ID: 927667830

View in Genome Browser
Species Human (GRCh38)
Location 2:25044431-25044453
Sequence GAGTAAGGAGGTTTGGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 1, 2: 1, 3: 34, 4: 388}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927667822_927667830 7 Left 927667822 2:25044401-25044423 CCAGAAGTCAATAGAGTGATGAA 0: 1
1: 0
2: 0
3: 9
4: 179
Right 927667830 2:25044431-25044453 GAGTAAGGAGGTTTGGGGGCGGG 0: 1
1: 1
2: 1
3: 34
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927667830 Original CRISPR GAGTAAGGAGGTTTGGGGGC GGG Intronic
900097938 1:947931-947953 CATTCAGGAGGTTTGGGGGCAGG - Intronic
900323462 1:2096009-2096031 GAGTAAATGGGTGTGGGGGCCGG + Intronic
900324448 1:2101386-2101408 AAGGAAGGAGGGCTGGGGGCCGG - Intronic
900588441 1:3445323-3445345 GAGTGAAGAGGTTTGGAGGGTGG + Intergenic
902334319 1:15746470-15746492 GAGGAAGGTGGTTTGGGCCCAGG + Intronic
903536023 1:24066914-24066936 GAGTATGGAATTTAGGGGGCCGG + Intronic
903614832 1:24643850-24643872 GAGGGAGGACGTTGGGGGGCGGG - Intronic
903677562 1:25073955-25073977 GAATAATGAGGGTTGGGGTCAGG + Intergenic
903954601 1:27016424-27016446 GAGGAAGGAGGTGTGGGGAAAGG + Intergenic
904162647 1:28532709-28532731 GGGCAAGGAGGTGTGGAGGCAGG + Intronic
904594011 1:31631816-31631838 GACTAAGGAGGTCTGTGGGCAGG - Intronic
905169357 1:36099989-36100011 GAGGCAGGGGATTTGGGGGCTGG + Intronic
905732447 1:40306090-40306112 GAGCAAGGAAGTCTGGGGCCAGG - Intronic
905804426 1:40865508-40865530 TAGGAAGGAGGTTGGGGTGCAGG + Intergenic
906607665 1:47183071-47183093 GATGAAGGATGTTTGGGGGCGGG + Intergenic
906694752 1:47816428-47816450 AAGCAAGGAGGTTAGGGAGCAGG - Intronic
907579297 1:55557276-55557298 GAGAAAGGTGGGTTGGGGCCTGG + Intergenic
908331147 1:63072450-63072472 GATTAAGGAGGTGTGGGGCTCGG - Intergenic
909351521 1:74659067-74659089 CAGTAAGGAGACTTGGGAGCAGG + Intronic
909975508 1:82042063-82042085 GATTTGAGAGGTTTGGGGGCTGG - Intergenic
910503291 1:87919261-87919283 GAGTAAGGAAGGTAGGGGGTAGG + Intergenic
911098927 1:94078569-94078591 GAGTAAGGGGGGTTGGAGGATGG - Exonic
911793171 1:102044962-102044984 CAATAAGAAGGCTTGGGGGCTGG + Intergenic
912669958 1:111616462-111616484 GAGTAAGGCGGTTAGGGGACAGG - Intronic
912757718 1:112338237-112338259 GAATAAGGAGATTTTGGAGCAGG + Intergenic
916825327 1:168436925-168436947 GATTCAGGAGGTTTGGGGTAGGG + Intergenic
917359455 1:174159806-174159828 CGGTAAGGAGGGTAGGGGGCGGG + Intronic
920026976 1:203006243-203006265 GTGTAAAGAGGCTTGGGGGAAGG - Intergenic
920385387 1:205567874-205567896 GACTGAGGAGGTATGTGGGCGGG - Intergenic
920442216 1:205988897-205988919 GAGTAAGGACATTTGAGGGCCGG + Intronic
922635900 1:227170800-227170822 GAGAAAGCAGGTTTGGGTGGAGG - Intronic
922775629 1:228213161-228213183 GAGACAGGAAGTTGGGGGGCGGG - Intronic
923218034 1:231868186-231868208 GAGAACGGAGGGTTTGGGGCAGG - Intronic
923571845 1:235123189-235123211 GACTAAAGAGGTCTGAGGGCCGG + Intronic
924470196 1:244336641-244336663 GTGGAAGGAGGGTTGGGGTCTGG - Intergenic
924532873 1:244908191-244908213 GAGTATGGGGTTTTGGGAGCCGG + Intergenic
924891652 1:248288529-248288551 GGGTTAGGAGGTTTGGGGAGAGG + Intergenic
1062898992 10:1127634-1127656 GAGTCAGGAGGTCCGGGGTCAGG + Intronic
1065596203 10:27314282-27314304 AAGTCAGAAGGATTGGGGGCGGG + Intergenic
1065918456 10:30371004-30371026 GTGGGAGGAGGTTGGGGGGCTGG + Intronic
1069637376 10:69933495-69933517 GAGACAGGATGTTTGGTGGCGGG + Intronic
1070480583 10:76878717-76878739 GAGTCAGGGCGTTTGGGGGCTGG + Intronic
1072005557 10:91243189-91243211 GACTAAGGAGGTTGTGGGGAGGG + Intronic
1073579882 10:104655770-104655792 GAGCAAGGCGGAGTGGGGGCAGG - Intronic
1073757419 10:106595504-106595526 GAGTATGGAGGTGTGGAGGGTGG - Intronic
1074318615 10:112380676-112380698 GAGAAAGATGGTTTGGTGGCAGG + Intronic
1074572169 10:114634001-114634023 GGGTGAGGAGGAATGGGGGCTGG - Intronic
1074713740 10:116199307-116199329 GAGGAGGCAGGTTTGGGGTCCGG - Intronic
1074757374 10:116634582-116634604 GAATGAGGAGGGCTGGGGGCTGG - Intronic
1076439026 10:130466810-130466832 GACTCAGGAGGGCTGGGGGCAGG - Intergenic
1077244887 11:1531942-1531964 GAGTAAGGAGGTGTGGGATGGGG - Intergenic
1077483447 11:2827317-2827339 GAGAGAGGAGGTCTGGGGCCAGG - Intronic
1078234663 11:9473093-9473115 GAGTAAAGACATTTGGGGCCGGG + Intronic
1081011630 11:37820341-37820363 GTGTAAGGAGGATGTGGGGCTGG + Intergenic
1081814526 11:45931010-45931032 CAGAATGTAGGTTTGGGGGCTGG + Intronic
1082988133 11:59185333-59185355 GAGAAAGGAGTTTTGAGGGAGGG - Intronic
1083270924 11:61572104-61572126 GAGGAATGAGGTTGGGGGGGGGG + Intronic
1083630206 11:64091389-64091411 AGGTAGGGAGGTTGGGGGGCGGG + Intronic
1083749585 11:64753854-64753876 GAGTCCGGAGGCTTGGGGGATGG - Intronic
1083962027 11:66020060-66020082 GTGGAAGGAGGTTAGGGGGATGG + Intronic
1084719369 11:70894499-70894521 GAGTAGGGGGGTTTAGTGGCTGG + Intronic
1084980160 11:72824708-72824730 GGGTAAGGTGGGTTGGGGTCAGG - Intronic
1085266293 11:75240034-75240056 GTCTTAAGAGGTTTGGGGGCAGG + Intergenic
1085273506 11:75283833-75283855 GAGCAGGGAGTTGTGGGGGCAGG + Intronic
1086371052 11:86156315-86156337 GGGTCAGGAGGTTTTGGGTCAGG - Intergenic
1088223931 11:107598613-107598635 GTGCAAGGAGGTTTGGGGAAAGG - Intronic
1089564485 11:119363722-119363744 GGGAAAGGAGGGGTGGGGGCTGG + Intronic
1089812674 11:121144451-121144473 GAGGAAGGAGGTTGGGGGAAGGG + Intronic
1089932830 11:122331570-122331592 GAGCAGGGAGGTTGGGAGGCAGG - Intergenic
1090033339 11:123226394-123226416 GAGAAAGGAGGTTTGGGTCAAGG - Intergenic
1091658183 12:2361084-2361106 GACTAGGAAGGTTGGGGGGCTGG + Intronic
1091806257 12:3358320-3358342 GAGTCAGCAGGTTTGGGGTAGGG + Intergenic
1092148714 12:6232518-6232540 GAATAAGGAGGTGGGGAGGCAGG + Intronic
1092485856 12:8901563-8901585 AAGAATTGAGGTTTGGGGGCCGG - Intergenic
1092814289 12:12299577-12299599 GGGTATGGAGTTTTGGGGCCGGG - Intergenic
1093214749 12:16349359-16349381 TAGTACGGGGGTTTGGGGGGAGG + Intronic
1095180588 12:39143469-39143491 AAGGGTGGAGGTTTGGGGGCGGG - Intergenic
1095190850 12:39256417-39256439 GAGTTAGTAGGTTTGAGGGAAGG + Intergenic
1095523082 12:43091672-43091694 GAATAAGGAGGATTGGGAGAGGG - Intergenic
1095946606 12:47757524-47757546 GAGGTGGGAGGTATGGGGGCCGG - Intronic
1096077906 12:48816253-48816275 GAATAATCAGGTTTGGGAGCTGG - Intronic
1096716101 12:53492736-53492758 GGGGAGGGAGGTTGGGGGGCAGG - Intronic
1096766252 12:53892766-53892788 GGGTAAGAAGGTTTGTGGGGGGG - Intergenic
1097181492 12:57174477-57174499 GAGTGAGAAGGCATGGGGGCAGG + Intronic
1097187193 12:57202241-57202263 CTATAAGGAGGTTTGGGGACAGG - Intronic
1097223835 12:57465369-57465391 AAGTAAAGAGGTGTGGGTGCTGG + Intronic
1098301477 12:69058693-69058715 GAGTAAGGAGGAGAGGGGGATGG - Intergenic
1098584006 12:72134765-72134787 AAGTAGGGAAATTTGGGGGCTGG + Intronic
1099177776 12:79441609-79441631 GAGAACAGAGGGTTGGGGGCTGG - Intronic
1099388871 12:82053283-82053305 GAGAATGGAGGTTTGGAGACTGG - Intergenic
1099415451 12:82379890-82379912 GAGAAAGGAGATTTGGGCTCTGG - Intronic
1099819173 12:87688020-87688042 TAGTAAGGATGCTTGGGGACTGG + Intergenic
1100175133 12:92021838-92021860 TAGTCAGGAGGTAGGGGGGCTGG - Intronic
1100356602 12:93836869-93836891 GAGTGTGTAGGGTTGGGGGCAGG + Intronic
1101467437 12:104962307-104962329 GAGTTAGAGAGTTTGGGGGCGGG + Intergenic
1101791903 12:107935295-107935317 GAGGAAGGTGGTTGGGGGGAGGG - Intergenic
1101806297 12:108067186-108067208 GAGTAGGAAGAGTTGGGGGCTGG - Intergenic
1102444292 12:112989870-112989892 GAGTGAGGAGGTGGGGGAGCTGG - Intronic
1102896452 12:116602120-116602142 GAGAGAGGAGGTTGGGGGGCGGG - Intergenic
1103215498 12:119198553-119198575 GAGCAAGCAGGGTTTGGGGCAGG + Intronic
1104048457 12:125180677-125180699 GAGTTTGCAGGGTTGGGGGCTGG - Intergenic
1104196733 12:126547203-126547225 GAGTTAGGAGGTTTGGATGATGG - Intergenic
1104818046 12:131659933-131659955 GAGGATAGAGGTTTGGGGGATGG + Intergenic
1104828355 12:131730904-131730926 GAGTAAGGGTGCCTGGGGGCTGG + Intronic
1104908401 12:132227891-132227913 GAGCAAGAAGGTGTGGGGACGGG - Intronic
1105021169 12:132817642-132817664 GAGTGTGGAGGTGTGGGGGGGGG - Intronic
1105021230 12:132817906-132817928 GAGTGTGGAGGTGTGGGGGGGGG - Intronic
1105021247 12:132817971-132817993 GAGTGTGGAGGTGTGGGGGGGGG - Intronic
1106510521 13:30408709-30408731 GAGCCAGTAGGTTTGGAGGCCGG - Intergenic
1107418844 13:40226524-40226546 CACTTAAGAGGTTTGGGGGCTGG + Intergenic
1107695027 13:42991919-42991941 GAGTGAGTATGTTTGGGGCCCGG + Intronic
1107989134 13:45802007-45802029 GAGTAAGAAAGTTTGGGGCCGGG + Intronic
1108108565 13:47041637-47041659 GGGTGAAGAGGTGTGGGGGCAGG - Intergenic
1108295055 13:49007790-49007812 GAGTTAGGAGGTCTAGGGACAGG + Intronic
1108854314 13:54774723-54774745 GAGTAAGCAAGTGTGGGGTCTGG + Intergenic
1110548167 13:76780175-76780197 AAGTAAGTAGGTTTTGTGGCAGG - Intergenic
1110703747 13:78580463-78580485 GAGTAGGGAGTTTTTGGGGAGGG - Intergenic
1113976879 13:114234686-114234708 GAGTCAGGAGGGCTCGGGGCCGG - Intergenic
1117953612 14:61106259-61106281 GAATAATGTGGTTTGAGGGCTGG + Intergenic
1117972372 14:61264913-61264935 GAGTAAGGAGGGATGGGGAATGG + Intronic
1119219935 14:72898405-72898427 GAGTAAAGAGGGATGGGGGCTGG - Intergenic
1120022605 14:79547684-79547706 CAGTAAGGAGGTTGGGGAGCTGG + Intronic
1120859988 14:89246499-89246521 GAGAAAGGAGGTGTGGGCGCTGG - Intronic
1121297756 14:92843382-92843404 AAGTATGGAAGTTTGGGGCCGGG - Intergenic
1122440271 14:101727025-101727047 GAGTAAGGAGGCCTGGAGGTGGG - Intergenic
1122632617 14:103113938-103113960 AAGGAAGGAAGTTTGGGGACGGG - Intergenic
1124358511 15:29017042-29017064 GAGGAAGGAGGGTTGGGTCCCGG + Intronic
1125354852 15:38806168-38806190 AAGAAAGGAGGTCTAGGGGCTGG + Intergenic
1125715012 15:41814730-41814752 GAGTGTGGAGGTATGTGGGCTGG + Exonic
1127775660 15:62262343-62262365 GTGGGAGGAGGTTTGAGGGCTGG + Intergenic
1128550635 15:68596009-68596031 GAGTGTGGAGGGTCGGGGGCTGG + Intronic
1128705692 15:69836171-69836193 GAGGAAGGAGGTTCCTGGGCTGG + Intergenic
1128788239 15:70414078-70414100 GATTCAGGAGGTCTGGGGACAGG - Intergenic
1128979811 15:72178096-72178118 AAGAAAGGAGGGGTGGGGGCAGG - Intronic
1129475012 15:75779248-75779270 GTGAAAGGAGGTTGGAGGGCTGG - Intergenic
1129518131 15:76169320-76169342 GAGGGAGGAGATTTGGGGTCGGG + Intronic
1129838790 15:78730842-78730864 GTGAAAGGAGGTTGGAGGGCTGG - Intergenic
1132387573 15:101411269-101411291 GAGTAAGGAGCTAGGGTGGCAGG + Intronic
1132587828 16:713941-713963 GTGGCAGGAGGTTTGGGGGCAGG + Intronic
1132602768 16:781380-781402 CAGGAAGGGGGTTTGGGTGCAGG + Intronic
1134232257 16:12438125-12438147 GAGTGGGGAGGTGAGGGGGCAGG + Intronic
1134687531 16:16169346-16169368 CTGTCTGGAGGTTTGGGGGCAGG + Intronic
1135042319 16:19127336-19127358 GGGAAAGGAAGTTTGGTGGCAGG - Intronic
1135295743 16:21278057-21278079 GAGTGAGGAGGGTCGGGGTCAGG - Intronic
1135705435 16:24670906-24670928 ATGTAAGGAAGTGTGGGGGCTGG - Intergenic
1138392891 16:56683043-56683065 GGGAAAGGAGCTCTGGGGGCTGG + Intronic
1138748934 16:59395599-59395621 GATTTAGTAGGTTTGGTGGCAGG + Intergenic
1140260382 16:73373129-73373151 TGGTGAGGAGGTTTGGGGGGGGG + Intergenic
1141746494 16:85929875-85929897 GAGGAGGGCGGTATGGGGGCCGG - Intergenic
1142154736 16:88527823-88527845 GAGCAAGGAGGCCTGGAGGCAGG + Intronic
1143038175 17:4012531-4012553 GAGCAAGGAGGGTGGGGGCCAGG + Intronic
1143096389 17:4480682-4480704 GTGGAAGGAGGGTTAGGGGCTGG + Intronic
1143149464 17:4798680-4798702 GGGAAAGGAAGTTTGGGGGAAGG - Intergenic
1143523769 17:7461259-7461281 GGTCAAGGAGGTTTGGGGGAGGG - Exonic
1143661374 17:8326660-8326682 TAGTGAGCAGGCTTGGGGGCCGG - Intergenic
1145819148 17:27818019-27818041 GGGTCAGGAGGGTTGGGGGAAGG - Intronic
1146412154 17:32595845-32595867 GATTAGGGGGGTTTGGGGACAGG + Intronic
1146825874 17:36022995-36023017 CAGTCAGGAGGCATGGGGGCAGG + Intergenic
1147150721 17:38512005-38512027 GAGTGAGGGTGTGTGGGGGCTGG - Exonic
1147767457 17:42846232-42846254 GAGGATGGAGACTTGGGGGCGGG + Intronic
1149401046 17:56296184-56296206 GAGTACGGAGGTGAGGGGGCAGG + Intronic
1150059092 17:62048623-62048645 GGGAAAGGAGGTTTGGAGGTGGG - Intronic
1150625172 17:66836694-66836716 GAGAGAGGAGGTTTGGGGGTGGG - Intronic
1150729424 17:67678998-67679020 GAGTCAGTAGGTTTGGGGTGGGG - Intronic
1151317869 17:73335077-73335099 GGGGTAGGAGTTTTGGGGGCCGG + Exonic
1151396578 17:73826960-73826982 GAGTGAACAGGTCTGGGGGCTGG - Intergenic
1151605146 17:75131160-75131182 GAGTAAGGAGAGAGGGGGGCGGG - Exonic
1151766659 17:76136623-76136645 GGGTTTGGTGGTTTGGGGGCCGG - Exonic
1152110170 17:78353382-78353404 GAGTAAGGATGTTTGGGAGGGGG - Intergenic
1152985757 18:319090-319112 GAGTCGGGAGGTGTGGGGGATGG - Intergenic
1153265184 18:3262400-3262422 GAGGGAGGAGGGTTGGCGGCGGG + Exonic
1153544815 18:6194699-6194721 GAGGAAGGAGTGCTGGGGGCTGG - Intronic
1155416144 18:25601746-25601768 AAGTAATAAGGTTTTGGGGCTGG - Intergenic
1157454016 18:47810265-47810287 GGCTCAGGAGGTTTGGGGACAGG - Exonic
1158558290 18:58492984-58493006 CATTAAGGAAGTTTGGAGGCTGG - Intronic
1158717336 18:59892346-59892368 GAGAAAGGAAGTAAGGGGGCAGG + Intergenic
1160659490 19:291509-291531 GAGGAGGGAGGGTTAGGGGCGGG + Intergenic
1161021419 19:2013382-2013404 CAGAAAGGAGGGCTGGGGGCTGG + Intronic
1163234428 19:16022569-16022591 GAATGGGGAGGTTTGGGGGCAGG + Intergenic
1163505037 19:17700568-17700590 GAGCAAGGATGGCTGGGGGCAGG + Intergenic
1164402580 19:27911835-27911857 GAGCAAGTGGGTTTGGGGGAGGG + Intergenic
1164597127 19:29537694-29537716 GAGTAGGTGGGTGTGGGGGCGGG - Intronic
1164672060 19:30077854-30077876 GAGTAAAGAGGGTTGGGGCAAGG + Intergenic
1165253680 19:34559611-34559633 GAGCAAGGAGGTCTGTGGGGTGG + Intergenic
1165272584 19:34723637-34723659 GAGCAAGGAGGTCTGCGGGGTGG - Intergenic
1165424861 19:35740137-35740159 AAGTTGGGAGGTTTGGGAGCGGG - Intronic
1165449904 19:35876107-35876129 GAGAAAGGAGGTTGAGGGACAGG - Intronic
1165860541 19:38907107-38907129 GGGTGATTAGGTTTGGGGGCTGG - Intronic
1165975402 19:39671972-39671994 GAGAAAGAAAGTTTGGTGGCAGG - Intergenic
1166758794 19:45212021-45212043 GAGGAAGGAGGTTGGGGGCAGGG - Intronic
1167288268 19:48610940-48610962 GAGTAAAGTGCTCTGGGGGCTGG + Intronic
1167327826 19:48836265-48836287 GAGAAAGGAAGGATGGGGGCGGG - Intronic
925896941 2:8479719-8479741 AAGGAGGGAGGTTTGGGGCCTGG - Intergenic
925905445 2:8537216-8537238 GGGTCAGGATGTGTGGGGGCTGG - Intergenic
926210554 2:10866424-10866446 GACTAAGGAGGCTTTGGGGCGGG - Intergenic
926697838 2:15783208-15783230 GAGTGAGGAGACTTGGGGTCTGG - Intergenic
927062858 2:19440781-19440803 GAGGCAGGGGGTTTGGGGGCTGG - Intergenic
927667830 2:25044431-25044453 GAGTAAGGAGGTTTGGGGGCGGG + Intronic
927698869 2:25254950-25254972 GAATAAGGAAGTTTGACGGCCGG - Intronic
928022654 2:27716114-27716136 GAGGAAGGAGGACTGAGGGCAGG - Intergenic
928842727 2:35630266-35630288 AAGTAAGGAGGTGTGTGGGAAGG - Intergenic
929806739 2:45153039-45153061 CAGTAGGGAGGTGAGGGGGCAGG - Intergenic
931178104 2:59873593-59873615 GAGGAGGGAGGATTGGGAGCTGG + Intergenic
931400369 2:61925633-61925655 ATGTAAAGAGGTTTGGGGGAAGG + Intronic
931447193 2:62336579-62336601 GAGCAGGGATGTTGGGGGGCGGG - Intergenic
931638597 2:64362162-64362184 GAGGGAGGACGTTTGGGGGAAGG + Intergenic
932736881 2:74260545-74260567 GAGGAAAGTGATTTGGGGGCAGG - Intronic
934793198 2:97080969-97080991 GCTTAAGAAGCTTTGGGGGCTGG + Intergenic
935178298 2:100668547-100668569 GAGTGATGAGGTTGGGGGACAGG + Intergenic
935269303 2:101419885-101419907 GAGCAAGGAGCTTTGGGGAAGGG + Intronic
935563636 2:104584296-104584318 GAGTAGGGTGGTTTGGTGGTGGG + Intergenic
935728732 2:106047039-106047061 GGCTAAGGAGGTATGGGGGGAGG - Intergenic
936013400 2:108940346-108940368 GAGGGAGGACGTATGGGGGCTGG + Intronic
936484786 2:112916570-112916592 GAGTTGGGAGGGTTGGAGGCAGG - Intronic
937682877 2:124663578-124663600 GAGTATGGAGGTTGGGGGCTAGG + Intronic
938747540 2:134293927-134293949 GAGTAGGGAGGTAGGAGGGCTGG + Intronic
939643126 2:144664357-144664379 CAGCAAGCTGGTTTGGGGGCAGG + Intergenic
940125241 2:150315259-150315281 GACTAAGAAGCTTTTGGGGCCGG - Intergenic
940290922 2:152076946-152076968 GAGTAAGCAGGGAGGGGGGCTGG + Intronic
942183746 2:173404781-173404803 GAGCAAGGTGGTTGGGTGGCCGG - Intergenic
942980609 2:182076608-182076630 GAGTTAGGAGGTTTGGGGTGGGG - Intronic
945415745 2:209569536-209569558 GAGTAAGGGGGATTGGGAGTAGG + Intronic
946238620 2:218340699-218340721 GAGAGAGGAGGTTTGGAGACTGG - Intronic
946399180 2:219459858-219459880 AAGGAAGGAGGGCTGGGGGCCGG - Intronic
946563297 2:220936997-220937019 GCAAAAGGAGGTTTGGGGGAAGG + Intergenic
946816890 2:223588038-223588060 GGGTCAGTGGGTTTGGGGGCTGG - Intergenic
947019607 2:225660312-225660334 GAGTAAGTAGTATTGGGGGCAGG - Intergenic
947406986 2:229788617-229788639 GACTAGGCAAGTTTGGGGGCTGG - Intronic
948958931 2:241316436-241316458 GGGCTTGGAGGTTTGGGGGCTGG - Exonic
949047280 2:241877792-241877814 GAGAAAGGAGGGTCGGGGGAGGG - Intergenic
1169070766 20:2728508-2728530 GGGAAAAGAGGTTCGGGGGCGGG + Intronic
1169758726 20:9068741-9068763 GAGGAGGGAGGCTCGGGGGCAGG + Intronic
1169910506 20:10644217-10644239 GAGTCAGGAGGTCTGGGGTGGGG - Intronic
1170393745 20:15903567-15903589 GATTCAGTAGGTTTGGGGGTGGG + Intronic
1171768292 20:29301802-29301824 GAGAAAGGAGGCTGGGGGACGGG - Intergenic
1172298633 20:33832144-33832166 GACAACGGAGGTATGGGGGCTGG - Intronic
1173466799 20:43289751-43289773 GAGAAAGGAATTTTGGGGGTAGG - Intergenic
1173741819 20:45406957-45406979 GGGTGAAGAGATTTGGGGGCAGG - Intronic
1173944634 20:46940918-46940940 GAGTCAGGAGGCTAGGGGCCCGG - Intronic
1174024198 20:47559137-47559159 GAGTTATCATGTTTGGGGGCAGG + Intronic
1175384280 20:58584248-58584270 GTGTAAGCAGGTTAGGGTGCAGG + Intergenic
1175525656 20:59631749-59631771 CAGTGAGGTGTTTTGGGGGCTGG - Intronic
1175625199 20:60483904-60483926 GAGGAAGCAGGTGTGGGGGTGGG + Intergenic
1175694271 20:61089738-61089760 GAGGCAGGAGGCTTGGGGGGCGG - Intergenic
1175955171 20:62605407-62605429 GAGGCAGGAGGGTTGGGGGAAGG - Intergenic
1178193818 21:30319555-30319577 AAGTGAGGAGGTTTTGGGGCTGG + Exonic
1178351069 21:31873431-31873453 GAGGAAGAACTTTTGGGGGCGGG + Exonic
1178473171 21:32913313-32913335 GGGGAAGGGGGTTTGGGGGTAGG - Intergenic
1178724802 21:35041984-35042006 GAGTGAGGAAGATGGGGGGCGGG + Intronic
1178804710 21:35829342-35829364 GAGGATAGAGGTGTGGGGGCAGG + Intronic
1179249956 21:39664308-39664330 GAGTACGGAGGTTTGGGGGCTGG - Exonic
1179452355 21:41475014-41475036 GGGTAAGGAGGTGAGGGGGTGGG + Intronic
1179474238 21:41633171-41633193 TTGTAAGAAGGGTTGGGGGCGGG + Intergenic
1180058940 21:45374920-45374942 GAGGAAGCAGATTTGGGGACGGG + Intergenic
1180070844 21:45435224-45435246 GAGGAAGGTGGGGTGGGGGCGGG + Intronic
1180151141 21:45948673-45948695 GAGGAAGGAGGCCTGGGGGAGGG + Intergenic
1180613670 22:17113786-17113808 GAGGCAGCAGGGTTGGGGGCTGG + Exonic
1181550361 22:23635326-23635348 AAGAAAGGAGACTTGGGGGCTGG + Intergenic
1181688698 22:24546255-24546277 GAAAATGGGGGTTTGGGGGCCGG - Intronic
1181813550 22:25420558-25420580 CAGGAAGGAGGTTGGGGGCCCGG + Intergenic
1181966422 22:26659093-26659115 GAGTCAGCAGGTTTGGGGTGGGG + Intergenic
1182001895 22:26926578-26926600 GAGTAAGGAGGGGTGGTGGTGGG + Intergenic
1182529814 22:30946617-30946639 GAGGAAGGAGTGTTGGGGGATGG - Intronic
1182572483 22:31249399-31249421 GACTGAGGAGGTGTGGGGGCTGG - Intronic
1182740922 22:32566965-32566987 GGGAAAGAAGGTGTGGGGGCAGG + Intronic
1183318985 22:37153571-37153593 GAGTAAGGCTGTCTGGCGGCAGG + Intronic
1183505039 22:38203947-38203969 GAGTCAGGAGGGTTGGGGCCAGG + Intronic
1183674032 22:39289972-39289994 GAGTTAGGGGGTATGGAGGCTGG + Intergenic
1184122219 22:42459508-42459530 GAATAAACGGGTTTGGGGGCAGG - Intergenic
1184484789 22:44770331-44770353 GAGTCAGGAGTCTTGGGTGCAGG + Intronic
949973346 3:9430369-9430391 GAGAAAGGAGGGTTGGGGGTGGG + Intronic
951139748 3:19147052-19147074 GAGAAAGGGGGCCTGGGGGCGGG + Intergenic
951357011 3:21679702-21679724 AAGGAAGGAGGTTTGGAGGGAGG + Intronic
951608836 3:24468573-24468595 GAGTAAGGAGGTTTGAGAAGAGG + Intronic
952103686 3:30044497-30044519 GATTAAGTAGGTTTGGAAGCAGG - Intergenic
952735785 3:36690349-36690371 CAGCAAGGAGGTTTGGGGGACGG + Intergenic
953148687 3:40304212-40304234 GAGTAAGCAGTTTTGGGGAGAGG + Intergenic
953269849 3:41430891-41430913 AAGCAATGAGGTTTGGGGGTGGG + Intronic
953286710 3:41617301-41617323 CAGTCAGGAGGCTTGGGGTCAGG - Intronic
953383376 3:42490702-42490724 GAGTAAAGAGGTTTAGGAGTTGG + Intronic
953668044 3:44940163-44940185 GAGTCAGGAGTTGTGGGGGGAGG - Intronic
954579538 3:51695819-51695841 GAGTAAGCAGGTGTTGGTGCAGG + Intronic
956358037 3:68415486-68415508 GAGTGAGGAGGTTGGAGGGATGG + Intronic
956781392 3:72606088-72606110 GAGGCAGGGGGTTGGGGGGCAGG - Intergenic
957199323 3:77112225-77112247 GATCAAGGAGTTTTGGGGGGTGG + Intronic
957536309 3:81508600-81508622 GAGTAAGTTTGTTTGGGGGAAGG - Intronic
959408422 3:105990330-105990352 GAGTAATGAGGCTTGGTGGGAGG - Intergenic
960285643 3:115825475-115825497 CAGTAAGGAGGTTTGATGGTAGG - Intronic
960522673 3:118673435-118673457 GAGTTAGGAAGTTTGAGGCCTGG - Intergenic
961359523 3:126358042-126358064 GACTAAGGAGGTTTGCTGACCGG + Intergenic
961760991 3:129167708-129167730 GTTAAATGAGGTTTGGGGGCTGG - Intergenic
962169866 3:133089617-133089639 GAGAAAAGATGTTTGGGAGCAGG + Intronic
963108255 3:141664677-141664699 GTGGAAGGAGGCTTGGGGGAAGG - Intergenic
964154575 3:153569415-153569437 GCTTAAGGAGTTTTGGGGGCAGG - Intergenic
966426904 3:179789601-179789623 GAGGAGGGAGGATTTGGGGCAGG + Intergenic
967843560 3:194026890-194026912 TGGTAAGGAGGATTGGGAGCAGG - Intergenic
967976924 3:195040735-195040757 CAGTAAGGACTTCTGGGGGCAGG - Intergenic
968360957 3:198146461-198146483 GAGTTCTGATGTTTGGGGGCAGG + Intergenic
968449015 4:666447-666469 GAGTGAGGGGGTCGGGGGGCTGG + Intronic
968610143 4:1553353-1553375 AAGGAAGCAGGTTGGGGGGCGGG + Intergenic
968775296 4:2536560-2536582 GAGTAAGGCGGGGTGGGGGTGGG + Intronic
968849068 4:3066045-3066067 GAGTAAGCAGCTTTCGGGGCTGG + Intergenic
969460694 4:7327251-7327273 GAGTCAGGAGGCTTTGGGGGAGG + Intronic
969952573 4:10853577-10853599 CAGTCAGGAGGTATGGGGTCAGG + Intergenic
976096942 4:81518266-81518288 GAGAGATGAGGTTTGGAGGCAGG - Intronic
978073123 4:104495046-104495068 GAGGGAGGAGGTGTGGAGGCTGG + Intergenic
980375987 4:131949609-131949631 GGGTATTGAGGTTTGGGGGTTGG + Intergenic
980541476 4:134201626-134201648 GAGAAAGGAGGCGTGGGGGAAGG + Intronic
980952875 4:139398990-139399012 GAATAAGGAGGTTTGAGGAGAGG + Intronic
981324915 4:143434761-143434783 GAGGAAAGGGGTGTGGGGGCAGG - Intronic
981515827 4:145608580-145608602 GATTAAGGATGTTGGGGGGGGGG - Intergenic
981516538 4:145616239-145616261 GAATAAAAAGTTTTGGGGGCCGG - Intergenic
981843958 4:149145300-149145322 GGGAAAGCATGTTTGGGGGCCGG + Intergenic
985888742 5:2699776-2699798 GAGGAAGGTGGCCTGGGGGCGGG + Intergenic
985888767 5:2699856-2699878 GAGGAAGGTGGCCTGGGGGCGGG + Intergenic
987355566 5:17060616-17060638 GAGTTAGAAGGTTTGGGTCCAGG + Intergenic
989683313 5:44055180-44055202 GACTAGGGTGGTTAGGGGGCAGG + Intergenic
990073332 5:51812198-51812220 AAGTAAGGAGGGTTGGGGTGGGG - Intergenic
992190315 5:74285495-74285517 GGGTGGGGAGGTTTGGGGGCTGG - Intergenic
992812206 5:80400243-80400265 GTGTAAGGAGGTTTGGTGTCTGG + Intergenic
992940754 5:81758959-81758981 TAATCAGGAGGTTTAGGGGCCGG - Intergenic
994906514 5:105846265-105846287 TAGTTAGGAGGTCTGGGGACTGG - Intergenic
995064450 5:107844208-107844230 GAAGAAGGAGATCTGGGGGCTGG + Intergenic
996796513 5:127353840-127353862 GAGGGAAGAGGTTTGGGGACTGG + Intronic
997199034 5:131998610-131998632 GAGTATTGAGGTTAGGAGGCTGG - Intronic
1000689384 5:164296309-164296331 GAGTAGGGAGGGTTGGGGAGAGG - Intergenic
1002127849 5:177060159-177060181 GCGTGAGGAGGTTTGGAGCCTGG + Intronic
1002131126 5:177082280-177082302 GGGGAGGGAGGTGTGGGGGCTGG - Intergenic
1002480406 5:179497168-179497190 GAGTCAGGAGGTCTGGGGCAGGG + Intergenic
1003137312 6:3443716-3443738 GGGAAAGGAGGTTTTGGAGCAGG - Intronic
1003174971 6:3747492-3747514 GAGTGAGGAGGTACGGTGGCTGG - Intronic
1003995743 6:11538017-11538039 GAGGAAGGAGGGGAGGGGGCCGG - Intergenic
1004513819 6:16305499-16305521 GGGTAAGGGGGGTTGGGGGTGGG - Exonic
1005715897 6:28548038-28548060 GACTCAGGAGGTGTGGGGGGAGG + Intergenic
1007073431 6:39052357-39052379 GAGGAAGGAGGTTGGGGTCCTGG + Intronic
1008830978 6:55761524-55761546 CAGCAAGGAGGTATGGTGGCTGG - Intronic
1012938036 6:105388471-105388493 GAGAAAGGAGATTGGGGGGTGGG + Intronic
1013273631 6:108562648-108562670 TTGGGAGGAGGTTTGGGGGCTGG + Intronic
1015205926 6:130638565-130638587 GCTTAAGAAGTTTTGGGGGCCGG - Intergenic
1015503042 6:133953047-133953069 GAGGAAGGAAGGGTGGGGGCGGG + Intronic
1015862442 6:137695082-137695104 GAATAGGCAGGTTGGGGGGCTGG + Intergenic
1016988247 6:149910772-149910794 GAGTAAGGAAGAGTGGGGCCGGG + Intergenic
1017635216 6:156436605-156436627 GACTAAGGAGATTTGGGGATTGG - Intergenic
1017888336 6:158619517-158619539 GAGGAAGGAGTTTTGGAGGAAGG + Intronic
1018036694 6:159888196-159888218 GAGTCAGGAGGGCAGGGGGCTGG - Intergenic
1018373640 6:163191267-163191289 AAGGAAGTAGGTTTGGGGGGTGG - Intronic
1018652151 6:166001607-166001629 GAGTTTGCAGGGTTGGGGGCTGG + Intergenic
1019259053 7:70193-70215 GAGTTCTGATGTTTGGGGGCAGG - Intergenic
1019357104 7:586251-586273 GAGTGAGGATCATTGGGGGCCGG - Intronic
1020785220 7:12565363-12565385 GAGTCAGGAGGTTTGAGGTTTGG - Intergenic
1022412425 7:30149373-30149395 TGGTGAGGAGGTTTGTGGGCTGG + Intronic
1023821943 7:43985484-43985506 GGGTGGGGAGGTGTGGGGGCAGG - Intergenic
1024492015 7:49996379-49996401 GAGTAAGGATGTGTGGAGGTCGG - Intronic
1025872081 7:65444253-65444275 GACTAATGGGGGTTGGGGGCAGG + Intergenic
1028159811 7:87473343-87473365 GAGTAAGCAGGTTTGGGAGTAGG - Intronic
1028380331 7:90192671-90192693 GAGTAAATAGGCTTGGGGGGTGG + Intronic
1029303868 7:99604595-99604617 CAGTAAGGAGGGATGGAGGCGGG + Exonic
1029472261 7:100762043-100762065 GGGGAAGGAGGCTTGGGGGAGGG + Intronic
1029750207 7:102538897-102538919 GGGTGGGGAGGTGTGGGGGCAGG - Intronic
1029768158 7:102638005-102638027 GGGTGGGGAGGTGTGGGGGCAGG - Intronic
1032680159 7:134174167-134174189 GGGGAAGGAAGTTGGGGGGCTGG + Intronic
1032906307 7:136371393-136371415 GAGGAAGGAGGTTGGGAGGAGGG - Intergenic
1033646478 7:143308774-143308796 GGGCAAGGGGGTTGGGGGGCGGG - Intergenic
1033955372 7:146841359-146841381 GAGTAAGGGGGTTGGGTGGGGGG + Intronic
1034121979 7:148636560-148636582 GAGTAAACAGGTTTGTGGGTTGG - Intergenic
1034488470 7:151380779-151380801 GTGGAAGGAGGGGTGGGGGCGGG - Intronic
1035299995 7:157890996-157891018 GAGTAAGGAGGTGGGGAGGTGGG - Intronic
1035339678 7:158152245-158152267 GAGTATGAAGGATCGGGGGCTGG + Intronic
1036646019 8:10611759-10611781 GTGTGGGGAGGTATGGGGGCCGG + Exonic
1038789577 8:30656985-30657007 GAGTCAGGAGGTTTGGTTCCTGG - Intronic
1039601486 8:38842084-38842106 GGGTAAGGAGGAATGGGGGCGGG - Intronic
1040037955 8:42888758-42888780 GGGTGGGGAGGTTGGGGGGCGGG - Intronic
1040424390 8:47270528-47270550 GACCAAGGAGGTTTGGGGGCGGG - Intronic
1041321926 8:56622306-56622328 GGGGAAGGAGGTATAGGGGCAGG + Intergenic
1041662680 8:60414582-60414604 GAATAAGCAGGGTTGGGGCCAGG + Intergenic
1042209515 8:66365960-66365982 GAGAAAAGAGGTTTGTGGGAAGG - Intergenic
1042281998 8:67064816-67064838 GAGTTATGAGGGTTGGGGGCGGG + Intronic
1048213917 8:132479437-132479459 GAGCCAGGAGGTGAGGGGGCCGG - Intronic
1049277061 8:141725219-141725241 GAGCAAGGTGGCTTGGAGGCTGG - Intergenic
1049575046 8:143386041-143386063 GAGTGGGGAGGGGTGGGGGCGGG + Intergenic
1049582546 8:143419347-143419369 AAGAAAGGAGGTCTGGGGGAAGG + Intronic
1049675607 8:143887569-143887591 GAGGCAGGAGGCTTAGGGGCCGG + Intergenic
1050708436 9:8431049-8431071 GTGTAAGGAGGCTTGTGAGCTGG - Intronic
1053603375 9:39632447-39632469 GAGTGGGGAGGCTGGGGGGCAGG - Intergenic
1053861007 9:42386167-42386189 GAGTGGGGAGGCTGGGGGGCAGG - Intergenic
1054250163 9:62709977-62709999 GAGTGGGGAGGCTGGGGGGCAGG + Intergenic
1054323939 9:63703886-63703908 GAGTAAGGGGGGGTGGGGGCGGG - Intergenic
1054564273 9:66744506-66744528 GAGTGGGGAGGCTGGGGGGCAGG + Intergenic
1055055055 9:72015743-72015765 GGGTACGGGGATTTGGGGGCTGG + Intergenic
1055781141 9:79822958-79822980 AAGGAAGGAGATTTGGGGTCAGG + Intergenic
1056259519 9:84833852-84833874 AAGTAAGGATTTCTGGGGGCAGG + Intronic
1057247296 9:93467521-93467543 GAGTAAAGAGGGTCGGGGGGAGG - Intronic
1058687183 9:107489398-107489420 GAGTAAGTAGGTCCGGTGGCCGG + Exonic
1058903236 9:109460007-109460029 GAGTCAGGAGGTTAGGGGATGGG - Intronic
1059269044 9:113060863-113060885 GAGGAGGCAGGTTTAGGGGCTGG - Intergenic
1059270180 9:113066312-113066334 GAGGAGGCAGGTTTAGGGGCTGG - Intergenic
1059271316 9:113071762-113071784 GAGGAGGCAGGTTTAGGGGCTGG - Intergenic
1059272447 9:113077206-113077228 GAGGAGGCAGGTTTAGGGGCTGG - Intergenic
1059273582 9:113082648-113082670 GAGGAGGCAGGTTTAGGGGCTGG - Intergenic
1060359409 9:122940989-122941011 GAGTAAAGGGGTGGGGGGGCGGG + Exonic
1060401575 9:123352864-123352886 GAGTGAGGAGGGCAGGGGGCTGG + Intergenic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1061797666 9:133097861-133097883 GAGGAAGGAGGATTTGGGGTGGG - Exonic
1062070814 9:134554092-134554114 GAGCAGGGGGGTGTGGGGGCTGG + Intergenic
1062448043 9:136603988-136604010 GAGGAGGGAGGTCTGGGTGCTGG + Intergenic
1062480217 9:136747643-136747665 GAGGCTGGAGGTTTGGAGGCTGG - Intronic
1062745665 9:138210292-138210314 GAGTTCTGATGTTTGGGGGCAGG + Intergenic
1186132890 X:6487850-6487872 GAGTAAGCAGGATTAGGAGCTGG - Intergenic
1186371247 X:8949601-8949623 GAGCAGGGATGTTTGGGGACAGG + Intergenic
1186760052 X:12713746-12713768 GAAGAATGTGGTTTGGGGGCTGG - Intronic
1186990343 X:15060248-15060270 AAAGAAGTAGGTTTGGGGGCAGG + Intergenic
1188441097 X:30215825-30215847 GGGGAAGGAGGTTTGGACGCAGG + Intronic
1189271821 X:39757468-39757490 GATTTAGCAGGTCTGGGGGCAGG + Intergenic
1189422065 X:40864843-40864865 TGGTAAGGAGGTATTGGGGCAGG + Intergenic
1192741078 X:73893197-73893219 CAGTCAGGAGTTATGGGGGCAGG - Intergenic
1193199886 X:78676433-78676455 GAGGATGGAGGTTTGGAGGAGGG - Intergenic
1193200058 X:78678605-78678627 GAGGATGGAGGTTTGGAGGAGGG + Intergenic
1194817624 X:98463664-98463686 AAGGAAGGAGGTTTCAGGGCAGG + Intergenic
1195252828 X:103064473-103064495 GAGGAAGGGGGTTTGGGGTGGGG - Intergenic
1198810955 X:140535926-140535948 GAGTTTGGAGGTTTGAGGACAGG - Intergenic
1199495161 X:148444536-148444558 GAGTCAGGAGGTCTGGGCTCTGG + Intergenic
1199603114 X:149554979-149555001 ATGTAAGAAGGTTTGGGGGAAGG - Intergenic
1199647274 X:149924496-149924518 ATGTAAGAAGGTTTGGGGGAAGG + Intergenic
1200807748 Y:7449539-7449561 GAGGAAAGAGGGGTGGGGGCGGG - Intergenic
1200960942 Y:8995482-8995504 GAGTAATGAGTTTTAGGTGCTGG + Intergenic