ID: 927658846

View in Genome Browser
Species Human (GRCh38)
Location 2:24974583-24974605
Sequence CTGTTTGTAGAGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 404}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927658846_927658850 11 Left 927658846 2:24974583-24974605 CCCTCTTCCCTCTCTACAAACAG 0: 1
1: 0
2: 2
3: 30
4: 404
Right 927658850 2:24974617-24974639 TGAATGCTGCTTTAATTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927658846 Original CRISPR CTGTTTGTAGAGAGGGAAGA GGG (reversed) Intergenic
900650747 1:3729053-3729075 CTGTTGGTAGGGGAGGAAGAGGG + Intronic
901617517 1:10553539-10553561 CTCTCTGAAGAAAGGGAAGATGG + Intronic
902195916 1:14797977-14797999 CTCTTTGTACACTGGGAAGAAGG + Intronic
902545437 1:17186696-17186718 CTCCTTGCAGAGAGGGCAGAAGG + Intergenic
903433955 1:23332123-23332145 CTGAATGGAGAGAGGGGAGAGGG + Intronic
903825118 1:26139056-26139078 GTGTTTGTAGGGCGTGAAGAGGG - Intergenic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904124754 1:28230318-28230340 CTGTTTTCATAGAGTGAAGAGGG - Intronic
904621073 1:31775672-31775694 TTGGGTGTTGAGAGGGAAGATGG - Intergenic
904752917 1:32752279-32752301 CATTTTGCAGGGAGGGAAGAGGG + Intronic
904767174 1:32859157-32859179 GTTTTTGCAGAGGGGGAAGATGG + Intergenic
905400358 1:37697756-37697778 TTGTTTCTAGAGATGGCAGAAGG + Intronic
905655790 1:39685089-39685111 CTATTTGTATAGAGGAAAGAGGG - Intronic
906156443 1:43616859-43616881 AAGGTTGTAGAGAGAGAAGAGGG + Intronic
906751860 1:48270738-48270760 TTTTTTGTGGAGTGGGAAGATGG - Intergenic
906950426 1:50330860-50330882 CTGCCTGTAGAGGGGGAAAAGGG + Intergenic
906950443 1:50330969-50330991 TTTTTTATAGAGTGGGAAGACGG - Intergenic
907123675 1:52030619-52030641 CTGTTAAAAGAGAGGGTAGATGG - Intronic
907366627 1:53966201-53966223 GTGTTTATGGAGAGGGAAAAAGG + Intronic
907711731 1:56889330-56889352 CTGTTTGTCAAAAGGAAAGAAGG - Intronic
908065670 1:60401452-60401474 CTGCTTGTAGAGAGGAAAAGGGG - Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908975233 1:69888766-69888788 CTGTTTGGGGGTAGGGAAGATGG + Intronic
909379655 1:74984012-74984034 GAGGTAGTAGAGAGGGAAGATGG - Intergenic
910733880 1:90430031-90430053 CTGTTTGTAGAAATGTAAAATGG - Intergenic
911588354 1:99717094-99717116 CTGTTTGTAGAGGGAGATGTGGG - Intronic
912170340 1:107092105-107092127 CTGGTTGTAAAGACGGAAAAGGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912600122 1:110922328-110922350 CTGATATGAGAGAGGGAAGAAGG - Intergenic
913069930 1:115289653-115289675 TTGTATGCAGAGAAGGAAGATGG - Intronic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915349982 1:155218212-155218234 CTGTTTGGAGAGACTGAAGACGG + Intergenic
916667694 1:166981483-166981505 ATGTGTGTAGAGAGGGAGGGAGG + Intronic
917786089 1:178458768-178458790 CTGCTTGAAGAGAAGGAAGGGGG - Intronic
918007164 1:180552581-180552603 CTCTTTCTCTAGAGGGAAGATGG - Intergenic
919421812 1:197379081-197379103 TTGTTTGTGGATAGGAAAGATGG + Intronic
920421615 1:205838044-205838066 CTCATTGTAGAGCGGGGAGAAGG - Intronic
921067146 1:211631157-211631179 CTGTTGAAAGAGTGGGAAGAGGG + Intergenic
921286957 1:213617395-213617417 CTGGTTGTGGAGATGGAAGGAGG + Intergenic
921431130 1:215067427-215067449 CTCATTGTCAAGAGGGAAGAGGG + Intronic
921650792 1:217675152-217675174 AGGTTTGTAGAGAAGGAGGATGG + Intronic
921825936 1:219671953-219671975 CAGTTTGCATAGAGGGAAGCAGG - Intergenic
922138386 1:222855264-222855286 CTTTTTGTAGAAAGGAAAGCAGG + Intergenic
922367594 1:224880633-224880655 CTGTTTGCACACTGGGAAGATGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923466641 1:234253550-234253572 CTGTTAGTAGGATGGGAAGAGGG + Intronic
923588814 1:235300496-235300518 CTGTTTACAGATAGGGAAAATGG - Intronic
924840231 1:247702141-247702163 CTGTTTGAAAGGAGAGAAGAAGG + Intergenic
924953293 1:248905711-248905733 TTCTTTGTTGAGAGGGAAGGAGG - Intergenic
1063001855 10:1932235-1932257 CTATCTGTAGAGAGGGAGGGAGG + Intergenic
1063939321 10:11110627-11110649 CTGTTTGGTGAGTGGGGAGATGG + Intronic
1064977942 10:21137759-21137781 TTTTTTGTAGAGATGGCAGAGGG - Intronic
1065434886 10:25695598-25695620 GTGATTGGAGAGAGTGAAGATGG + Intergenic
1066812829 10:39363243-39363265 CTGTTTGTAGAATCTGAAGAGGG - Intergenic
1067517408 10:46963580-46963602 ATGTGTGTACAGAGGGATGAGGG + Intronic
1067644840 10:48088249-48088271 ATGTCTGTACAGAGGGATGAGGG - Intergenic
1068922967 10:62504361-62504383 AATTTTGTGGAGAGGGAAGAGGG - Intronic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069945223 10:71981084-71981106 CTGTTTTTTCAAAGGGAAGAAGG + Intronic
1070147577 10:73785888-73785910 ATGTTTGCAGAGTGGGAGGACGG + Exonic
1070972395 10:80578356-80578378 CTGTTTGTTGTGGGGGAGGAGGG + Intronic
1071791975 10:88964569-88964591 TTCTTGGTAGAGAGGGAAGGAGG + Intronic
1071842928 10:89491584-89491606 CTGTTTGTAGTGGGAGAAGGAGG - Intronic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1074735641 10:116429803-116429825 CTGCAGGTAGAGAAGGAAGATGG + Intronic
1074866548 10:117547276-117547298 CTGTTTAGAAGGAGGGAAGAGGG + Intronic
1075623734 10:123946983-123947005 GTCTTGGGAGAGAGGGAAGAGGG + Intergenic
1075626143 10:123965742-123965764 CTGTCTGTAGATGGGGAAGGAGG + Intergenic
1075900197 10:126036865-126036887 CTGTTTTTAGAAAGAGAGGAAGG - Intronic
1076570446 10:131429331-131429353 CTGTCTGGAGAGTGAGAAGAGGG - Intergenic
1077906870 11:6541098-6541120 CTGTGTGGAGAGAGGGAGGTGGG + Intronic
1079684444 11:23339956-23339978 CTGTTTCAAGAGAGAGAGGAAGG - Intergenic
1080787752 11:35491298-35491320 CAGTTTACAGAGAGGGAGGATGG - Intronic
1081230137 11:40576150-40576172 AGGTCTGTAGAGAGGGATGAAGG + Intronic
1081648716 11:44808484-44808506 GTGTTTCTAGAGTGGGAACATGG + Intronic
1081677466 11:44979302-44979324 CTTATTGTTGAGAGGGCAGAGGG + Intergenic
1082131056 11:48489803-48489825 TTCTTTGAAGAAAGGGAAGATGG - Intergenic
1082256916 11:50041990-50042012 CTGTGTGTAAAGAAGGAAAATGG + Intergenic
1083072914 11:60005175-60005197 CAATATGTGGAGAGGGAAGACGG + Intergenic
1084081709 11:66831149-66831171 CTGTTTGTGGAAATGGAAAATGG + Intronic
1084396272 11:68912741-68912763 CAGTTTGTAGACAAGGAAGCCGG + Intronic
1084406203 11:68975053-68975075 CAGATTGAAGACAGGGAAGAGGG + Intergenic
1084663516 11:70561703-70561725 CTTTTTGTAGAGATGGCAGGGGG + Intronic
1085168144 11:74423381-74423403 CTGGCTTTAGAGAGAGAAGAAGG + Intergenic
1085389242 11:76174060-76174082 TAGCTGGTAGAGAGGGAAGAGGG + Intergenic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1085737377 11:79050553-79050575 CTGCTTGTAAAGATGCAAGAGGG - Intronic
1086949531 11:92877353-92877375 CTGGTTGTGCAGAGGGAAGGTGG - Intronic
1087652119 11:100879942-100879964 CTGTGTGTTGAAAGGGATGAGGG - Intronic
1087852554 11:103049243-103049265 CTCTTTGGAGACAGGGAAAATGG - Intergenic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1088987079 11:114918572-114918594 CTCTTTGGAGAAGGGGAAGATGG + Intergenic
1089405866 11:118196816-118196838 GTGTTTCTAGAGGGGGAAAATGG + Exonic
1089679335 11:120110642-120110664 ATGATGGTAGAGAGGGAAGAGGG - Intergenic
1090299481 11:125623124-125623146 CTGTTTGTAGGGGGTGTAGATGG + Intronic
1091404901 12:203234-203256 TTTTTTGTAGAGACGGGAGAAGG + Intronic
1091602896 12:1928704-1928726 CTGTTTCCAGAGAGGGAACCGGG - Intergenic
1091642631 12:2249070-2249092 CTGTCAGTAGAGAGGTAAGGAGG + Intronic
1091935994 12:4434921-4434943 CTGTGTGTGGTGGGGGAAGAAGG + Intronic
1091993404 12:4974190-4974212 ATGTTTATAGAAATGGAAGAAGG - Intergenic
1092842637 12:12557918-12557940 GTGTATGGAGAGAGGGAAGTGGG - Intronic
1092847075 12:12593725-12593747 CTGTTTGTACAGAGTCATGATGG - Intergenic
1093334168 12:17880270-17880292 CTGTTGGTAGAAATGGAAAATGG + Intergenic
1093843519 12:23937034-23937056 CTGTTTGTCAAGAGCTAAGAAGG + Intronic
1095029710 12:37254665-37254687 CTTTTTGTGGAAAGTGAAGATGG - Intergenic
1096060706 12:48697130-48697152 CTTTTTTTAAAAAGGGAAGAAGG + Intronic
1096120538 12:49086510-49086532 CTGCTTGAAGAAAGGAAAGAAGG + Intergenic
1096862124 12:54536998-54537020 CTTGTTGTAGAGCGTGAAGAGGG - Exonic
1098019883 12:66143331-66143353 CTTCTTGTTGAGAGGGATGAGGG - Intronic
1098065520 12:66611918-66611940 CTTTTTGTAGAGAGAGAACATGG + Intronic
1099006184 12:77237149-77237171 CATTTTGTAGAGAAGGCAGAAGG - Intergenic
1099016437 12:77348942-77348964 CTGGTTTTAAAGATGGAAGAAGG - Intergenic
1100056632 12:90519578-90519600 ATGTATGTGGAGAGGGAGGATGG - Intergenic
1100447929 12:94678470-94678492 CTTTTTGCAGATAGAGAAGAGGG - Intergenic
1101018247 12:100524823-100524845 ATGTTTGTTGGGAGGGAAGATGG - Intronic
1101885792 12:108660559-108660581 CTGTTTGCCTATAGGGAAGAAGG - Intronic
1102282339 12:111628301-111628323 GCTTTTGTAGAGAGGGAATATGG + Intergenic
1103619255 12:122176308-122176330 CTGTTCCTAGAACGGGAAGAGGG + Intronic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1104628359 12:130378148-130378170 CTGCTTGCAAAGAGGCAAGATGG - Intergenic
1104711478 12:130989875-130989897 CTTTCTGTAGAGGAGGAAGAAGG + Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1105024993 12:132842250-132842272 CAGTCTGTGGAGAGGGAAGGTGG - Intronic
1105433210 13:20356390-20356412 CTGTTTGGAGGCAGGGAAGGAGG - Intergenic
1106402028 13:29440644-29440666 CAGATGGTCGAGAGGGAAGATGG - Intronic
1106509100 13:30397815-30397837 CTCCTTCTACAGAGGGAAGATGG + Intergenic
1106775234 13:33002401-33002423 CTGTTTGTAAAGATGGGAGGTGG - Intergenic
1107097191 13:36549673-36549695 CTGTTTGTAGGGAGAGGGGATGG - Intergenic
1107448964 13:40491630-40491652 ATGTTTGCAGGGAGGCAAGAAGG + Intergenic
1107825287 13:44323961-44323983 CAGCTTGCAAAGAGGGAAGAGGG - Intergenic
1107860893 13:44660146-44660168 CTGTGTGTAGACATGGGAGAGGG + Intergenic
1107900359 13:45006571-45006593 CTGTTTATAAAGTGGGGAGAGGG - Intronic
1111017019 13:82394468-82394490 GTGTTTGTCGAGTGGGAGGAAGG - Intergenic
1113404724 13:110027767-110027789 CTCTTTGTGGAGAGGAGAGAGGG + Intergenic
1114417006 14:22551658-22551680 CTGTTTGGAGAGGGAGAAGAGGG - Intergenic
1117118867 14:52547645-52547667 CTGTTTGGAGAGAGGAAGAATGG - Intronic
1117402040 14:55367346-55367368 GAGTTCGTAGAGAGTGAAGATGG - Exonic
1118108056 14:62682985-62683007 CTATCTGAAGAGACGGAAGATGG + Intergenic
1118475255 14:66110174-66110196 CTTTTTGTAGAGATGACAGATGG + Intergenic
1118659380 14:67990917-67990939 TTCTTTTTAGAGAGGGTAGAAGG + Intronic
1119203228 14:72774402-72774424 CTGTTGGTAGAAATGGAAAATGG - Intronic
1119228498 14:72961979-72962001 CTGTTAGAACAGAGGGAAGTGGG - Intergenic
1119326525 14:73762795-73762817 CAGTTTGTAAAGAGGGTTGAGGG - Intronic
1119576070 14:75723409-75723431 CTGTTTGAAGATGGGGATGAGGG + Intronic
1119689286 14:76658209-76658231 CTGTCTGTGGAGAGAGTAGAAGG + Intergenic
1121185580 14:91964875-91964897 CAGATTGCAGAGGGGGAAGAGGG - Intergenic
1121492271 14:94369089-94369111 CAGGTAGGAGAGAGGGAAGAGGG + Intergenic
1121702269 14:95963546-95963568 CAGTTTATACAGAGGGCAGATGG + Intergenic
1122180026 14:99948107-99948129 CTCTTTGAAGAGAAGAAAGAGGG + Intergenic
1126442774 15:48709384-48709406 TTTTTTGTAGAGATGGAAGCGGG + Intergenic
1126662753 15:51048555-51048577 CTCTTTGAAAAAAGGGAAGAAGG - Intergenic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127958355 15:63872193-63872215 CTGGCTGGGGAGAGGGAAGAAGG + Intergenic
1128479182 15:68022740-68022762 CTGTAAGGAGAGAGGGATGAGGG + Intergenic
1128498207 15:68210244-68210266 CGGTGTGTGGAGAGGGGAGAGGG - Intronic
1129022172 15:72530384-72530406 TTGTTAGTAGAGGGGGAAGTTGG + Intronic
1129091856 15:73159438-73159460 CTGTTAGTACAGTGGGCAGAAGG + Intronic
1130623604 15:85490158-85490180 TTGTTTAGAGAGAGGAAAGATGG + Intronic
1130717676 15:86351788-86351810 CAGCTTGTAGAGAAGGCAGAAGG - Intronic
1132040225 15:98518893-98518915 CTTTTTTTAGAAAGGGAAAAAGG + Intergenic
1132919299 16:2376631-2376653 CTCTCTGGAGAGAGGGATGAGGG - Intergenic
1132924422 16:2421123-2421145 CTGTTTGAATAGGGAGAAGAGGG + Intergenic
1133550371 16:6848615-6848637 ATGTGTGTAGAGAGAGATGATGG + Intronic
1133556493 16:6910898-6910920 CTGTTAGTAAAGAGGAAGGAGGG + Intronic
1134022348 16:10929838-10929860 CTGTTTATTGGGAGGGAGGAGGG + Exonic
1135524180 16:23201268-23201290 CAGTTTGAAAAGGGGGAAGAGGG - Intronic
1137590069 16:49687966-49687988 CTGTTTTTTGGGAGGGCAGATGG - Intronic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1139476050 16:67203096-67203118 CTGCGTGGAGAAAGGGAAGAGGG - Intronic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1139705215 16:68736766-68736788 CTTTTTGTAGAGAGACAAGTCGG - Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1140863204 16:79037339-79037361 CTTTTTGTAGAGAGGAAGAATGG + Intronic
1141581120 16:84999758-84999780 CTGTATCTTGAGAGGGAAGTGGG + Intronic
1142323303 16:89398961-89398983 CTGATGGGAGAGAGGGATGATGG - Intronic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1144443020 17:15301065-15301087 CTGTTTAGAGAGAGGGATGAGGG + Intergenic
1146531838 17:33614051-33614073 CTGTTGGTAGAAAGGCAAAATGG - Intronic
1147205587 17:38835186-38835208 CTGTTAGAACAGAGGGAAGTGGG + Exonic
1148259982 17:46173218-46173240 GTGGTTGTTGAGAGAGAAGAGGG - Intronic
1149083866 17:52691016-52691038 CTGTTTGGAGGTAGGGAAGGAGG + Intergenic
1149243789 17:54681845-54681867 ATGTTTGAAGAGTGGGATGAAGG - Intergenic
1150059989 17:62059363-62059385 TTCTTGGTAGTGAGGGAAGAGGG - Intronic
1150125160 17:62630468-62630490 CTGTCTGGAGAGAGGCAGGAAGG + Intronic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1153743423 18:8152283-8152305 GTTTTTGTAGAGTGAGAAGAAGG + Intronic
1155053721 18:22168548-22168570 CTGTTTGGAGGGAGCGAAGAGGG + Intergenic
1155080787 18:22407942-22407964 ATGTTTGTAAACAGGGCAGAGGG - Intergenic
1156054555 18:32983402-32983424 GTGTTTGTAGATAGGAAATACGG - Intronic
1156474703 18:37398137-37398159 CTGTTGGGAGAGAGTGAAGGAGG + Intronic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1158267731 18:55678640-55678662 CTTTTTATAGATAAGGAAGAGGG - Intergenic
1158722745 18:59940244-59940266 TTGTATGTAGAGAAGGAATAAGG - Intergenic
1159953037 18:74498825-74498847 GTGTTTGAAGAGGAGGAAGAGGG + Intronic
1160191837 18:76721338-76721360 CTGTTTGTGGGGAGGAAAGGAGG - Intergenic
1160451455 18:78969235-78969257 CTGTCTATAGAGAGGGGATAAGG - Intergenic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161783213 19:6307285-6307307 CTGGTCCTAGAGAGGGGAGAGGG + Exonic
1163541801 19:17915900-17915922 CTTTCTCTGGAGAGGGAAGAGGG - Intergenic
1164157027 19:22603198-22603220 ATCTTTGGAGAGAGGGAGGAGGG - Intergenic
1164411681 19:28011387-28011409 TTGTGTGTAGAGAGGAATGAAGG + Intergenic
1164580667 19:29433099-29433121 CTCTTTGGAGAGAGGGATGGGGG - Intergenic
1165283769 19:34820148-34820170 CACTTTGCAGAGTGGGAAGAAGG + Intergenic
1165361290 19:35338451-35338473 CTGGTTCTAGGGAGAGAAGATGG + Intronic
1166767207 19:45258830-45258852 CTTTTTGTAGAGAAAGATGAAGG + Intronic
1167597005 19:50433042-50433064 CTGTTTGTAGGGTTGGGAGAAGG + Intronic
924998782 2:387068-387090 CTGTTTGGAGAAAGTGAAGGGGG - Intergenic
925516987 2:4693501-4693523 CTGCGTGGGGAGAGGGAAGACGG + Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927715913 2:25352734-25352756 CTGCTTCTCCAGAGGGAAGAGGG + Intergenic
927999153 2:27507771-27507793 CTGGATGGTGAGAGGGAAGATGG + Exonic
928451180 2:31379924-31379946 CTTTCTGTAGCCAGGGAAGAAGG + Exonic
928535122 2:32232666-32232688 ATGTTTGCAGGGATGGAAGATGG + Intronic
929473904 2:42225703-42225725 CTATCTGCAGGGAGGGAAGAAGG - Intronic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
931314231 2:61112142-61112164 CTGCTTGTAGAGATGCAAAACGG - Intronic
931771934 2:65504914-65504936 CTGGTTGCAGTGAGGGAAAATGG - Intergenic
934545348 2:95209808-95209830 TTGTTTGTACAGAACGAAGATGG + Intronic
936401759 2:112169936-112169958 CTGTTTTAAGAAAAGGAAGAAGG + Intronic
937081815 2:119145626-119145648 CTGTTTGGAGAAAGCGAAGAAGG + Intergenic
937249824 2:120516311-120516333 CTGTTTATACAGTGGGAATAGGG - Intergenic
939004199 2:136766363-136766385 CTGTTTGTGGAGAGGAAACTGGG + Intronic
939548797 2:143588020-143588042 CTGTTTGGAAAGAAGGAAGAGGG - Intronic
939796371 2:146649815-146649837 TTGTTTATAGAGAGAGAAAAAGG + Intergenic
939915815 2:148041779-148041801 GTTTTTGGAGAGAGGAAAGATGG - Intronic
940279819 2:151977580-151977602 TTGTTTGGACAGAGAGAAGAAGG + Intronic
940321811 2:152385326-152385348 CAGTTTGTAGGGAGGGAGGCTGG + Intronic
941173416 2:162167477-162167499 CTGTTTGTAAAGAAGAAAGGAGG - Intergenic
942344667 2:174989909-174989931 CTGTTTGTACCAGGGGAAGAAGG - Intronic
942766946 2:179468650-179468672 CTGAATCTAGAGAGGAAAGAGGG - Intronic
942803053 2:179898231-179898253 CTGTTTGGAAAGAGTGAAAATGG - Intergenic
942961039 2:181829937-181829959 CTGTTGGGAGAGAAGGAGGAGGG - Intergenic
943366251 2:186970135-186970157 CTTTTTGTCTAGAGGGAAAAGGG - Intergenic
944194875 2:197041780-197041802 ATTTTTGAAGAGAGGTAAGATGG - Intronic
945250984 2:207766844-207766866 CGACTTGGAGAGAGGGAAGAGGG - Exonic
946145199 2:217725374-217725396 CTGTTTGCTGAGCTGGAAGAGGG - Intronic
947175557 2:227363484-227363506 CTGTGTGTAGAGAAAGGAGAAGG - Exonic
947544693 2:231002554-231002576 GAGTTTGGAGAGGGGGAAGATGG + Intronic
948343936 2:237279481-237279503 CAGTTTATAGAGAGGCTAGAAGG + Intergenic
948909791 2:240997311-240997333 CTGTTTGCAGAGAGGCAAACTGG - Intergenic
948952862 2:241265814-241265836 CCCTTTCTAGAGAGGGAAGACGG - Intronic
1168761871 20:354830-354852 CTGTTTATTGAAAGGGAAGGTGG - Exonic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169934109 20:10864685-10864707 CTGTTTCTAGAGGGGCATGAAGG + Intergenic
1170346477 20:15392564-15392586 CTGTTGGTAAAGAGGCATGATGG - Intronic
1172580186 20:36041351-36041373 CTGTTTGGAGGGAGGGGAGCAGG - Intergenic
1173033813 20:39389352-39389374 CTGTCTAGAGAGAGAGAAGAAGG - Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173749563 20:45466793-45466815 CTAGTTGCAGAGAGGGAGGATGG + Intergenic
1174392913 20:50228904-50228926 CTGGTTGGATAGAGGGAAAAAGG - Intergenic
1174443502 20:50575010-50575032 GAGTCTGAAGAGAGGGAAGAAGG + Intronic
1176524025 21:7851673-7851695 CTGGCTGTAGAGGGGAAAGAAGG + Intergenic
1177022211 21:15876042-15876064 CTGTTGGGTGAGTGGGAAGAAGG + Intronic
1178424760 21:32470564-32470586 GTGTTATCAGAGAGGGAAGATGG - Intronic
1178658045 21:34481686-34481708 CTGGCTGTAGAGGGGAAAGAAGG + Intergenic
1179711995 21:43268810-43268832 CGGGTTGGGGAGAGGGAAGACGG + Intergenic
1179977561 21:44877748-44877770 CTGTTTTTAGAGAGCGTATAAGG - Intergenic
1181902996 22:26170512-26170534 GTGTTTGTTGAAGGGGAAGAGGG + Intronic
1182176560 22:28295630-28295652 CTGTCTGCAGAGTGGAAAGAAGG - Intronic
1182819562 22:33203578-33203600 TTGTTTATAGTGAGGGGAGAGGG + Intronic
1183044434 22:35208371-35208393 CCCTTTGTAGAGAGGGACCAAGG + Intergenic
1183232435 22:36591371-36591393 GTTCTAGTAGAGAGGGAAGAAGG + Intronic
1183733906 22:39632960-39632982 AGTTTTGTGGAGAGGGAAGATGG + Intronic
1183785856 22:40028735-40028757 CTGCCTGTAGGGAGGGAAGGGGG - Intronic
1184162350 22:42704541-42704563 CTGTTTGTAAGAAGGGCAGAAGG + Intronic
1184815018 22:46862614-46862636 CTGTTTGGAGACAGGGTAGGAGG + Intronic
1185089342 22:48757124-48757146 CTCTTTGGAGAGAGGCAAGGAGG + Intronic
949170830 3:994471-994493 CTTATTGTAGAGAGAGGAGAAGG + Intergenic
950400409 3:12765494-12765516 CCGTTTGAAGAGAGACAAGAAGG + Intronic
950500681 3:13361677-13361699 CTGTTTGAAGGGAGAGTAGATGG - Intronic
951906055 3:27708559-27708581 GTTTTTGTTGAGAGGGAAAAAGG + Intergenic
952255302 3:31690000-31690022 AGGTTGGCAGAGAGGGAAGAAGG + Intronic
952995755 3:38880605-38880627 CTGTTTGTAGGGATAGATGAGGG - Intronic
954159000 3:48706512-48706534 CTGTCTGTAGAGAGAACAGAAGG - Intronic
954195947 3:48997322-48997344 CTATGTGTTGAGTGGGAAGATGG - Intronic
956040504 3:65140234-65140256 TTGTTTGTGGAGAGGGAGGAAGG + Intergenic
957055576 3:75440204-75440226 ATTTTTGTAGAGATGGAAGGTGG + Intergenic
958795547 3:98703050-98703072 GTGGTTGTAGTGAGGCAAGATGG - Intergenic
959116134 3:102180840-102180862 TTGTTTGTGGAGTGGGTAGAGGG - Intronic
959264436 3:104119618-104119640 CTGTGTGTGGAGTGGGGAGAGGG - Intergenic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
959829933 3:110848922-110848944 CTGTTAGTAGAGAGGGGAAGGGG - Intergenic
960945220 3:122961728-122961750 CTCTTTGTAGAGAGAGAGGCAGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
963430287 3:145192643-145192665 CTGGTGGTAGAGATGGGAGAGGG - Intergenic
963704148 3:148665071-148665093 CTGTCTGGTGAGAGGGGAGAAGG - Intergenic
964130249 3:153279009-153279031 CAGTTTCAAGAGAGGGAGGAGGG - Intergenic
967724316 3:192847339-192847361 TTGTTTTTAGGGAGGGAATAAGG - Intronic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
969222774 4:5772316-5772338 CTCTTTGCAGGGAGGTAAGATGG - Intronic
970289013 4:14551513-14551535 TTGTTTGTAGCAAGGGAAGAAGG - Intergenic
970313197 4:14804390-14804412 CTGATTGTAAAGAGGGCAAAAGG + Intergenic
972940516 4:44189588-44189610 ATGTTTGTAGAAAGAGAAAATGG - Intronic
974081284 4:57215928-57215950 GTGACTGTAGAGATGGAAGAGGG - Intergenic
974351797 4:60757316-60757338 CTGTTGGTAGAAAGGTAAAATGG + Intergenic
974424886 4:61729046-61729068 ATATTTGTAGAGAGGGAGGGAGG + Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976416083 4:84777048-84777070 CTGTTTATACACAGGGAAGAAGG + Intronic
976697184 4:87929608-87929630 TTATGTGTAGAGAAGGAAGAGGG + Intergenic
977041091 4:92020035-92020057 CTGTTCTTAAATAGGGAAGAAGG - Intergenic
977544848 4:98365442-98365464 TTTTTTGTAGAGAGGGGATAGGG - Intronic
979361818 4:119774116-119774138 CTCCTTGGAGAGAGGGAAGGGGG + Intergenic
982951497 4:161702811-161702833 TTGTTTTTTGAGTGGGAAGAGGG - Intronic
983506853 4:168562692-168562714 ATGTTTGAAGAGAGGGAAGGAGG + Intronic
983557348 4:169070270-169070292 TTCCTTGTAGAGAGGGGAGAGGG - Intergenic
983693224 4:170497913-170497935 CTGTTTCTAGATAGGAAATAGGG + Intergenic
984298223 4:177881289-177881311 CAGTTTGTGGAGGGGGAAGCAGG + Intronic
985553698 5:545916-545938 CTCTTTGTGGAGGGGGAAGAGGG + Intergenic
985909133 5:2865244-2865266 TTGTTTGTAGAGAGAAAACAGGG - Intergenic
985969002 5:3360666-3360688 CTGTTTGTGAAGACGGAGGAAGG + Intergenic
988636882 5:32994539-32994561 GTGTGTGTAGAGAGGGAGGTAGG - Intergenic
989209701 5:38846533-38846555 GTGTTGGGAGAGAGGAAAGAGGG - Intronic
989295553 5:39821623-39821645 CTGTTTGTGACTAGGGAAGATGG + Intergenic
990919029 5:60942612-60942634 TAGTTTCTAGAGAAGGAAGAGGG + Intronic
993520373 5:88892167-88892189 GTGCTTGTAGACATGGAAGAAGG + Intronic
993552199 5:89287282-89287304 CAGTATGAAGAGAGAGAAGATGG + Intergenic
993776395 5:92003499-92003521 CTATTTGTAGAGAGGAAGGAAGG + Intergenic
995505414 5:112855275-112855297 GTGTTTGAAGAAAAGGAAGATGG - Intronic
995751017 5:115453377-115453399 CTGTTAGGAGAGAGGGGAGCTGG + Intergenic
996021534 5:118595948-118595970 CTGTGTGAAGACAGGGAACATGG - Intergenic
996551273 5:124732942-124732964 CTGTATAGAGGGAGGGAAGAAGG - Intronic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
997447971 5:133955678-133955700 CTTTATGTAGAGCTGGAAGAAGG - Exonic
997619557 5:135276937-135276959 CTGTTTGGAAAGATGGCAGATGG - Intronic
997639207 5:135437586-135437608 CTGTTTCAGGGGAGGGAAGAGGG - Intergenic
997771921 5:136563027-136563049 CTGCTTGAAGATAGGGAAGATGG + Intergenic
999401407 5:151267178-151267200 CTGTTTTGAGAATGGGAAGAGGG + Intronic
1000018280 5:157297479-157297501 CTGTTTGTAAAGAGCCAAGTAGG + Intronic
1000337335 5:160251595-160251617 CTGATTTGAGAGAGGGAAGGAGG + Intergenic
1000362701 5:160462718-160462740 GAGTTTGTAGAGGGGGAAGCAGG + Intergenic
1000840502 5:166212111-166212133 CTGTTGGTAGAGTGGGGAGGTGG - Intergenic
1001217661 5:169870990-169871012 CTGTCTGTAGACCAGGAAGAGGG - Intronic
1002160368 5:177311223-177311245 GTGTTTGGAGAGTGGGGAGATGG + Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002448197 5:179302872-179302894 ATGTTTGAGGAAAGGGAAGAAGG + Intronic
1002809847 6:616916-616938 TTTTTAGTAGAGAGGGAGGAGGG + Intronic
1003393672 6:5734544-5734566 CTCTCTGTAGAGAGGGAGCAAGG + Intronic
1004141968 6:13026546-13026568 TGGCTTGTAGAGAGGGAGGAAGG + Intronic
1004484958 6:16057711-16057733 CTGTTTGACGAGATGGAAGGAGG - Intergenic
1005030240 6:21501481-21501503 CTGTATGCAAAGAAGGAAGATGG - Intergenic
1006354624 6:33547741-33547763 CTGTTTGTGGACAAGGAAAAGGG + Intergenic
1006846914 6:37068792-37068814 CGATTTTTATAGAGGGAAGATGG - Intergenic
1007098160 6:39227277-39227299 CTTTGTTTAGAGGGGGAAGAGGG - Intronic
1007236999 6:40397718-40397740 CTAGTTGTAAAGAGGCAAGAGGG + Intronic
1007518252 6:42430376-42430398 CTTTTTGGAGTGAGGGAAGATGG - Intronic
1007562484 6:42821506-42821528 CTGCATTTAGAGAGAGAAGAGGG - Intronic
1007819484 6:44550518-44550540 TTGTTTTGGGAGAGGGAAGACGG - Intergenic
1008447773 6:51613038-51613060 CTGTTTGTGAACAAGGAAGAGGG - Intergenic
1008535067 6:52501274-52501296 CTTATCGTAGAGAGGGATGAAGG + Exonic
1009796766 6:68479432-68479454 TTTTTGGTAGAGAGGGCAGATGG - Intergenic
1010356019 6:74934601-74934623 CTGTTTTGAGATAGGGGAGAGGG + Intergenic
1011045434 6:83076662-83076684 CTGTTGGTAGAGATGTAAAATGG + Intronic
1011339274 6:86294755-86294777 CTGTGTGTAGAGAAGTCAGAAGG - Intergenic
1012096640 6:94970862-94970884 GTGTATGTGGAGAAGGAAGAGGG + Intergenic
1012939266 6:105400434-105400456 TTGTTTGTAGGGTGGCAAGAAGG - Intronic
1013420521 6:109962589-109962611 CTGTGTTCAGAGAGGAAAGAGGG + Intergenic
1013565394 6:111354629-111354651 ATGTTTTTAGAGAGGAAAAATGG - Intronic
1014808608 6:125859962-125859984 TTGTTTTTTGAGAGGGAAGTAGG + Intronic
1014827838 6:126066469-126066491 ATGTATGTCGAGAGGGAAGATGG + Intergenic
1014997321 6:128165332-128165354 CTGTATGTAAAGAGGAAAAAGGG - Intronic
1015301825 6:131661319-131661341 CTGTTGGTAGAAAGGCAAAACGG - Intronic
1016993132 6:149943051-149943073 CTCTTTCTAGAAAGGGAGGAAGG + Intronic
1017240438 6:152162377-152162399 ATGATGGTAGAGAGGGAAAAAGG - Intronic
1017341604 6:153330656-153330678 CTGTATGTTCAGATGGAAGATGG + Intergenic
1017869468 6:158474555-158474577 CTTTTTGAAGAGAGGGAGCAGGG - Intronic
1017986968 6:159452602-159452624 CTGTTTGTTGACTGGGGAGATGG + Intergenic
1018625512 6:165774670-165774692 CTGCTTCTGGAGAGGGAGGAAGG + Intronic
1020999493 7:15310970-15310992 GTGTTTTTAGAAATGGAAGAGGG - Intronic
1022142864 7:27508379-27508401 CTCTTTGAAGAGAGGTAAGGGGG + Intergenic
1022470001 7:30676296-30676318 CTGCTGGGAGAGAGGGAAGGTGG - Intronic
1027301257 7:76838701-76838723 CTGTATGTAGAGAGATATGAAGG + Intergenic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1030105536 7:105983903-105983925 CTGTTTGAGGTGGGGGAAGAAGG - Intronic
1030209992 7:106986657-106986679 CTCTTTGCAGGCAGGGAAGATGG + Intergenic
1035812072 8:2500873-2500895 CTGTTAGTAGAAAGGGGAGCTGG - Intergenic
1035931702 8:3786792-3786814 CAGGTGGTAGAGAGAGAAGAAGG + Intronic
1035990859 8:4488801-4488823 CTCTTTGCAGAGAGGAAATATGG - Intronic
1037012317 8:13858968-13858990 TTGTTTGGAGAGAGGAAAGGAGG - Intergenic
1038197264 8:25379814-25379836 TTGTTTGTGGAGATGGAAAAAGG - Intronic
1038286008 8:26207026-26207048 CTGTCAGTAGAGAGGGGAGCTGG - Intergenic
1038525674 8:28271077-28271099 TTGTCTCTAGAGAGGGAGGAAGG - Intergenic
1040544757 8:48390217-48390239 CAGTTTCTAGACAGGAAAGAAGG + Intergenic
1041592533 8:59605692-59605714 GTGTAAGAAGAGAGGGAAGAAGG + Intergenic
1043174419 8:77006374-77006396 CTGGTTGTTGAGAGCGAAGTTGG + Intergenic
1046578655 8:116064364-116064386 TTGTTTGGAGTAAGGGAAGAAGG + Intergenic
1047343004 8:124000901-124000923 ATCTTTATAGAGAGGGCAGAGGG + Intronic
1047979393 8:130164606-130164628 CTGTTTTTAGAGTTGGAAGTAGG - Intronic
1048033454 8:130654431-130654453 CTGTTTGTAGTGAGGGATGCTGG + Intergenic
1048505429 8:135016452-135016474 ATGTTTGTAGTGAGGGTATATGG - Intergenic
1049012933 8:139899662-139899684 CAGCTTGCAGAGAAGGAAGATGG - Intronic
1049027366 8:140003734-140003756 CTGCTAGTAGAGATGGAAAATGG + Intronic
1049416138 8:142496225-142496247 CTGGATGTAGAGATGGTAGATGG + Intronic
1050719384 9:8568322-8568344 CTGTTAGTAGAGAGGGAGGGAGG - Intronic
1050858827 9:10397447-10397469 TTGTTTTTGGAGAGGGAACAAGG + Intronic
1050866935 9:10512650-10512672 CAATTTGTTGAGAGGGAAGGAGG + Intronic
1051195390 9:14558365-14558387 GTATTTGTAGAGATGGAAGGTGG + Intergenic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051467660 9:17398915-17398937 TTTTTGGCAGAGAGGGAAGAAGG - Intronic
1052502848 9:29314876-29314898 CAGTTTGTAGAGGTGGAAGAAGG - Intergenic
1055568126 9:77589553-77589575 GTGTTTGTTGAAAGGGGAGAGGG + Intronic
1058317462 9:103586536-103586558 CTGTTAGCAGAGAGGGGAGCTGG - Intergenic
1058747094 9:108002374-108002396 CTCTCTGTAAAGAGGGAAAATGG - Intergenic
1059094284 9:111395836-111395858 CAGTTTGTATAGAAGGAAGGAGG - Intronic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059435996 9:114276669-114276691 CTGTTTGTTGATTGAGAAGACGG + Intronic
1059511871 9:114855672-114855694 CATTTTGCAGAGAAGGAAGAAGG + Intergenic
1060647024 9:125289597-125289619 CTTTTTGTGGGGAGGGAAGCAGG + Intronic
1061947390 9:133916382-133916404 CTCTTTGTAGAAAGGGAAGGTGG + Intronic
1185808093 X:3078974-3078996 ATGTTTGTAGAGACGGAAAGTGG - Intronic
1185840313 X:3383445-3383467 CTATTTGCAGAGAAGGAAGGTGG - Intergenic
1186554700 X:10545547-10545569 ATGATTGTAGAGTGGGAAAAGGG - Intronic
1186706100 X:12140176-12140198 ATGTTAGTAGAAAGGGAAGGTGG - Intronic
1188335446 X:28926746-28926768 AGGTTTGAAGAGAGAGAAGAAGG - Intronic
1188660600 X:32753099-32753121 CTTGTTGTGGAGAAGGAAGAGGG - Intronic
1190378170 X:49811644-49811666 CTGGTTGTAGGGAGGGGAGCAGG + Intergenic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1195345715 X:103949130-103949152 CTGTTTGTAGAATAGCAAGAAGG + Intronic
1197163456 X:123349582-123349604 CTTTTTGTAAAGAAGGAAAACGG - Intronic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198237826 X:134752250-134752272 TTTTTTTTAGAGAGGGAAGTGGG + Intronic
1198380321 X:136077628-136077650 CAGTTCTTAGAGAGGGAAGTGGG - Intergenic
1198847551 X:140928956-140928978 CAGTTTGTACTGAGTGAAGATGG - Intergenic
1199684618 X:150255141-150255163 CTGTCTCTGGAGAGGGAAAAGGG - Intergenic
1199734171 X:150668514-150668536 TTTTTTGTAGAGATGGAGGAGGG - Intronic
1199895817 X:152127290-152127312 GGGTATGGAGAGAGGGAAGAGGG - Intergenic
1200162361 X:154016094-154016116 CTACCTGGAGAGAGGGAAGAGGG + Exonic
1201711463 Y:16997521-16997543 ATGTTTGTAGAGAGGAAGGATGG + Intergenic
1202257275 Y:22934767-22934789 GTCTTTGTAAAGAAGGAAGAAGG + Intergenic
1202410266 Y:24568514-24568536 GTCTTTGTAAAGAAGGAAGAAGG + Intergenic
1202460516 Y:25101558-25101580 GTCTTTGTAAAGAAGGAAGAAGG - Intergenic