ID: 927662038

View in Genome Browser
Species Human (GRCh38)
Location 2:25001418-25001440
Sequence CAGGTGTCCCGGTTCTCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927662038_927662042 -7 Left 927662038 2:25001418-25001440 CCGTGTGAGAACCGGGACACCTG No data
Right 927662042 2:25001434-25001456 ACACCTGTCCTGTTGAAAAGGGG No data
927662038_927662048 27 Left 927662038 2:25001418-25001440 CCGTGTGAGAACCGGGACACCTG No data
Right 927662048 2:25001468-25001490 TGAAAATGCCCGGAAGGATATGG No data
927662038_927662040 -9 Left 927662038 2:25001418-25001440 CCGTGTGAGAACCGGGACACCTG No data
Right 927662040 2:25001432-25001454 GGACACCTGTCCTGTTGAAAAGG No data
927662038_927662047 21 Left 927662038 2:25001418-25001440 CCGTGTGAGAACCGGGACACCTG No data
Right 927662047 2:25001462-25001484 AAAAGCTGAAAATGCCCGGAAGG No data
927662038_927662046 17 Left 927662038 2:25001418-25001440 CCGTGTGAGAACCGGGACACCTG No data
Right 927662046 2:25001458-25001480 ACGCAAAAGCTGAAAATGCCCGG No data
927662038_927662043 -6 Left 927662038 2:25001418-25001440 CCGTGTGAGAACCGGGACACCTG No data
Right 927662043 2:25001435-25001457 CACCTGTCCTGTTGAAAAGGGGG No data
927662038_927662041 -8 Left 927662038 2:25001418-25001440 CCGTGTGAGAACCGGGACACCTG No data
Right 927662041 2:25001433-25001455 GACACCTGTCCTGTTGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927662038 Original CRISPR CAGGTGTCCCGGTTCTCACA CGG (reversed) Intergenic
No off target data available for this crispr