ID: 927664624

View in Genome Browser
Species Human (GRCh38)
Location 2:25022030-25022052
Sequence TTGCTTCCCTAACCAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927664618_927664624 26 Left 927664618 2:25021981-25022003 CCCTTTCCCACTGGGTTACTTTT No data
Right 927664624 2:25022030-25022052 TTGCTTCCCTAACCAGAGGGAGG No data
927664619_927664624 25 Left 927664619 2:25021982-25022004 CCTTTCCCACTGGGTTACTTTTA No data
Right 927664624 2:25022030-25022052 TTGCTTCCCTAACCAGAGGGAGG No data
927664620_927664624 20 Left 927664620 2:25021987-25022009 CCCACTGGGTTACTTTTAGTGAA No data
Right 927664624 2:25022030-25022052 TTGCTTCCCTAACCAGAGGGAGG No data
927664621_927664624 19 Left 927664621 2:25021988-25022010 CCACTGGGTTACTTTTAGTGAAA No data
Right 927664624 2:25022030-25022052 TTGCTTCCCTAACCAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927664624 Original CRISPR TTGCTTCCCTAACCAGAGGG AGG Intergenic