ID: 927670896

View in Genome Browser
Species Human (GRCh38)
Location 2:25068046-25068068
Sequence GCTCGTATGCACAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 103}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927670896_927670900 -1 Left 927670896 2:25068046-25068068 CCTGCTTCCCTGTGCATACGAGC 0: 1
1: 0
2: 2
3: 4
4: 103
Right 927670900 2:25068068-25068090 CAGGTGCAGATACCCAGACATGG 0: 1
1: 0
2: 0
3: 19
4: 270
927670896_927670905 16 Left 927670896 2:25068046-25068068 CCTGCTTCCCTGTGCATACGAGC 0: 1
1: 0
2: 2
3: 4
4: 103
Right 927670905 2:25068085-25068107 ACATGGGCTTTCTGAGCCAAGGG 0: 1
1: 0
2: 1
3: 24
4: 178
927670896_927670906 17 Left 927670896 2:25068046-25068068 CCTGCTTCCCTGTGCATACGAGC 0: 1
1: 0
2: 2
3: 4
4: 103
Right 927670906 2:25068086-25068108 CATGGGCTTTCTGAGCCAAGGGG 0: 1
1: 0
2: 3
3: 20
4: 211
927670896_927670907 20 Left 927670896 2:25068046-25068068 CCTGCTTCCCTGTGCATACGAGC 0: 1
1: 0
2: 2
3: 4
4: 103
Right 927670907 2:25068089-25068111 GGGCTTTCTGAGCCAAGGGGAGG 0: 1
1: 0
2: 3
3: 35
4: 285
927670896_927670901 0 Left 927670896 2:25068046-25068068 CCTGCTTCCCTGTGCATACGAGC 0: 1
1: 0
2: 2
3: 4
4: 103
Right 927670901 2:25068069-25068091 AGGTGCAGATACCCAGACATGGG 0: 1
1: 0
2: 1
3: 12
4: 145
927670896_927670904 15 Left 927670896 2:25068046-25068068 CCTGCTTCCCTGTGCATACGAGC 0: 1
1: 0
2: 2
3: 4
4: 103
Right 927670904 2:25068084-25068106 GACATGGGCTTTCTGAGCCAAGG 0: 1
1: 0
2: 0
3: 30
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927670896 Original CRISPR GCTCGTATGCACAGGGAAGC AGG (reversed) Intronic
900935956 1:5766468-5766490 GCATGTATGCACAGGGCAGTGGG + Intergenic
904915953 1:33970750-33970772 GCTCTGAGGCTCAGGGAAGCAGG - Intronic
906798404 1:48715461-48715483 GCTCGTGGGCACAGGGCAGGGGG - Intronic
1064356729 10:14625520-14625542 GCTCATAAGAACAGGGAAACAGG + Intronic
1067239290 10:44476649-44476671 GCTCCTCTGCAGAGGCAAGCTGG - Intergenic
1070437452 10:76407066-76407088 GCTCATATGCACAGGAAGGATGG + Intronic
1070750933 10:78963656-78963678 GCATGTATGCACAGGAAGGCTGG - Intergenic
1072447833 10:95515043-95515065 GCTCGTGGGCACTGGGTAGCTGG + Intronic
1076873680 10:133205623-133205645 CCTCGTCTGCACAGGCCAGCTGG + Intronic
1081583924 11:44371282-44371304 GCACCTCTTCACAGGGAAGCAGG - Intergenic
1084540069 11:69780906-69780928 ACGCGTGTGCACAGGGAGGCAGG - Intergenic
1084843866 11:71883824-71883846 GCCCGAATACACTGGGAAGCTGG + Intronic
1085523400 11:77151068-77151090 GCTCCTGGGGACAGGGAAGCTGG - Intronic
1089085494 11:115813619-115813641 GCTCCTCTTCACAGGGCAGCAGG + Intergenic
1089419750 11:118322684-118322706 GCTGGGGTGCACGGGGAAGCAGG - Intergenic
1089438595 11:118494601-118494623 CCTCGTATTAACAGAGAAGCTGG + Intronic
1089926548 11:122264148-122264170 GCTAGCGTTCACAGGGAAGCTGG + Intergenic
1104741916 12:131183930-131183952 GCACCTCTTCACAGGGAAGCAGG + Intergenic
1113639979 13:111950216-111950238 GTTGCTATGCACAGGGGAGCTGG + Intergenic
1113789842 13:113022422-113022444 GCCCATTTGCACAGGGACGCAGG + Intronic
1118867812 14:69717265-69717287 GCTCCTCTTCACAGGGTAGCAGG + Intergenic
1119217157 14:72877774-72877796 TCACTTATGCACAGGGTAGCAGG - Intronic
1120009731 14:79399971-79399993 ACACATATGCACAGGGAAGAAGG - Intronic
1120316714 14:82903631-82903653 GCTCCTCTTCACAGGGCAGCAGG - Intergenic
1126969913 15:54099189-54099211 ACTCTTAGGCACAGAGAAGCTGG - Intronic
1129782753 15:78284630-78284652 GCTCGTATCCCCTGGGAACCTGG - Intronic
1130048804 15:80466435-80466457 ACTCCTATGTACAGGGAAGCAGG - Intronic
1131425636 15:92343567-92343589 GCTGAAATACACAGGGAAGCAGG + Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134030534 16:10988947-10988969 GCTCGTAAGCCCAGGGAAGAAGG - Intronic
1137544335 16:49390092-49390114 GCTTGTTTGCAATGGGAAGCTGG + Intronic
1141148048 16:81545755-81545777 GCTTCTATGCCCAGGTAAGCTGG - Intronic
1142185030 16:88690787-88690809 GGCCGTATGCACAGGGAATGGGG + Intergenic
1142218328 16:88840824-88840846 GCTGGCCTGCACAGGGACGCTGG + Intronic
1145002397 17:19314476-19314498 GCTGGTGTGAACTGGGAAGCAGG + Intronic
1150431300 17:65119915-65119937 ACTCCTATAGACAGGGAAGCAGG + Intergenic
1152270601 17:79322538-79322560 GCTCGCTTTCACAGGGAAGATGG + Intronic
1152426998 17:80223379-80223401 GCTCGTTGGCACAGGGATGGCGG + Intronic
1152985778 18:319217-319239 GCACACATGCACAGTGAAGCGGG - Intergenic
1154046960 18:10915241-10915263 TCACGTGTGCAGAGGGAAGCAGG + Intronic
1154174702 18:12077787-12077809 TCACGTGTGCAGAGGGAAGCAGG - Intergenic
1158324044 18:56295004-56295026 GCCCGTCAGCAAAGGGAAGCTGG - Intergenic
1160405890 18:78646165-78646187 GCTCAGATGGACAGGGACGCTGG - Intergenic
1161599296 19:5171092-5171114 GCTAACATGCACAGAGAAGCCGG - Intronic
1162819576 19:13214389-13214411 GCTGGTATACACAGGGACCCAGG - Intronic
925128671 2:1479097-1479119 TCCCGTTTGCACGGGGAAGCAGG - Intronic
927670896 2:25068046-25068068 GCTCGTATGCACAGGGAAGCAGG - Intronic
929671435 2:43878964-43878986 GCTCCTCTTCACAGGGTAGCGGG - Intergenic
933132712 2:78692502-78692524 GCACCTCTTCACAGGGAAGCAGG + Intergenic
938592296 2:132751302-132751324 GCTGGAAGGCAAAGGGAAGCAGG - Intronic
938821055 2:134960573-134960595 GCTGGTAAGGAGAGGGAAGCTGG - Intergenic
939052789 2:137328850-137328872 GCACCTCTTCACAGGGAAGCAGG - Intronic
940046919 2:149419667-149419689 GCTCTCATGCACAGACAAGCTGG + Intronic
940596037 2:155794792-155794814 GCACCTCTTCACAGGGAAGCAGG + Intergenic
947089784 2:226496834-226496856 ACTGGTATGCTCAGGAAAGCAGG + Intergenic
1175722137 20:61293927-61293949 GCCCGTAGGCACAGGGAAGCTGG + Intronic
1176366407 21:6035581-6035603 GCTCGTCTTCCCAGGGATGCGGG - Intergenic
1179618575 21:42597813-42597835 GGTCCTAAGCACTGGGAAGCCGG - Intergenic
1179757110 21:43502964-43502986 GCTCGTCTTCCCAGGGATGCGGG + Intergenic
1181314008 22:21960418-21960440 GTTGATATGCACAGGGATGCTGG + Exonic
1181985469 22:26797217-26797239 GCTTGCATGCTCAGGTAAGCCGG + Intergenic
1181985475 22:26797248-26797270 GCTTGTATGCTCAGGTAAGCCGG + Intergenic
1184269579 22:43371381-43371403 GCCCATCTGCCCAGGGAAGCTGG + Intergenic
949896645 3:8772173-8772195 GCTGGTAGCCACAGGGAAGATGG + Intronic
952727746 3:36605918-36605940 GCTCTTGAGCACAGGGCAGCAGG + Intergenic
953292905 3:41684269-41684291 ACTGGTGTGCACAGAGAAGCAGG - Intronic
954177003 3:48852609-48852631 CCTAGAAAGCACAGGGAAGCTGG + Intergenic
954464908 3:50648637-50648659 GCTGGACTGCACAGGGAGGCAGG - Exonic
954686956 3:52376313-52376335 GCAGGTGTGCACAGGAAAGCCGG + Intronic
955579193 3:60400595-60400617 GCTGGCATGCACACAGAAGCAGG + Intronic
956330058 3:68096633-68096655 GCTTGTATTCACAGCCAAGCTGG + Intronic
961102747 3:124215352-124215374 ACTGGTATGCAGTGGGAAGCTGG + Intronic
963805017 3:149714242-149714264 GCCCCTAAGCACAGGGAGGCAGG - Intronic
964945318 3:162216481-162216503 GCACGTCTTCACAGGGCAGCAGG + Intergenic
967924048 3:194632885-194632907 GATCCCACGCACAGGGAAGCTGG - Intronic
968808329 4:2788859-2788881 CCTCCTATCCCCAGGGAAGCAGG + Intergenic
969122324 4:4919524-4919546 TCCCGTCTGCACAGGGAGGCAGG - Intergenic
971362905 4:25953345-25953367 GGTCGCAGGCACAGTGAAGCTGG + Intergenic
973292721 4:48485151-48485173 GCTAGTATGGAAAGGGAAGAGGG - Intronic
975193362 4:71492773-71492795 TCTCGTATTCAAAGGGCAGCAGG - Intronic
975573767 4:75843044-75843066 GTTCATATGCACAGTAAAGCTGG + Intergenic
986247022 5:6017956-6017978 GCTCCTACGCACAGGAAGGCTGG + Intergenic
986927073 5:12767666-12767688 GCTCGTATGCACAGTGCAGCTGG - Intergenic
990186467 5:53215241-53215263 GCACGTCTTCACAGGGCAGCAGG - Intergenic
997379420 5:133424662-133424684 GCTGGTCTGGACAGGGAAGCTGG + Intronic
1005753224 6:28903038-28903060 GCACGTACCCACAGAGAAGCAGG + Exonic
1010001282 6:70952589-70952611 GATAGGATGCACAGGGAGGCAGG + Intronic
1013611458 6:111799855-111799877 GCACGTTTCCACAGGGGAGCTGG - Intronic
1019052453 6:169193471-169193493 GCTTCTATGCAAAGAGAAGCAGG + Intergenic
1024932691 7:54680422-54680444 GCTCGGAGGCACAGGAAAGAGGG - Intergenic
1029148635 7:98464693-98464715 GCTGGTGAGCACAGGGAGGCAGG + Intergenic
1029475100 7:100778657-100778679 TCTGGTGTTCACAGGGAAGCTGG - Intronic
1032262724 7:130350003-130350025 TCTCATATCCACAGGGAGGCTGG - Exonic
1033461518 7:141551263-141551285 GCTCGGATGCTCAGGGACGGTGG - Exonic
1035074361 7:156168753-156168775 GCTTGTCTGCAGAGGGCAGCGGG + Intergenic
1037508791 8:19560822-19560844 GCTGGTATGCACTGGAATGCAGG + Intronic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1044100135 8:88124865-88124887 GTGAGTATGCACAGAGAAGCTGG - Intronic
1048885612 8:138907023-138907045 GCTCTTATCCACAGAGTAGCCGG - Intronic
1051777104 9:20646902-20646924 GCTCCTGTGGACAGAGAAGCAGG + Intergenic
1053045798 9:34916029-34916051 GCACCTCTTCACAGGGAAGCAGG - Intergenic
1057749282 9:97778746-97778768 GCACGTATTCACAGGGTGGCAGG - Intergenic
1059506307 9:114802847-114802869 GCCTGAATGCACAGGGAAGGAGG + Intronic
1060440348 9:123632869-123632891 GTGCCTATGCACAGGGAACCAGG - Intronic
1062183178 9:135202159-135202181 GCTGGTAAGCCCTGGGAAGCTGG + Intergenic
1188657841 X:32719904-32719926 GCACGTGTGCACATGCAAGCTGG - Intronic
1189326764 X:40117007-40117029 GCTTGCAGGCACAGGGAACCCGG + Intronic
1189891741 X:45610226-45610248 GCTGGGATGCACAGGGCTGCTGG + Intergenic
1192560188 X:72123206-72123228 CCTCGTATGTACAGAAAAGCAGG + Intergenic
1197995250 X:132366043-132366065 GCTGGTTTGCACACAGAAGCAGG + Intergenic