ID: 927662047

View in Genome Browser
Species Human (GRCh38)
Location 2:25001462-25001484
Sequence AAAAGCTGAAAATGCCCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927662038_927662047 21 Left 927662038 2:25001418-25001440 CCGTGTGAGAACCGGGACACCTG No data
Right 927662047 2:25001462-25001484 AAAAGCTGAAAATGCCCGGAAGG No data
927662039_927662047 10 Left 927662039 2:25001429-25001451 CCGGGACACCTGTCCTGTTGAAA No data
Right 927662047 2:25001462-25001484 AAAAGCTGAAAATGCCCGGAAGG No data
927662045_927662047 -3 Left 927662045 2:25001442-25001464 CCTGTTGAAAAGGGGGACGCAAA No data
Right 927662047 2:25001462-25001484 AAAAGCTGAAAATGCCCGGAAGG No data
927662044_927662047 2 Left 927662044 2:25001437-25001459 CCTGTCCTGTTGAAAAGGGGGAC No data
Right 927662047 2:25001462-25001484 AAAAGCTGAAAATGCCCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927662047 Original CRISPR AAAAGCTGAAAATGCCCGGA AGG Intergenic
No off target data available for this crispr