ID: 927660433

View in Genome Browser
Species Human (GRCh38)
Location 2:24988676-24988698
Sequence GACGGCTCTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927660429_927660433 11 Left 927660429 2:24988642-24988664 CCATCTTCTGCAGATAAATACTC No data
Right 927660433 2:24988676-24988698 GACGGCTCTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927660433 Original CRISPR GACGGCTCTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr