ID: 927667116

View in Genome Browser
Species Human (GRCh38)
Location 2:25040689-25040711
Sequence CTGCAGGACTGTTGGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927667116_927667124 7 Left 927667116 2:25040689-25040711 CCAGTTTCCCAACAGTCCTGCAG 0: 1
1: 0
2: 3
3: 15
4: 227
Right 927667124 2:25040719-25040741 GGGTTGAGAGAGTAGATCATTGG 0: 1
1: 0
2: 0
3: 12
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927667116 Original CRISPR CTGCAGGACTGTTGGGAAAC TGG (reversed) Intergenic
900963570 1:5941888-5941910 CTGCAGGTCTGTGGGAAAGCTGG + Intronic
901586378 1:10297262-10297284 CTGCTAAACTGTTGGGAAAAGGG + Intronic
903320362 1:22539314-22539336 TTGCAGGACTGGGGGGAAGCTGG - Intergenic
903426852 1:23259973-23259995 CTGAAGGACTGTGGGGAACAGGG + Intergenic
904565218 1:31424708-31424730 CTGCAGGACGGTGGGGATCCCGG - Exonic
905404504 1:37723813-37723835 GTGCTGTACTGTTGGGACACGGG + Intronic
908409312 1:63847032-63847054 CTGCAGGGCTGTGGGGACAGAGG - Intronic
910051719 1:82982085-82982107 CTGTAGCACTGCTGGGAAATAGG + Intergenic
911039473 1:93580232-93580254 CTGCAGGAGTGTTCTGAGACTGG + Intronic
912972147 1:114293672-114293694 CTGGAGGAAGGCTGGGAAACTGG - Intergenic
917451338 1:175150181-175150203 GAGGAGGACTTTTGGGAAACAGG + Intergenic
920438960 1:205965804-205965826 GTGGAGGGCTGTTGGGAAAGGGG + Intergenic
922818961 1:228470994-228471016 GTGCAGGAGTGTTGGGATGCTGG - Intergenic
923134893 1:231109101-231109123 TTGAAGGACTGTGAGGAAACAGG + Intergenic
1066459509 10:35600962-35600984 CTCCAGGGCTGGTGGGAAAAGGG - Intergenic
1066994624 10:42552499-42552521 CGGCAGGACCGTGCGGAAACGGG - Intergenic
1068735226 10:60406605-60406627 CTGTAGGCCTGTTAGGAACCAGG - Intronic
1070274993 10:74997376-74997398 ATGCAGGACTCTTAGGAAAGGGG - Intronic
1074470218 10:113720067-113720089 CTGCTAGACTTTTGGCAAACTGG + Intronic
1076523012 10:131092858-131092880 CTGCAGGACTGTGGGGAAGCAGG - Exonic
1077056416 11:596021-596043 GTGCAGGACTCTTGGGAGAATGG + Intronic
1077733725 11:4765476-4765498 CTGCTTGTCTGTTTGGAAACAGG + Intronic
1079781908 11:24618023-24618045 GTGGAGGTCTGCTGGGAAACTGG - Intronic
1080579368 11:33630020-33630042 CTGCAGGTCTGTTGGAGTACTGG + Intronic
1080844162 11:36011952-36011974 CTGCATGACTGTGGGGAAGAAGG + Intronic
1081594124 11:44447439-44447461 CTGAAGGGCTGATGGGAAACAGG + Intergenic
1085581663 11:77656423-77656445 CTGCTGGGCAGTTGGGAAACTGG + Intergenic
1085716562 11:78878661-78878683 TGGCAGGACTGTGGGGAAATTGG + Intronic
1088231773 11:107680290-107680312 CAGCAAGATTGTTGGGAAATTGG + Intergenic
1089412232 11:118255127-118255149 CTGCAGAACTGGTTGGAAAACGG + Exonic
1089773963 11:120823267-120823289 TTGCTGGGCTTTTGGGAAACAGG + Intronic
1090343097 11:126043079-126043101 CTGCATGGCAGGTGGGAAACTGG + Intronic
1090461929 11:126898916-126898938 TTGGAGGACAGTTGGGAAAGGGG - Intronic
1090744096 11:129693055-129693077 CTGCAGGACTGCTGGGAGCATGG - Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091193079 11:133710503-133710525 CTTCAGGAATGTTTGGCAACAGG - Intergenic
1091580631 12:1786343-1786365 CTGCAAGACCCTTGGCAAACTGG + Exonic
1091810900 12:3397444-3397466 CTGCAGGTCTGTTGGAGTACTGG + Intronic
1092553207 12:9526782-9526804 CTGCAGGTCTGTTGGAGTACTGG + Intergenic
1095340783 12:41086691-41086713 CTGCAGGTCTGTTGGAGTACTGG + Intergenic
1096670647 12:53196529-53196551 CTGGAGGTCTGTTTGGGAACAGG - Intronic
1101131561 12:101696646-101696668 CTGGAGGGCTGTAGGAAAACAGG + Intergenic
1101353736 12:103957146-103957168 CTGCAGGGATGCTGGGCAACAGG + Exonic
1101669953 12:106860304-106860326 CTGCAGGACTGTTGGCGGCCAGG + Exonic
1108823716 13:54386061-54386083 TTGCAGGAATGTTTGGAAACTGG - Intergenic
1110573417 13:77030056-77030078 CTGCAGGAATTTTGTGCAACAGG + Intergenic
1112245717 13:97731184-97731206 CTGCAGGTCTGTTGGAGTACCGG - Intergenic
1113379957 13:109795199-109795221 TTGCCAGAATGTTGGGAAACAGG + Intergenic
1114502161 14:23178462-23178484 CTGCAGGGCTGCTGGGAACCTGG - Intronic
1116006527 14:39297492-39297514 TTGCAAGACTGTTGGCAAACAGG - Intronic
1117597950 14:57343323-57343345 CTGCAGGTCTGTTGGGGTCCTGG + Intergenic
1117915958 14:60678114-60678136 CTGAAGCACAGATGGGAAACTGG - Intergenic
1118837443 14:69486771-69486793 CTGCAGGTACATTGGGAAACTGG + Intronic
1119199690 14:72743205-72743227 CTCCAGGACTCTTGGGGAGCAGG - Intronic
1119790024 14:77341752-77341774 CTGAAGGACTGCTGGGACAGGGG - Exonic
1121078766 14:91090704-91090726 CTCCAGGACTGATGGGAAGAAGG + Intronic
1121688778 14:95859464-95859486 CTGAAGGAGTCTTGGAAAACAGG - Intergenic
1122298241 14:100717468-100717490 CTGCAGGCCTATGGGGTAACGGG + Intergenic
1122847510 14:104507972-104507994 CTGCAGGCCTGTGGGGACTCTGG - Intronic
1124841453 15:33245692-33245714 CTGCAGGTCCTTTGGGATACAGG - Intergenic
1125484780 15:40104288-40104310 GGGCAAGACTGCTGGGAAACTGG + Exonic
1125518143 15:40334342-40334364 GTGCAGGACGGTGGGGAAAGAGG + Exonic
1125592597 15:40864181-40864203 CTGCAGGTCTGCTGGGAGCCAGG + Intergenic
1129882670 15:79017459-79017481 CTGCAGGATAGTGGGGAAAGGGG + Intronic
1129940306 15:79491022-79491044 CTGCAGGTCTGTTGGAGTACTGG + Intergenic
1132254761 15:100366039-100366061 CTGCAGGTCTGTTGGAGTACTGG - Intergenic
1132416965 15:101627219-101627241 CTGCAGGTCTGTTGGAGTACTGG - Intronic
1132538683 16:497006-497028 CTGAAGGAGTGTTGGGAAAGGGG + Intronic
1132913657 16:2329684-2329706 CTTCAGGACTACTGGGGAACTGG + Exonic
1132988490 16:2780403-2780425 CTACAGGACGGTTTGGAGACAGG + Intergenic
1135917042 16:26614549-26614571 CTGCAGGGCTGGCAGGAAACAGG + Intergenic
1138507065 16:57483739-57483761 CTGCAGGCCTGTTGGGGACAAGG - Intronic
1139339088 16:66255875-66255897 CTGCAGGGCTTTTGGGCAACTGG - Intergenic
1140187525 16:72788234-72788256 GTGCAGGGCTGTAGGGGAACAGG + Exonic
1141787484 16:86211426-86211448 CTGCAGGACAACTGGGAAAGCGG - Intergenic
1147744571 17:42687395-42687417 CTGGAGCTCTGTTGGGAAGCTGG + Intronic
1150818285 17:68413354-68413376 CTGCAGGTCTGTTGGAGTACTGG + Intronic
1151314379 17:73312434-73312456 CTGCAGTACTGTCGGGAGATGGG + Intergenic
1151341637 17:73475034-73475056 CTGCAGTACTGTTGTGGTACTGG + Intronic
1153369188 18:4294821-4294843 CAGCAGGATAGATGGGAAACTGG + Intronic
1155052170 18:22158045-22158067 CTGTAGGTCTCTTGGGAAGCAGG - Intergenic
1155436498 18:25818110-25818132 CTCCAGGACAGCTGGGAAGCCGG - Intergenic
1156417952 18:36918203-36918225 CTGCAAGACTGATGGAAAAGGGG - Intronic
1156453318 18:37278979-37279001 CTCCAAGACTCTTGCGAAACTGG - Intronic
1157516207 18:48313466-48313488 CCTCAGGACTGTTGGGGAGCAGG - Intronic
1158393642 18:57063227-57063249 CTGCAGGACCCATGAGAAACAGG - Intergenic
1160117906 18:76099287-76099309 CTGCAGGAATGATGTGACACGGG - Intergenic
1160752559 19:741385-741407 CTGCAGGAGTGAGGGGAGACGGG + Intronic
1160812202 19:1017700-1017722 CTCCAGGTCTGTGGGGAGACAGG - Intronic
1162966613 19:14159208-14159230 CTCCAGGACTGTGGGGACAGGGG + Exonic
1164461520 19:28452968-28452990 CTGCAGGACAGATGGGAAACTGG + Intergenic
1165124079 19:33581693-33581715 CAGCAGAACTGTGGGGAGACAGG + Intergenic
1165722365 19:38088646-38088668 CTGCAGGCCTGCTGGGCATCAGG + Intronic
1167631199 19:50627281-50627303 CTGCAGGGCTGTGGGGGATCTGG - Intronic
1167725253 19:51207715-51207737 CTGGAGGACAGTAAGGAAACAGG + Intergenic
1168065001 19:53914339-53914361 CTCCAGGGGTGTTGGGAAAGCGG - Intronic
925312507 2:2895733-2895755 GTGAAAGACGGTTGGGAAACAGG - Intergenic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
926174799 2:10581194-10581216 TTGCTGGAGTGTGGGGAAACAGG + Intronic
926730190 2:16030671-16030693 CCGCAGGGCAGCTGGGAAACTGG - Intergenic
927493675 2:23537732-23537754 CTGCATGTCGGGTGGGAAACTGG + Intronic
927495827 2:23550981-23551003 TTGCAGGACTACAGGGAAACGGG + Intronic
927667116 2:25040689-25040711 CTGCAGGACTGTTGGGAAACTGG - Intergenic
930004707 2:46887263-46887285 CTGCAGTGCTTTTGGGAGACAGG - Intergenic
931552458 2:63461842-63461864 TTGGAGGACAGGTGGGAAACTGG - Intronic
932984296 2:76707314-76707336 CTGCAGGTCTGTTGGAGTACCGG + Intergenic
936394577 2:112112545-112112567 CAGCAGGACCTTTGGGAAAGTGG - Intronic
936685413 2:114821527-114821549 TTGTGGGACTGTTGGGAAAGTGG - Intronic
938607590 2:132911862-132911884 CTGCAGGACTGTTGATTAGCGGG + Intronic
938993384 2:136652680-136652702 CTGGAGGCCTGTTAGGAGACCGG + Intergenic
939093053 2:137800926-137800948 CTGCAGGTCTCATGGGAAACTGG - Intergenic
939218955 2:139277671-139277693 CTGCAGAATTGTTTGGAAATAGG + Intergenic
939430368 2:142097070-142097092 CAGCAGGACTGTTGGTAAACCGG - Intronic
939485922 2:142811501-142811523 CTGCAGGTCTGTTGGAGTACTGG + Intergenic
940692822 2:156940850-156940872 CTGCAGGGATGTTGAGAAAGAGG - Intergenic
941591752 2:167428826-167428848 CTAAAGGACTGTTGAGAATCAGG + Intergenic
942295540 2:174513517-174513539 CTGCTGGATTGTTTGGTAACAGG + Intergenic
942564726 2:177255114-177255136 CTGCAGGACTCTTGGAAGTCTGG - Intronic
946176186 2:217923074-217923096 CTCCAGGACTGTGGGGCCACAGG - Intronic
947146006 2:227065637-227065659 CTGCAGGTCTGTTGGAGTACTGG - Intronic
947544839 2:231003310-231003332 TTGCAGGACAGATGGGAGACAGG - Intronic
948645058 2:239399584-239399606 CAGCAGGACTGGGGGGATACTGG - Intronic
1169482841 20:6000967-6000989 CTGCAGGACCAGAGGGAAACAGG + Intergenic
1170549673 20:17465989-17466011 CTGCAGCTCTGCTTGGAAACTGG - Intronic
1174213737 20:48900193-48900215 CTGCAGGAATAATGGGAAAAGGG - Intergenic
1178107492 21:29336503-29336525 ATGCAGGAGTATTGGGGAACGGG - Intronic
1178308288 21:31508912-31508934 CTGCAGGACATTTAGCAAACTGG + Intronic
1179407254 21:41136355-41136377 CTGCAGGGCTGGTGGGAGCCAGG + Intergenic
1179768008 21:43588458-43588480 CTGTAGCGTTGTTGGGAAACAGG + Intronic
1182422197 22:30254054-30254076 GTGCAGGACTGGTGGGGGACAGG - Intergenic
949743703 3:7264493-7264515 CTGAATGACTGTTGGGGAAAGGG - Intronic
950448555 3:13052678-13052700 CAGGAGGGCTGTGGGGAAACTGG - Intronic
952777097 3:37057093-37057115 TTGCAGGACTGTGGGAAAGCTGG - Intronic
952838422 3:37624480-37624502 GTGCAGGACTGGGGAGAAACAGG - Intronic
957314475 3:78559694-78559716 ATGCAGGAGTGTTGGGAGATGGG + Intergenic
958955235 3:100459372-100459394 ATGCAGAACTTTTTGGAAACTGG - Intergenic
960317134 3:116191696-116191718 ATGCAGGAATGTTGAGAAAATGG - Intronic
961521566 3:127470054-127470076 TTGCAGCACTTTTGGGAAAGAGG + Intergenic
961980544 3:131073683-131073705 CTTCAGGAGTATAGGGAAACCGG + Intronic
962498304 3:135965270-135965292 GTGCAGGACTGTGGGAAGACAGG + Intergenic
963766669 3:149343342-149343364 CTGCAGGACCATTGAGGAACTGG + Intergenic
964541485 3:157784417-157784439 CTGCAGGTCTGATGGGAATGTGG - Intergenic
964658036 3:159090153-159090175 CTGCAGGTCTGTTGGAGTACTGG + Intronic
964846478 3:161049659-161049681 TTGCAGGATTTTTGTGAAACTGG + Intronic
964854379 3:161130225-161130247 ATGCAAGGCTGTGGGGAAACAGG + Intronic
966926818 3:184649725-184649747 GTGCAGGACTGTGAGGAAAAGGG - Intronic
967035860 3:185647776-185647798 GTGCAGTCCTGTTGGGAAGCAGG - Intronic
967135097 3:186506397-186506419 CTGGAAGACTGCTTGGAAACAGG - Intergenic
967919866 3:194606397-194606419 GGGCAAGACTGTGGGGAAACAGG - Intronic
968702477 4:2063480-2063502 CTGTTGGCCTGTTGGGTAACAGG + Intronic
968913842 4:3488672-3488694 CTGCAGGACTGAGCCGAAACAGG - Intronic
969639010 4:8385735-8385757 CTGCAGGACTGGAGAGACACAGG - Intronic
970024141 4:11603936-11603958 CTGCAGGGGTGTGGGCAAACTGG - Intergenic
970669031 4:18374951-18374973 ATGCAGGACTGTTGAGAGATAGG + Intergenic
974418898 4:61646510-61646532 CTGCAGGTCTGTTGGAGTACTGG + Intronic
975604126 4:76136256-76136278 CTGCAGGCCTTTTGGGGAACAGG - Exonic
975639929 4:76490348-76490370 CTGCATGTCAGATGGGAAACTGG - Intronic
979051689 4:115943168-115943190 CAACAGGATTGTTGGGAAACTGG + Intergenic
979689680 4:123547249-123547271 GTGGAGGACTGTGGGGAGACTGG - Intergenic
979848164 4:125543367-125543389 CTTCTGAACTGTTGGTAAACAGG + Intergenic
981222593 4:142254112-142254134 CTGCAGGTCTGTTGGAGTACCGG - Intronic
981940933 4:150280917-150280939 GTGCAGGAGTGCTGGGAAAAAGG + Intronic
982836456 4:160125441-160125463 CTGCAGGTCTGTTGGAATACTGG + Intergenic
983446460 4:167858657-167858679 CTGCAGGTCTGTTGGAGTACTGG - Intergenic
985237915 4:187897116-187897138 GTGCAGGAGAGCTGGGAAACAGG + Intergenic
985570219 5:640775-640797 CTCCAGGCCTGTTGTGAGACAGG - Intronic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
990270241 5:54129603-54129625 CTACAGTACTATTGGGAAAGTGG - Intronic
990344216 5:54855424-54855446 CTGCATGACTGCTGAGCAACAGG - Intergenic
990369613 5:55104057-55104079 CTGCAGGACATTTGGGACAAAGG + Intronic
990670067 5:58118334-58118356 CAACAGGACTGGTGGGATACGGG - Intergenic
992564173 5:77981637-77981659 CTGCAGGACCATTAGGAACCGGG - Intergenic
992620075 5:78584516-78584538 CTGCAGGTCTGTTGGAGTACCGG + Intronic
992809030 5:80367657-80367679 CGGCAAGTCTGTGGGGAAACAGG + Intergenic
993061796 5:83047532-83047554 CTGCAGGACACTGGGCAAACTGG - Intergenic
993690933 5:90998762-90998784 TGGCAAGAATGTTGGGAAACAGG - Intronic
994738234 5:103584995-103585017 CTGCAGGATTGTTGTGAAATTGG - Intergenic
995385145 5:111580745-111580767 CTGCAGGTCTGTTGGAGTACTGG + Intergenic
996881205 5:128299066-128299088 CTGCAGGTCTGTTGGAGTACTGG + Intronic
996884078 5:128335230-128335252 CTCCAGGAATGTTGGTACACTGG + Exonic
997087509 5:130818507-130818529 CTGCAGGTCTGTTGGAGCACCGG - Intergenic
997360249 5:133290476-133290498 CTGCTGGCCTGCTGGGAAGCAGG - Intronic
999025903 5:148231372-148231394 CTGCAGGTCTGTTGGAGTACTGG - Intergenic
999584519 5:153076221-153076243 CTGCAGGTCTGTTGGAGTACTGG + Intergenic
999963228 5:156779547-156779569 CTGCAGGGCTGCTGGGGACCAGG + Intergenic
1000174895 5:158742295-158742317 CTCCAGGACGGTTGGGACAAAGG - Intronic
1001581728 5:172803135-172803157 CTGGAGCACTGTTGGGAAGAGGG + Intergenic
1006806228 6:36791494-36791516 CTGTAGGACTGTGGGGGAGCAGG - Intronic
1008297539 6:49796716-49796738 CTGCAGGTCTGTTGGAGTACTGG + Intergenic
1008825238 6:55685429-55685451 CTGCAGGTCTGTTGGAGTACCGG - Intergenic
1011002494 6:82606805-82606827 CTTCAGGGCTCTGGGGAAACAGG - Intergenic
1011004863 6:82633011-82633033 CTGCAGGTCTGTTGGAGTACTGG - Intergenic
1011479093 6:87776456-87776478 CTCCAGGACTGCTTGGAGACAGG - Intergenic
1013974409 6:116060444-116060466 CTGCTGGACTGATCTGAAACGGG - Exonic
1014650723 6:124033686-124033708 CTGCAACACTGTTGGGAATTTGG + Intronic
1015871254 6:137778690-137778712 CTGAAGGCCTGTTGGTAAAGGGG - Intergenic
1016213391 6:141566877-141566899 CTGCAGGTCTGTTGGAGTACCGG - Intergenic
1016226650 6:141746785-141746807 CTGCAGGTCTGTTGGAGTACCGG - Intergenic
1017800118 6:157887875-157887897 CTACAGGACAGTTGTGGAACCGG + Intronic
1018501263 6:164413219-164413241 GAGCAGGACAGTGGGGAAACTGG - Intergenic
1018645561 6:165944631-165944653 CTGCAGGGCTTATGGGAAAATGG - Intronic
1018824626 6:167399734-167399756 CTGCAGGGCTGGTGCGACACAGG - Intergenic
1020056195 7:5118865-5118887 CTTCAGGAGTCTTGGGAAAGAGG + Intergenic
1020660185 7:10972966-10972988 CTGCAGGGCAGATGGGAAATTGG + Intergenic
1021091261 7:16485832-16485854 GTGCAGGATTGTGGGGCAACAGG - Intronic
1022638181 7:32156799-32156821 CTGCAAGTTTGTTGGGAAAAAGG + Intronic
1024038998 7:45535000-45535022 TTGCAGCAGTGTTGGGAGACGGG + Intergenic
1030260960 7:107563790-107563812 CTGCAGGACGGTAAGGAGACGGG - Exonic
1030818173 7:114062465-114062487 CTGCAGGAAGGTTTGAAAACTGG - Intronic
1032794716 7:135268483-135268505 CTGCAGAACTGAAGGGAATCTGG + Intergenic
1033077841 7:138266276-138266298 CTGCAGGACTGCTTGAAAACAGG + Intergenic
1034200204 7:149279403-149279425 CTGCAGGAGTGTTGGGGACATGG + Intronic
1034892595 7:154854314-154854336 TTTCAGGACTGTTGTGAAAGGGG + Intronic
1036196776 8:6724276-6724298 CTGGAGGCCTGTTGGGAACATGG - Intronic
1037329126 8:17726257-17726279 CTGAAGCACTGTTGAGAATCAGG + Intronic
1037925694 8:22842628-22842650 GTGCAGGCCTGTTGGGATCCTGG - Intronic
1038309008 8:26430990-26431012 CTGCAGGTCTGTTGTGTCACCGG + Intronic
1042269935 8:66944494-66944516 CTGCAGCACAGTTGGGAATGAGG - Intergenic
1042486923 8:69356625-69356647 CTGCAGGTCTGTTGGAGTACTGG + Intergenic
1044220901 8:89668807-89668829 CCTCAGGACTGTAGGGAAGCGGG - Intergenic
1045591925 8:103608232-103608254 CTGCAGGTCTGTTGGAGTACTGG + Intronic
1045827710 8:106419648-106419670 TTGCTGGATTGTTGGGAGACAGG + Intronic
1048355430 8:133650066-133650088 TTGCAGGGCTGTTGGCACACAGG - Intergenic
1049079864 8:140433901-140433923 CTGCATGGCAGGTGGGAAACTGG + Intronic
1049311561 8:141936371-141936393 CTGCAGGACTGCTGGGTTAGGGG + Intergenic
1049508534 8:143016317-143016339 CTGCAGTATTGCTGGGAAAGAGG + Intergenic
1049513203 8:143040010-143040032 CTGCAGGAGGCTTGGGAATCAGG + Intronic
1052239154 9:26250542-26250564 CTGCAGGTCTGTTGGAGTACTGG - Intergenic
1054823949 9:69552070-69552092 CTGCAGAAGTGTTGGGAATATGG + Intronic
1056805928 9:89728878-89728900 CTGCAGTAATTTAGGGAAACAGG + Intergenic
1056888394 9:90466660-90466682 CTGCAGGGCAGATGGGAAAATGG + Intergenic
1059876584 9:118641826-118641848 CTGCTGTACTGTTGGGAGCCAGG - Intergenic
1060686810 9:125622211-125622233 CTGCAGCACTGTAGGGTAAGTGG + Intronic
1062036712 9:134385720-134385742 ATGCAGGAGTGCTGGAAAACCGG - Intronic
1062327732 9:136020221-136020243 ATGCAGGTCTGGAGGGAAACCGG + Intronic
1062639748 9:137512680-137512702 CTCCCAAACTGTTGGGAAACAGG - Intronic
1203594388 Un_KI270747v1:110778-110800 CTTCAGGACTGTGGTGAAAAAGG + Intergenic
1186063751 X:5739435-5739457 CTGCAGGGCTGCTGAGAGACAGG - Intergenic
1186944839 X:14554292-14554314 CTACAGTACTGTTAGGAAACAGG - Intronic
1188792023 X:34415920-34415942 CTGCAGGTCTGTTGGAGTACCGG - Intergenic
1192776332 X:74249333-74249355 TGGCAGGACTGTGGGAAAACTGG - Intergenic
1192976237 X:76288764-76288786 CTGCAGGTCTGTTGGATTACCGG - Intergenic
1196536983 X:116857841-116857863 CTGCAGGAGTAAGGGGAAACTGG + Intergenic
1198098691 X:133404997-133405019 ATCCAGCACTGTTGGGAAACTGG + Intronic
1198545670 X:137690203-137690225 CTGCAGGAATTTTGGGGATCAGG + Intergenic
1201401151 Y:13605591-13605613 TGGCAAGACTGTGGGGAAACTGG + Intergenic