ID: 927668504

View in Genome Browser
Species Human (GRCh38)
Location 2:25049107-25049129
Sequence AACTGCTAGTAGGAGTATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927668504 Original CRISPR AACTGCTAGTAGGAGTATAA TGG (reversed) Intronic
902523637 1:17038724-17038746 AACTGCTAATAGGAAAAGAAGGG - Intronic
907081986 1:51632325-51632347 AACTGTTTGTAAGATTATAATGG - Intronic
910641533 1:89468355-89468377 TACTGATTGTATGAGTATAATGG + Intergenic
911126053 1:94341975-94341997 AACTTTTACTGGGAGTATAACGG - Intergenic
913315431 1:117546778-117546800 ATCTGCAAGTAGGAGTTGAAAGG - Intergenic
915271214 1:154755071-154755093 AACTACTAGGAGGACTAAAAAGG - Intronic
916847604 1:168669122-168669144 GACTACTGGTAGGAATATAAAGG + Intergenic
918791190 1:188832121-188832143 ACCTGTTAGAAGGACTATAAGGG + Intergenic
919412143 1:197258993-197259015 AACTACTATTTGAAGTATAATGG - Intergenic
921784097 1:219205840-219205862 AACAACTAGTAGGACTTTAAAGG + Intronic
921811720 1:219522428-219522450 AACTGCTAGTAGTATTTTATAGG - Intergenic
1065947101 10:30614712-30614734 ACTTGCTGGTGGGAGTATAATGG + Intronic
1069507083 10:69009414-69009436 AAATGCTAGAAGGAATATTATGG - Intronic
1072897248 10:99377355-99377377 AACTGCTACTGGCTGTATAAAGG + Intronic
1073281005 10:102354109-102354131 AACTGCTAGGAGAAGAATAGTGG + Intronic
1074349669 10:112724024-112724046 AAATGCTTGTAGGAGAAAAAGGG - Intronic
1078643011 11:13113786-13113808 TACTGCTTGTAGGAATATACAGG - Intergenic
1079122210 11:17694298-17694320 AACTGTTAGTAGTAGTATCCAGG - Intergenic
1079973961 11:27069776-27069798 AAATGCTAGGAGGTGAATAAAGG - Intronic
1080309244 11:30870104-30870126 AACTGTTAATATGAGTAAAATGG - Intronic
1085989271 11:81821299-81821321 AACAACTAGAACGAGTATAAAGG - Intergenic
1086809121 11:91283142-91283164 AATTGGTAGTAAGAGTATTAAGG + Intergenic
1087600205 11:100304830-100304852 AAATGCTAGTAGTAGTAATATGG + Intronic
1095609869 12:44114738-44114760 AAGTATTAGTAGAAGTATAAGGG + Intronic
1100869618 12:98895739-98895761 AACTGTTGGTAGTAGTACAATGG - Intronic
1107180654 13:37455049-37455071 AAATGCTGGTAGGAGTTCAAAGG - Intergenic
1108413141 13:50170609-50170631 ACCTGCTGGTAGGAGAAGAATGG - Intronic
1109272587 13:60271128-60271150 AACTGGAAGTAGGATTATGAAGG + Intergenic
1111290278 13:86158268-86158290 GTATGCTAGTAGCAGTATAATGG - Intergenic
1113269067 13:108653287-108653309 ATCTCCTATTAGGTGTATAAGGG + Intronic
1114576382 14:23717966-23717988 CATTGCTATTAGGAGAATAAAGG + Intergenic
1118039552 14:61902148-61902170 AACTACAGGGAGGAGTATAAAGG - Intergenic
1123952911 15:25300638-25300660 AAATGACAGTAGGAGTATAAAGG + Intergenic
1124108801 15:26767323-26767345 AATTGCTATTAGCAGTTTAAAGG - Intronic
1124555894 15:30725603-30725625 CACTGCTAGTAGGGGAATATTGG - Intronic
1124675384 15:31680168-31680190 CATTGCTAGTAGGAGAATATTGG + Intronic
1127383303 15:58447972-58447994 AAATGCTAGACGTAGTATAAAGG - Intronic
1127623098 15:60753187-60753209 AACTGCGAGTAGGACTTAAAGGG - Intronic
1135052649 16:19204999-19205021 ACCTGGTTGTAGGAGTAGAAGGG - Intronic
1137955216 16:52822706-52822728 AACTGCTTCTAGGAATATCAAGG + Intergenic
1138493578 16:57393063-57393085 AACTGGCAGTAGGAGGATGAGGG - Intergenic
1140357224 16:74316776-74316798 AACTGTGAGTAGGAGCATAAAGG - Intergenic
1141293394 16:82742652-82742674 AACTGCAATGAGGACTATAAAGG + Intronic
1147584255 17:41644379-41644401 CATTGCTAGTAGATGTATAAGGG - Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1166578923 19:43874752-43874774 AATTGAGAGAAGGAGTATAAAGG - Intronic
927294806 2:21441711-21441733 AACTGCCAAGAGGAGTGTAAAGG + Intergenic
927668495 2:25048989-25049011 TTCCGCTAGTAGGAGTACAACGG - Intronic
927668504 2:25049107-25049129 AACTGCTAGTAGGAGTATAATGG - Intronic
929741751 2:44609535-44609557 GACTGCTACAAGGAATATAAAGG + Intronic
935043256 2:99454761-99454783 AACTAATAGTAGGAGTATTGTGG - Intronic
938088388 2:128416772-128416794 AATTGCTAGAAGGACTATATAGG + Intergenic
938878136 2:135555445-135555467 TACTGCCAGTAGGAGTGTAAAGG + Intronic
944141682 2:196463761-196463783 ACCTGGTTGTAGCAGTATAAAGG - Intronic
1175066884 20:56296666-56296688 ATCTGCAAGTTGGAGTATATGGG + Intergenic
1176951972 21:15058661-15058683 AAATGAGAGTAGTAGTATAATGG - Intronic
949229576 3:1734732-1734754 AACTGATAGCAGAAGTAAAAAGG + Intergenic
949776614 3:7639616-7639638 AAAAGGTAGTAGGAGTTTAAAGG - Intronic
971535082 4:27737977-27737999 CACTGATAGTAGTTGTATAAAGG + Intergenic
974230459 4:59106846-59106868 AACTACTAGAAGAAGCATAAGGG - Intergenic
975033138 4:69648842-69648864 AACTGCTGGTAGCAGTCTTAAGG + Intronic
975430121 4:74279937-74279959 TACTGCTAGCAAGAGTTTAAAGG - Intronic
976960984 4:90973056-90973078 AACTGCTAGAAGAAATATAGAGG + Intronic
977110562 4:92948117-92948139 AACCTCAGGTAGGAGTATAATGG - Intronic
977952366 4:102987322-102987344 AACTGATAGTAAGATTTTAATGG - Intronic
983714880 4:170768645-170768667 AACTGTTAGAAGGAAAATAAAGG - Intergenic
984616854 4:181907797-181907819 AACTGCTTGAATGAGTAGAAAGG + Intergenic
986658147 5:10035400-10035422 ACCTGCTAGTAGGAGTCTCTAGG - Intergenic
989115012 5:37943952-37943974 ATCTGCTTGTAGGTGTCTAAAGG + Intergenic
990786072 5:59421683-59421705 AGCAGTTAGTAGGAGTCTAAAGG + Intronic
995970132 5:117958778-117958800 AACTGAAAGTGGGAGTAAAAAGG - Intergenic
997121872 5:131182806-131182828 AACTTCTACTAGGAGTATTAGGG - Intronic
998742527 5:145220979-145221001 ATCTGGTAGTTGTAGTATAAAGG - Intergenic
999491279 5:152053854-152053876 AAAAGCTAATAGGATTATAAGGG + Intergenic
1001393207 5:171397383-171397405 CACTGCTAGTGGGAATACAATGG - Intronic
1004291988 6:14375703-14375725 CACAGCTAGGAGAAGTATAAAGG + Intergenic
1008444121 6:51568860-51568882 GACTGTTAGTAGGAGAAAAAGGG - Intergenic
1010446236 6:75951696-75951718 AAATGATACTGGGAGTATAAAGG + Intronic
1010969856 6:82251724-82251746 AAGTGATAGAAGCAGTATAAAGG - Intergenic
1011206434 6:84904232-84904254 AACTGCTGGGATGAGTCTAAGGG + Intergenic
1028085277 7:86628777-86628799 AACTTCTAGTAGCTGAATAATGG - Intergenic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1039679854 8:39720768-39720790 TACTACTAATAGGAATATAATGG + Intronic
1040744490 8:50624562-50624584 TACTGCTACTAGAAATATAATGG + Intronic
1040807531 8:51409804-51409826 AGCTGCTAGAAGGAGCAAAATGG + Intronic
1043076351 8:75706274-75706296 AACAGGTAGTAGGAGAAAAAGGG - Intergenic
1048249308 8:132846915-132846937 AACTGCTAGTAGTGGAATACTGG + Exonic
1051529894 9:18090139-18090161 AATTGCTGGTAGGAATATAAAGG + Intergenic
1053332516 9:37227632-37227654 TACAGCTAGTAGGAATATACAGG - Intronic
1058179607 9:101780547-101780569 AAATGCTTGGAGGAATATAAGGG + Intergenic
1060702419 9:125768368-125768390 AACTTATTTTAGGAGTATAAAGG - Intronic
1188820432 X:34768209-34768231 GACTGCTAGTAGAAGTAGAATGG + Intergenic
1192080093 X:68039483-68039505 AAGTGGTAGCAGGAGTGTAAGGG - Intergenic
1192283163 X:69705496-69705518 TACTGCTACTATGAGTAAAATGG - Intronic
1198434420 X:136602127-136602149 AACTGCTAATATGATTCTAAAGG + Intergenic
1199010079 X:142747185-142747207 AACTGCTTGCAAGAGTATACAGG + Intergenic