenic
903553708 1:24177784-24177806 GAGGCAAGTATGTATGTTTTGGG + Intronic
904127966 1:28255543-28255565 GAAGGAAGAGTGGATCCTTGTGG + Intergenic
904159494 1:28512276-28512298 GAGGCCATTGTGGATCCTTAGGG - Intronic
904266855 1:29323278-29323300 AGGGCAAGTGTGGAGCCCTTGGG + Intronic
904898644 1:33838111-33838133 GAGGGAAGTCTGAATCCATTGGG - Intronic
906179553 1:43806616-43806638 GAGGTAACTGTGGATCATTTAGG + Intronic
909683769 1:78322416-78322438 GAGGCAAGTATGGATATTTCAGG - Intronic
915304205 1:154968692-154968714 GAGGCAAGTGTGGGGCATGTGGG - Intronic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
1065223446 10:23519250-23519272 TATGCAAGTGTGTGTCCTTTTGG + Intergenic
1067432039 10:46251329-46251351 GATGCAGGTGTGGCTCCATTTGG - Intergenic
1067441375 10:46310873-46310895 GAGGCAGGTGTGGCTCCATTTGG + Intronic
1069871743 10:71537150-71537172 GAGGCAAGTGCCCACCCTTTGGG + Intronic
1070526076 10:77297033-77297055 GAGGCAAGTCTGCACCCTGTTGG - Intronic
1072000034 10:91185762-91185784 GGGGCAAGTGTGGTTTCCTTGGG + Intronic
1072002638 10:91211948-91211970 GAGGCAGGAGTGGAACCTTGTGG - Intronic
1073916986 10:108417105-108417127 TAGGCTGGTGTGAATCCTTTGGG - Intergenic
1075313350 10:121432706-121432728 GAGACAACTGTGGGTCCTTAAGG + Intergenic
1076359581 10:129877950-129877972 GAGGGAAGTGTGGAAGCTGTGGG - Intronic
1076561110 10:131364880-131364902 GAGGCAGGTGCGGCTCCCTTTGG + Intergenic
1077274586 11:1697996-1698018 GAGGAAGGTTTGGAGCCTTTGGG - Intergenic
1077324827 11:1959200-1959222 GAGGTGGGTGTGGATGCTTTGGG - Intronic
1077738884 11:4822441-4822463 GAGGCATGTGTGGGCACTTTGGG - Intronic
1079704139 11:23592274-23592296 GAGGCAAGCAGGGATCATTTGGG - Intergenic
1089125554 11:116174181-116174203 GAGGGAACTGTGGCTCCTTCTGG - Intergenic
1090191713 11:124775313-124775335 GTGGCAGGTGTGCATCCTATTGG - Intronic
1202807807 11_KI270721v1_random:14377-14399 GAGGTGGGTGTGGATGCTTTGGG - Intergenic
1092159200 12:6306674-6306696 AAAGCAAATGTGGTTCCTTTGGG + Intergenic
1095602136 12:44025917-44025939 GAGGTATGTGTATATCCTTTTGG + Intronic
1096060279 12:48692662-48692684 CAGACAATTGTGGATCCTTTCGG - Exonic
1096749492 12:53749728-53749750 GAGGCAAATTTGTATCCTTTAGG + Intergenic
1100391086 12:94147262-94147284 GAGGCATTTGTGCATCCTCTGGG + Intergenic
1104112023 12:125713093-125713115 GACTCAGCTGTGGATCCTTTGGG + Intergenic
1105039468 12:132950261-132950283 GAGGCCAGGGTGGCTGCTTTTGG - Intronic
1107533733 13:41308623-41308645 TAGGCAAGTATAGATGCTTTAGG - Intergenic
1107895577 13:44959404-44959426 GAGGCAAATGCAGATCCTCTTGG - Exonic
1110048932 13:70869855-70869877 GAGGGAAAAGTGGATACTTTGGG + Intergenic
1111355981 13:87103140-87103162 GAGGCAAGGGTGAGTGCTTTGGG - Intergenic
1115976917 14:39006926-39006948 GAGGCATGTGGGGAGCCTATGGG + Intergenic
1130996753 15:88908432-88908454 GAGTCCAGTGTGCATTCTTTGGG + Intronic
1131046128 15:89317268-89317290 GAGTCAAGAGTGGATTCTCTGGG + Intronic
1132735532 16:1384090-1384112 GAGGCAGGTTTGGGTCCCTTGGG + Intronic
1134421500 16:14095280-14095302 CAGGCAAGTGTGGTTCCACTTGG + Intronic
1138002302 16:53294534-53294556 GAGGCAACTGTGGCTCTTCTAGG - Intronic
1140940812 16:79720302-79720324 GACCCAAGTGGGGATTCTTTGGG - Intergenic
1142698166 17:1644850-1644872 GATGCAAGCCTGGATTCTTTGGG - Exonic
1144097808 17:11917580-11917602 TAAGGAAGTGTGGCTCCTTTAGG - Intronic
1144769926 17:17753862-17753884 GGAGGAACTGTGGATCCTTTGGG + Intronic
1149988657 17:61367985-61368007 GAGGAAAGTAGGGATCCGTTTGG + Intronic
1151360538 17:73586012-73586034 GTGGGAAGTGAAGATCCTTTGGG + Intronic
1155659697 18:28233321-28233343 AAGGAAAGTGTGGAAACTTTGGG + Intergenic
1157612048 18:48963338-48963360 AAGGCAAGTGAGGCTCCTCTGGG - Intergenic
1160978018 19:1803296-1803318 GAGGCAGGTGAGGACCCTTCAGG - Intronic
1161831801 19:6611210-6611232 TTGGCAACTGTGTATCCTTTGGG + Intergenic
1163155166 19:15436160-15436182 CAGGCTAGTGGGGATCCTATTGG - Intronic
926238867 2:11069730-11069752 GAGGGCTGTGTGGATGCTTTGGG - Intergenic
927504164 2:23602485-23602507 GAGGCCAGTGGGGAACTTTTAGG + Intronic
927655903 2:24946306-24946328 GAGGCAAGTGTGGATCCTTTGGG - Exonic
927657949 2:24967136-24967158 GATGCAAATATGGATCATTTTGG + Intronic
933933984 2:87185385-87185407 GAGGCAAGTTTGCATCATCTGGG + Intergenic
936359159 2:111780510-111780532 GAGGCAAGTTTGCATCATCTGGG - Intronic
937717274 2:125047245-125047267 CAAGCAATTGTGGCTCCTTTAGG + Intergenic
939842936 2:147210668-147210690 GAGGCAACTGTGAATCACTTAGG + Intergenic
940398271 2:153218725-153218747 GAGAAAAGTGTGGATCCCCTGGG - Intergenic
940868747 2:158842048-158842070 GAGCCAAGTCTGGATTCCTTGGG - Intronic
1168746252 20:244366-244388 GAGGCAAGTGTGAAAGCTTTAGG - Intergenic
1172639221 20:36431111-36431133 GAGGCAGGCGTGGGTCATTTGGG - Intronic
1173941541 20:46915094-46915116 GAGGCTGATGTGGCTCCTTTGGG - Intronic
1174192150 20:48748181-48748203 GAAGCAGGTGTGTATCTTTTTGG - Intronic
1175809395 20:61849608-61849630 GTGGCAGGTCTGGATCCTTGTGG + Intronic
1178795425 21:35739528-35739550 GTGTCCAGTGTGGTTCCTTTGGG + Intronic
1182900584 22:33895058-33895080 GAGGCAAGTGGGGGTGCTGTGGG + Intronic
1182928810 22:34153582-34153604 AAAGCAAGTGTGGATCCCTGTGG + Intergenic
1184011331 22:41750952-41750974 GAGGCAAGTGTAGATCTCTTGGG + Intronic
1184093695 22:42305406-42305428 GTGGCAAGTGTGGAGTGTTTGGG - Intronic
950523258 3:13508743-13508765 GAGGGAAGTGTGGCACCTGTGGG + Intergenic
952081301 3:29760579-29760601 GAGACAATAGTGGATCCTGTGGG + Intronic
952634364 3:35508683-35508705 GAGGCAAGCATACATCCTTTTGG + Intergenic
952992879 3:38847214-38847236 GAAGAAAGTGAGGACCCTTTGGG - Exonic
953857620 3:46512223-46512245 GAGCCAAGTGAGAATACTTTAGG - Intergenic
956624120 3:71249872-71249894 GAGGCAAGGGAGGATCCACTGGG - Intronic
958907807 3:99961215-99961237 GAGGCAAGTCCGGATCCCCTCGG - Intronic
961238802 3:125392049-125392071 GTGGCAAGTCTTCATCCTTTTGG - Intergenic
964108165 3:153061006-153061028 TAGGCAAGTGTTGAGCCATTTGG - Intergenic
964539530 3:157764147-157764169 GAGATAAATATGGATCCTTTTGG + Intergenic
974454940 4:62117224-62117246 GAGCCAAGTGTGGTTGTTTTGGG + Intergenic
975536845 4:75460075-75460097 GAACCAAGTGTGGCTTCTTTAGG - Intergenic
976160337 4:82191981-82192003 GAGGCAGGAGTGGATAATTTTGG - Intergenic
976460368 4:85303695-85303717 GAGGCAACTGTGGGATCTTTTGG + Intergenic
976990824 4:91363034-91363056 GAGGCAAATGAAGATCCCTTGGG - Intronic
982182347 4:152760555-152760577 GATGCAATTCTGGATCTTTTTGG + Intronic
982305702 4:153928454-153928476 GAGGAGAGTGTGGATCGATTGGG + Intergenic
982322655 4:154095927-154095949 GCAGCAAGTGTGAATCCTTGAGG + Intergenic
985767680 5:1788394-1788416 CAGGCACGTGTGGCTCCTGTGGG + Intergenic
986822509 5:11482935-11482957 ACGGCATGTGTGGAGCCTTTTGG + Intronic
997063812 5:130539450-130539472 GAGTGAAGTGTAGATCTTTTAGG - Intergenic
1002715680 5:181225232-181225254 GAGGCAAGTGCAGAGCATTTGGG - Intronic
1002939336 6:1702517-1702539 ATAGCAAGTGTGGATCTTTTTGG - Intronic
1003361970 6:5435634-5435656 GAGGCAAGTGTGTAGTATTTGGG - Intronic
1004049038 6:12055908-12055930 AAGGCTAGTGTGCATCATTTTGG + Intronic
1006537132 6:34708795-34708817 GGGGCATGAGTGGATCTTTTGGG + Intergenic
1009622324 6:66093915-66093937 GAGGCAAATGCAGATCCTCTTGG - Intergenic
1009990482 6:70837001-70837023 GAGCCCACTGTGGATCTTTTAGG + Exonic
1010149952 6:72719691-72719713 GAGGCAAGAGAGGAACCTATGGG - Intronic
1012291892 6:97466326-97466348 GAGGCCAGTGGGGCACCTTTTGG + Intergenic
1012978044 6:105801105-105801127 GAGTTCAGTCTGGATCCTTTAGG - Intergenic
1014164938 6:118213053-118213075 GAGGCAAGTTTGAATCCATCTGG + Intronic
1014525230 6:122494840-122494862 GGAGGAAGTGTGGATCCTCTGGG - Intronic
1019001374 6:168755801-168755823 GAGGCAAGTCTCAATCCCTTTGG - Intergenic
1019357106 7:586256-586278 GAGGCGAGTGAGGATCATTGGGG - Intronic
1020991790 7:15207034-15207056 TAAGAAAGTGTGCATCCTTTTGG + Intronic
1022356573 7:29620646-29620668 GAGGGGAGTCTTGATCCTTTGGG - Intergenic
1026607436 7:71827867-71827889 GAGGCAAGGGTGGGTCCATGTGG + Intronic
1031060047 7:117040814-117040836 GAGTTAATTGTGGACCCTTTTGG - Intronic
1033952706 7:146805045-146805067 GAGGCAAAAGTGGAGACTTTGGG + Intronic
1034245568 7:149641818-149641840 GAGGCCAAGGTGGATCCTTGAGG - Intergenic
1035516298 8:234852-234874 GAGGCAAGTATGGGTCGTTTAGG + Intronic
1039786936 8:40842139-40842161 GAAGCAAGTGTGGCTCCTGGGGG + Intronic
1040605328 8:48926075-48926097 GAGGCAAGTGAGCAACCTTCTGG + Intergenic
1041764672 8:61406053-61406075 GAGGGAAGTGTGAATTATTTAGG - Intronic
1042801190 8:72719661-72719683 GAGGAAAGTGTGGAACCTTCAGG - Intronic
1044316200 8:90751880-90751902 GTGGGAAGTGTGGATCCCCTGGG + Intronic
1050806267 9:9682532-9682554 AATGCAAGTGTGGGTCCTTATGG + Intronic
1051899101 9:22019314-22019336 GAGGCAAGAGTGGATTCTGTGGG + Intronic
1053070894 9:35101356-35101378 GAGGGAAGTCTGGATCCTCCTGG + Intronic
1053452263 9:38202953-38202975 GTGGCATGTGTGGAACCTCTGGG + Intergenic
1053510194 9:38681070-38681092 GAGGCCAGTGTGGTTTCTTTGGG - Intergenic
1055846424 9:80569024-80569046 GAGTAAATTGTGGATACTTTTGG + Intergenic
1059341866 9:113601818-113601840 GCTGCAGGTGTGGATTCTTTTGG - Intergenic
1060482344 9:124023980-124024002 GGGGCAAGTGGAGATCATTTGGG - Intronic
1186085797 X:5989238-5989260 GAGGCAAGTCTTAATCCTTAAGG - Intronic
1187522984 X:20029628-20029650 GAAGTAAGGGTGGATTCTTTGGG + Intronic
1187918938 X:24182362-24182384 GTGTCAAGTATGGCTCCTTTAGG + Intronic
1191195723 X:57720407-57720429 TAGGCAAGTTGGGATTCTTTAGG + Intergenic
1192245327 X:69367150-69367172 AAGCCAAGTGTGGGACCTTTCGG - Intergenic