ID: 927662043

View in Genome Browser
Species Human (GRCh38)
Location 2:25001435-25001457
Sequence CACCTGTCCTGTTGAAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927662035_927662043 20 Left 927662035 2:25001392-25001414 CCTTTCTTATCTTTTCAACTTAG No data
Right 927662043 2:25001435-25001457 CACCTGTCCTGTTGAAAAGGGGG No data
927662038_927662043 -6 Left 927662038 2:25001418-25001440 CCGTGTGAGAACCGGGACACCTG No data
Right 927662043 2:25001435-25001457 CACCTGTCCTGTTGAAAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927662043 Original CRISPR CACCTGTCCTGTTGAAAAGG GGG Intergenic
No off target data available for this crispr