ID: 927662624

View in Genome Browser
Species Human (GRCh38)
Location 2:25005754-25005776
Sequence GCAGTATTTTGGGCCGGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927662619_927662624 8 Left 927662619 2:25005723-25005745 CCTCTAAACATAGGAAAGGCATA No data
Right 927662624 2:25005754-25005776 GCAGTATTTTGGGCCGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927662624 Original CRISPR GCAGTATTTTGGGCCGGGTG CGG Intergenic
No off target data available for this crispr