ID: 927662624 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:25005754-25005776 |
| Sequence | GCAGTATTTTGGGCCGGGTG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 927662619_927662624 | 8 | Left | 927662619 | 2:25005723-25005745 | CCTCTAAACATAGGAAAGGCATA | No data | ||
| Right | 927662624 | 2:25005754-25005776 | GCAGTATTTTGGGCCGGGTGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 927662624 | Original CRISPR | GCAGTATTTTGGGCCGGGTG CGG | Intergenic | ||
| No off target data available for this crispr | |||||