ID: 927672001

View in Genome Browser
Species Human (GRCh38)
Location 2:25076300-25076322
Sequence CTGCCTTTTTTCTCCTAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 1, 2: 1, 3: 33, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927671997_927672001 0 Left 927671997 2:25076277-25076299 CCAACATTCCATTTTATTCTACC 0: 1
1: 0
2: 3
3: 21
4: 308
Right 927672001 2:25076300-25076322 CTGCCTTTTTTCTCCTAAGTTGG 0: 1
1: 1
2: 1
3: 33
4: 287
927671998_927672001 -8 Left 927671998 2:25076285-25076307 CCATTTTATTCTACCCTGCCTTT 0: 1
1: 0
2: 2
3: 53
4: 503
Right 927672001 2:25076300-25076322 CTGCCTTTTTTCTCCTAAGTTGG 0: 1
1: 1
2: 1
3: 33
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927672001 Original CRISPR CTGCCTTTTTTCTCCTAAGT TGG Intronic
900075076 1:807941-807963 CTGCCTTTCTTTTGCCAAGTTGG - Intergenic
900766157 1:4507127-4507149 CTGCCTTGTTTGTCCTGCGTGGG + Intergenic
901523669 1:9805462-9805484 CTAGCTGTTTTCTCTTAAGTTGG + Intronic
902568341 1:17330638-17330660 CTGCCTTCTTTCTCCAATGCTGG - Intronic
902727410 1:18346485-18346507 CTGCATTTATTGTCCTAAGTTGG - Intronic
903503706 1:23817484-23817506 CAGCTTTGTGTCTCCTAAGTGGG - Exonic
906013941 1:42556158-42556180 CTGCTTTCTTTCTCCTAATTTGG - Exonic
906769149 1:48468679-48468701 GTTCCTTTTTTTTCCTCAGTTGG - Intronic
907006122 1:50915709-50915731 ATACCTTTTTTCTCGTAAGAAGG - Intronic
907553279 1:55322845-55322867 TTCCTTTTTTTCTCCTAATTGGG - Intergenic
908139234 1:61166460-61166482 CTGCTATTTTTCTTCTCAGTTGG - Intronic
908512584 1:64861169-64861191 CTGTTTCTTTTCTCCTAAGCAGG - Intronic
908513920 1:64873200-64873222 CTGCCTTTTTTCTCCTCACTTGG + Intronic
908918286 1:69158238-69158260 CTGCCTTTCTTCTCCTTCCTAGG + Intergenic
911537002 1:99112385-99112407 CTGCATGTTCTCTCATAAGTGGG - Intergenic
912658061 1:111505339-111505361 CTGCCTTTATTCTCTCTAGTGGG - Intronic
914767407 1:150650859-150650881 CTGCTTTTTTTCTTCTGAATGGG - Intronic
916017022 1:160759020-160759042 CTGCCTTTTTTGTTCTATTTAGG + Intergenic
916155063 1:161836857-161836879 TTTCCTTTTATCTCTTAAGTTGG - Intronic
917655534 1:177121972-177121994 CTGCCAGTTTTGTGCTAAGTGGG - Intronic
918148305 1:181777137-181777159 CTGCCTTTATACTCCAAAGCAGG - Intronic
918461851 1:184784728-184784750 CTTCCTTTTATCTCCTCAGAAGG + Intergenic
921706407 1:218326648-218326670 CAGACCTTTTTCTTCTAAGTAGG - Intronic
921911192 1:220551087-220551109 CTGCCTTCTGTCTTCTAAGATGG + Intronic
922270916 1:224032840-224032862 CTGCCTTTCTTTTGCCAAGTTGG - Intergenic
924708051 1:246513845-246513867 CTGCCTTGTTTCTCCTTTATGGG - Intergenic
1063293201 10:4772848-4772870 CTTCCTTTGTTCCGCTAAGTCGG - Intergenic
1063720185 10:8572680-8572702 CTCCCTCTTTTCTCATATGTAGG + Intergenic
1063906025 10:10781070-10781092 CTACCTTTTTTTTGGTAAGTGGG - Intergenic
1063972174 10:11388887-11388909 GTACCTCTTTTCTCCTAAGCTGG - Intergenic
1064181861 10:13123915-13123937 CAGCCTGTTTTCTCCTAAAGAGG + Intronic
1064528559 10:16283714-16283736 CTACCTTTTTTCTCAGAAGCAGG + Intergenic
1064617961 10:17182226-17182248 CAGCCTTGTTTCTTCTAGGTTGG - Intronic
1065045240 10:21741814-21741836 CTCCCTTTTTTCTTGCAAGTTGG - Intronic
1068135309 10:52947273-52947295 CTGCTATTTCTCTCCTAAGGAGG - Intergenic
1071124270 10:82316116-82316138 GTGCCTTCTCTCTCCTATGTAGG + Intronic
1071436892 10:85655694-85655716 CTGCTTCTTTTTTCCTAAGAAGG + Intronic
1072182622 10:93001686-93001708 TTCCCATTTTTCTCCTCAGTTGG + Intronic
1072208811 10:93227959-93227981 CTGATTGTTTTTTCCTAAGTAGG - Intergenic
1073476955 10:103760112-103760134 CTGCCCTTTTGCTCCCAAGATGG - Intronic
1074211192 10:111336744-111336766 CTGCCTTCTTACTGCTGAGTAGG + Intergenic
1074216850 10:111393697-111393719 CTGCATTTCTTCACCTAAGAAGG - Intergenic
1074266257 10:111906530-111906552 CTCCCTTGCTTCACCTAAGTGGG + Intergenic
1075474274 10:122719814-122719836 ATGCCTTTTTTTTCCTACGTTGG + Intergenic
1077695177 11:4386987-4387009 CTGTCTCTTTTCTCCTCAGGAGG - Exonic
1078616585 11:12871603-12871625 CTGCCTTTTTGCTGCTAATGGGG - Intronic
1078667450 11:13338583-13338605 CTGCCCTCTTTCTCCTACTTGGG + Intronic
1079467120 11:20741506-20741528 CTGCCCTTTTTATCCTAATCAGG - Intronic
1079699718 11:23529669-23529691 CTGCCTTCTGTGTCCTCAGTTGG + Intergenic
1080188307 11:29518678-29518700 CTGTTTTTTTGCTCCTAACTGGG - Intergenic
1080346104 11:31327639-31327661 CTTCCTTTTTTCTACTTTGTGGG - Intronic
1082076397 11:47979459-47979481 CTGCCTCGTTTCTGCCAAGTTGG + Intergenic
1082085285 11:48044977-48044999 CTCCCTTTTTTCTCCTCCCTGGG + Intronic
1087667651 11:101069771-101069793 CTGCATATTCTCTCATAAGTGGG + Intronic
1087668345 11:101076233-101076255 CTGCATGTTCTCTCATAAGTGGG + Intronic
1095140411 12:38655936-38655958 CTGCCTTTCTTGCCCTTAGTAGG - Intronic
1098223547 12:68296979-68297001 CTGCCTTTTTTTTTTTAAGTGGG - Exonic
1099417213 12:82405458-82405480 CTGCCTTTTTTATCTGATGTTGG + Intronic
1099566202 12:84249745-84249767 CTGACTTTTTTCCCCCAATTGGG - Intergenic
1099906155 12:88772530-88772552 CTGCCTCTTTTCTTCTTATTAGG + Intergenic
1106457748 13:29942328-29942350 CTGCCTTCTTTCTCCCTGGTCGG + Intergenic
1106666153 13:31852787-31852809 TTGCCTTTTTTGTCCTGAGTGGG - Intergenic
1107283773 13:38766220-38766242 CTGCCTCTTTTTTCTTAAGCTGG + Intronic
1108902891 13:55435156-55435178 CTGCCCTGTTTCACCCAAGTCGG - Intergenic
1109008940 13:56914626-56914648 GTGCCTTTTTTCTCCTAAGTAGG + Intergenic
1109662628 13:65484352-65484374 CTGCATGTTCTCTCATAAGTGGG - Intergenic
1111650297 13:91081962-91081984 CAGCCTGTTTTCTACTAAGTAGG + Intergenic
1116176976 14:41483561-41483583 TTTCCTTTTATCTCCAAAGTGGG - Intergenic
1116673020 14:47868129-47868151 CTGATTTTTTTGTCCTAATTTGG + Intergenic
1117256425 14:53982742-53982764 CAGTCTTTTTTCTCCTAGGTGGG + Intergenic
1118073450 14:62271367-62271389 CTGCTTTTACTCTTCTAAGTAGG + Intergenic
1119671011 14:76518433-76518455 CTGCCTTATTTCTTCTGGGTGGG - Intergenic
1120306695 14:82779964-82779986 TTGCCTTTTTATTCCTATGTGGG - Intergenic
1120588343 14:86344792-86344814 CTTTTTTTTTTCTCCTGAGTGGG + Intergenic
1120899933 14:89566928-89566950 TTGCCTTTTTTCCTCTAAGGTGG + Intronic
1121120902 14:91375434-91375456 CTTCCTTTTTTCCTTTAAGTAGG + Intronic
1121858660 14:97295009-97295031 TGGCCTCCTTTCTCCTAAGTCGG - Intergenic
1122361463 14:101169342-101169364 CTGCCTGTTTGCTGCTGAGTGGG + Intergenic
1124996360 15:34726874-34726896 CTTCAGTTTTTCACCTAAGTAGG - Intergenic
1125121097 15:36159504-36159526 CTGCCTTTCTTCTTCTATATTGG - Intergenic
1125188499 15:36961615-36961637 GTGGCTTTTTTTTCCTAATTTGG + Intronic
1125531020 15:40413514-40413536 CTGCCTTCTCTCTACTGAGTCGG - Intronic
1126085081 15:45003991-45004013 CTTCCTTTTTTGTCATTAGTGGG + Intergenic
1126547535 15:49889403-49889425 CTCCCTTTTGTTTCCTATGTTGG - Intronic
1127951040 15:63806731-63806753 CTGCCTTTGTTGTTGTAAGTTGG + Intronic
1131855439 15:96588646-96588668 CTACTTTGTTTCTCCTAAGAGGG + Intergenic
1131903571 15:97116136-97116158 TTGCCTTTCTTCTCCTTAGTTGG - Intergenic
1134048912 16:11123284-11123306 CTTCCTTATTTCTTCTAAGAAGG - Intronic
1134386012 16:13773318-13773340 CTGCCTTTTTTTTGTTAGGTTGG - Intergenic
1135960247 16:26988877-26988899 TTGCCTTTTTTCCCCTGAGGGGG - Intergenic
1136272826 16:29158646-29158668 CTGCCTGTGTTCTCCCAGGTGGG - Intergenic
1137453171 16:48596460-48596482 CTGGCTGCTTTCTCCTAACTGGG - Intronic
1137568430 16:49548999-49549021 TTGCATTTTTTTTCTTAAGTGGG + Intronic
1138717192 16:59037088-59037110 CTGCCTCCTTTCTACTAGGTTGG - Intergenic
1140733912 16:77880824-77880846 CTGCATGTTCTCTCCTAAGTGGG - Intronic
1142076382 16:88120458-88120480 CTGCCTGTGTTCTCCGAGGTGGG - Intergenic
1143195434 17:5072784-5072806 CTGCCTTTCTTCTTTTAACTAGG - Intergenic
1143287959 17:5805295-5805317 CTGCCTTGTTACTGCTAGGTGGG + Intronic
1145297250 17:21601433-21601455 CTGCCTGTTATCTCCTCAGAGGG - Intergenic
1145366702 17:22271467-22271489 CTGCCTGTTATCTCCTCAGAGGG + Intergenic
1145777770 17:27541170-27541192 CTGACTCCTTTCTCCTCAGTAGG - Intronic
1146074265 17:29713385-29713407 CTGCCTTTGTTCTCTTCAGATGG - Intronic
1148131996 17:45267606-45267628 CTGCCTGTTGTCTCCTCAGCTGG + Exonic
1148360372 17:47007075-47007097 CTGCCCTTTTTTTCCTAAATGGG - Intronic
1148700485 17:49583823-49583845 CTGTCTTTTTTTTTCTAAGATGG + Intronic
1149300265 17:55298781-55298803 TGGCCATTTTTCTCCTATGTAGG + Intronic
1149516884 17:57287635-57287657 CTGCCTTTCGGCTCCTACGTGGG + Intronic
1149998295 17:61416451-61416473 CTGCCTTCTTCCTCCTGAGTTGG + Intergenic
1151240464 17:72753588-72753610 CTCCCTGTTTTCTCCAGAGTAGG + Intronic
1154093796 18:11391124-11391146 TTGCTTTTTTCCTCCTAACTTGG + Intergenic
1154176802 18:12091502-12091524 CTGGCTTTTTTTTCCAAAGTTGG + Intergenic
1155001870 18:21695447-21695469 CTGCTTTTTTTCTCCTTCTTGGG + Intronic
1155029925 18:21975040-21975062 ATTCTTTTTTTCTCCTAAGATGG - Intergenic
1155199926 18:23508314-23508336 TTGCCCTTTTTCTCCTCACTGGG + Intronic
1155413749 18:25573498-25573520 CTGAATTTTTTCTCCCAAGCTGG + Intergenic
1157172275 18:45418835-45418857 ATGCCTTTTTTTTCCTCAGAAGG - Intronic
1157180861 18:45496828-45496850 CTGCCTTCTTTCTCCCATGCTGG + Intronic
1157596439 18:48866934-48866956 CTGCCTTCTTAGTCCTAAGATGG + Intergenic
1159306244 18:66646770-66646792 CTCCTTTTTTTCTCCTATATTGG + Intergenic
1159859653 18:73631963-73631985 TTGCCTTTTTTATGCCAAGTTGG - Intergenic
1163917997 19:20259655-20259677 CTGCTTTGTTTCTTCTAAGTAGG + Intergenic
1165067438 19:33237259-33237281 CTGCCTTTGATCTCAAAAGTAGG + Intergenic
1167697908 19:51025768-51025790 CAACCTTGTTTCTCCCAAGTGGG - Intronic
1167873192 19:52390401-52390423 CTGCCTTTTTCCTCCTTGATCGG + Intergenic
1168498768 19:56875890-56875912 TTGCCTTTTTTCTTCTCAGAGGG + Intergenic
926011020 2:9407924-9407946 CTTCCTTTTCTCTCCTGTGTTGG - Intronic
926457657 2:13087905-13087927 CTTCCTTTTTGTTCCTAAGCAGG + Intergenic
926855673 2:17253319-17253341 TTCACTTTTTTCTCCTAAATGGG - Intergenic
927672001 2:25076300-25076322 CTGCCTTTTTTCTCCTAAGTTGG + Intronic
928961268 2:36928645-36928667 CTGCCTTTTTTTTTTTAAGATGG - Intronic
929437708 2:41940879-41940901 CTGCCTTTTTTCTTCTCTCTGGG - Intronic
930745636 2:54880568-54880590 CTTCCCTTTTTCTCCGAAGATGG - Intronic
931592236 2:63897749-63897771 CTACATTTTTTCTCCTTAGTTGG + Intronic
931646970 2:64432788-64432810 CTGCCTTATTCTTCCTAGGTGGG + Intergenic
931743350 2:65268971-65268993 CTGCTTTGTTTCTTCTAAGTAGG + Exonic
932205484 2:69877329-69877351 CTTCCTTCTTTCTCCAGAGTTGG + Intronic
932962613 2:76431957-76431979 CTGCCTTTTTCTTCCAAAATAGG + Intergenic
933648477 2:84830833-84830855 CTGCCCTCTTTCTCCTCAGAAGG - Intronic
933939142 2:87231188-87231210 CTGCCTTTTTTATTCTACTTGGG - Intergenic
934673856 2:96235423-96235445 CTGCCTTTTCTTTCTTATGTTGG - Intergenic
934864279 2:97792023-97792045 CTGCCTTTTAACTCCAAATTAGG - Intronic
935564973 2:104596679-104596701 CTGCCTTTTTATACATAAGTTGG + Intergenic
936353991 2:111734587-111734609 CTGCCTTTTTTATTCTACTTGGG + Intergenic
940247067 2:151630901-151630923 CTGGCTTATTTTTCCTAATTAGG - Intronic
941252459 2:163183249-163183271 CTATCTTTTTTCCCCAAAGTTGG + Intergenic
943530440 2:189073039-189073061 CTCCCTTGTTTCTCATAAGTAGG - Intronic
944825991 2:203483739-203483761 CTGCCTTTTTTGTTCTATCTGGG - Intronic
945224434 2:207519099-207519121 CTGCCCTTTTTGTCCTCAGAAGG + Intergenic
945679970 2:212902334-212902356 ATTCCTTTTTTTTCATAAGTAGG + Intergenic
947518273 2:230825609-230825631 CTGCCTTTTTTCTCATGATTAGG + Intergenic
948483864 2:238267752-238267774 CTGCCTTTTGTCCACAAAGTGGG - Intronic
949009302 2:241669354-241669376 CTGCCTTCTTCCTCCTAAATGGG - Intronic
949082647 2:242116843-242116865 CTGCCTTTCTTTTGCCAAGTTGG + Intergenic
1170139391 20:13110683-13110705 CTGCCTGTTTTCCCCAAGGTAGG + Intronic
1171960990 20:31494053-31494075 TTTCCTTTTTTCACGTAAGTGGG + Intergenic
1172333471 20:34093322-34093344 CAGACTTTTTTTTCCTAAATTGG - Intronic
1173883082 20:46433541-46433563 CTGCCTTTTTTGTTCTATGCGGG - Intergenic
1174124270 20:48291150-48291172 TATTCTTTTTTCTCCTAAGTAGG - Intergenic
1175884156 20:62279434-62279456 CTGTCATTTTTCTCCTGAGGTGG + Intronic
1176343853 21:5723127-5723149 GTGCCTTATCTCACCTAAGTTGG - Intergenic
1176500974 21:7601329-7601351 GTGCCTTATCTCACCTAAGTTGG + Intergenic
1176538174 21:8121196-8121218 GTGCCTTATCTCACCTAAGTTGG - Intergenic
1178165097 21:29964894-29964916 CTGCCTTTTTGCTACAAAGCAGG + Intergenic
1180072559 21:45443603-45443625 CGGCCCTTTTTCTCCCACGTGGG + Intronic
1181710965 22:24688329-24688351 CTGCTTTGTTTCTTCTAAGTAGG + Intergenic
1182043307 22:27255056-27255078 CTGCCTGTTTTCTCCTTCATGGG - Intergenic
1203243121 22_KI270733v1_random:37552-37574 GTGCCTTATCTCACCTAAGTTGG - Intergenic
950211262 3:11125303-11125325 CTGCCTCTTTTCCTCTCAGTGGG - Intergenic
950838964 3:15948461-15948483 ATTCTTTTTTCCTCCTAAGTAGG - Intergenic
951059175 3:18184456-18184478 CTGCCCTATTTCTCCTAATTTGG + Intronic
952526525 3:34216312-34216334 CTGCCTTTCTTATCCTAACATGG - Intergenic
952939995 3:38436049-38436071 ATTCCTTTTTTCTGCTAATTTGG - Intergenic
953205930 3:40829021-40829043 TTCCCTTTTCTCTACTAAGTGGG + Intergenic
953247170 3:41204634-41204656 CTGATTTCTTTCCCCTAAGTGGG + Intronic
954099710 3:48360300-48360322 CTTCCTTGTTACTCCCAAGTGGG - Intergenic
955043780 3:55340781-55340803 CTGCCTTTTTTGTTCTATTTGGG - Intergenic
955118212 3:56027149-56027171 CTTCCTTTTTATTGCTAAGTAGG + Intronic
955611840 3:60765863-60765885 CTGCCTTCTTTCTCCCATGCTGG + Intronic
955642928 3:61105975-61105997 TGGCCTTTTATCTGCTAAGTTGG - Intronic
955785545 3:62534257-62534279 TTGCCTTTTCTCTCCCAAGATGG - Intronic
956237513 3:67090733-67090755 CTGCCTTTTTTATTCTATCTGGG - Intergenic
956286015 3:67611041-67611063 CTGCCTTTTGTCTCCTGATATGG + Intronic
956878420 3:73486954-73486976 ATGTCTTTTTGCTCCAAAGTTGG + Intronic
957258910 3:77875183-77875205 GTGCCTTTTTTGTCCTTTGTGGG - Intergenic
959592985 3:108099646-108099668 CTGCCTTTTGTATCCTTAGAGGG + Intergenic
959837788 3:110941048-110941070 TTGCCTTATTTCTGGTAAGTAGG - Intergenic
960269401 3:115658247-115658269 TTGGTTTTTTTTTCCTAAGTAGG + Intronic
960439885 3:117674033-117674055 TTTCCTCTTTTCTCCTAACTAGG - Intergenic
960644508 3:119864167-119864189 CTGCATTTTTTTTCTCAAGTAGG + Intronic
960886072 3:122396316-122396338 CTGCCTATTTTTTTTTAAGTAGG - Intronic
962724613 3:138211017-138211039 TTGCCTTTGTTCCCTTAAGTAGG + Intronic
963086539 3:141442127-141442149 CTTCCCCTTTTCTCCAAAGTTGG - Intronic
963347577 3:144113562-144113584 CTGCCGTTTTTCTAATATGTTGG - Intergenic
964779108 3:160315491-160315513 CTCCCATTTTGTTCCTAAGTAGG - Intronic
965783807 3:172315603-172315625 CTGCCTTTCTGCTCCTAATGGGG - Intronic
966984495 3:185166928-185166950 CTGACTTTTTTCTCTTGAGAGGG - Intergenic
967416344 3:189222902-189222924 CTGCCTTGTTTCTGCTAACCCGG + Intronic
968918595 4:3510525-3510547 TAGGCTTTTTTCTCCTAATTTGG - Exonic
970778691 4:19709264-19709286 CACCCTTTCTTCTCCTAAATAGG + Intergenic
970871151 4:20818408-20818430 CTGCTTTTCTTCTGATAAGTTGG - Intronic
971472442 4:27041151-27041173 CTGCAGTTTTTCTCCTTTGTTGG + Intergenic
971778659 4:31002114-31002136 CTGAATTTTTTCACCTAATTGGG + Intronic
971782084 4:31049400-31049422 ATGCCTGGTTTCTCCTAACTAGG - Intronic
973608634 4:52612243-52612265 ATGCCTTTTTTATACGAAGTTGG - Intronic
974934954 4:68400368-68400390 TTGCCTTTTTTCTGAGAAGTAGG - Intergenic
975229079 4:71909267-71909289 CAGCCTTTTTTCCCCTAACTGGG + Intergenic
975422269 4:74180896-74180918 ATTCTTTTTTTCTTCTAAGTAGG + Intronic
977175365 4:93813810-93813832 CTGCATTGTTACTGCTAAGTGGG + Intergenic
979009436 4:115348729-115348751 ATACCTTTTTTGTCCTACGTGGG - Intergenic
979300412 4:119080364-119080386 CTGGCTTTCTTTTCCTGAGTGGG - Intergenic
980264318 4:130495455-130495477 CTGCACTTTTTTTTCTAAGTGGG + Intergenic
980501405 4:133658962-133658984 CTGCCTTTTTTTTTCTATTTAGG + Intergenic
981290776 4:143071918-143071940 CTGTTTTTTTTCTTCTCAGTGGG + Intergenic
981671167 4:147288627-147288649 TTGCCTTTTTTCTCCTACTGAGG - Intergenic
983595705 4:169464820-169464842 CTGCTTTATTTATCATAAGTAGG + Intronic
983622388 4:169774746-169774768 CTGCCCTTCATCGCCTAAGTGGG - Intergenic
987015444 5:13813592-13813614 CTGCTTTTATTCTCCTTAATGGG + Intronic
987689435 5:21247803-21247825 CTGCACTTTTTTTTCTAAGTGGG - Intergenic
988087820 5:26494550-26494572 CTGCCTTTCTTCTCTGCAGTAGG + Intergenic
988494055 5:31729569-31729591 CTGCCTTTTTTCTACTACCCTGG + Intronic
989451664 5:41593642-41593664 CAGCCTGTTTTGTCCTTAGTAGG + Intergenic
990063627 5:51683787-51683809 CCGCCTTTCTTCCCCTAAATGGG - Intergenic
992129301 5:73675300-73675322 CTGTTTTTTTTCTACTGAGTGGG + Intronic
992356904 5:75995078-75995100 CTGCCTTTTTTTTTCTATTTAGG + Intergenic
993165644 5:84351406-84351428 CTGCCTGTTTTCATCTATGTAGG + Intronic
993449746 5:88059313-88059335 TTGCTTTTTTTCTCCCAAGATGG + Intergenic
993655008 5:90567070-90567092 CTGCTTTTTTTCTATTAATTTGG + Intronic
994839620 5:104906128-104906150 CAGCATTTTTTCTACTATGTAGG + Intergenic
994850025 5:105042970-105042992 TTGCCCATTTTTTCCTAAGTTGG - Intergenic
995379992 5:111521223-111521245 CTGATTTTTTTCTCCTAAGGAGG + Intergenic
995717902 5:115098347-115098369 TTGCTTTTTTCCTCCTAACTAGG + Intergenic
996855391 5:128000100-128000122 CTGCCTTTGATGTCCTCAGTAGG - Intergenic
997507551 5:134430106-134430128 CTGCCTTCTTCCTCCTGAGAGGG - Intergenic
998009905 5:138686486-138686508 CTGCCTTTTTTCTTATACATTGG + Intronic
999060821 5:148633105-148633127 CTGCCTGTTGACTGCTAAGTTGG + Intronic
999523956 5:152382135-152382157 CTGCATATTCTCTCATAAGTGGG - Intergenic
999592426 5:153162982-153163004 CTCCCTTTTTTCTTCTGGGTGGG + Intergenic
1000565568 5:162842774-162842796 CTGCTTTCTTTCTCGTAGGTGGG - Intergenic
1004174655 6:13328924-13328946 CTGCCTTTTTTCTTCTCATTCGG - Intergenic
1004212840 6:13669669-13669691 CAGCCTTTTTTCTCCCGATTAGG + Intronic
1005322655 6:24669938-24669960 TTTCCTTTTTTTTCCTAATTAGG - Intronic
1009658896 6:66583918-66583940 CTGCCTTTTGTCTCCTATATTGG - Intergenic
1010190248 6:73187953-73187975 CTGCCTTTTTTGCCCTAATGGGG - Intronic
1010437268 6:75847514-75847536 CTTCTTTTTTTCTTCTGAGTTGG + Intronic
1010762827 6:79744373-79744395 CTTCTTTTTTTCTCCTTATTTGG - Intergenic
1010767819 6:79796302-79796324 CTGCCCTTTTCCTCTGAAGTAGG + Intergenic
1012015492 6:93844296-93844318 CTGCTTTTTTTCCCCTAAATTGG + Intergenic
1012530884 6:100234940-100234962 CTCTCTTTCTTCTCCTAAATTGG - Intergenic
1014352936 6:120366643-120366665 CTGCATTCTTACTCATAAGTGGG + Intergenic
1014453675 6:121612335-121612357 CTGCCTGCTTTCTCCTCACTGGG + Intergenic
1015121210 6:129703399-129703421 CTGCCTTGTCTCTTCTAAGTGGG - Intronic
1016235633 6:141861450-141861472 CTGATTTTTTTTTCCTAACTTGG + Intergenic
1016770890 6:147849439-147849461 GTACTTTTTTTCTCCTAAGGAGG + Intergenic
1017196072 6:151701773-151701795 CAGCCTTATTTCACTTAAGTGGG + Intronic
1018658970 6:166067553-166067575 CTTCCTTTTTTCTCATTTGTTGG - Intergenic
1018717789 6:166547265-166547287 CTGCCTTCCTTCCTCTAAGTCGG - Intronic
1019204714 6:170350374-170350396 CTGCCTGTGTTCTCCAAAGCTGG - Intronic
1021479453 7:21100005-21100027 CAGCCTTTTTTCTACAAAATAGG - Intergenic
1022243627 7:28535820-28535842 CTCCTTTTTTTCTCCTTGGTTGG + Intronic
1024093261 7:45965044-45965066 CTGCCTTTGCTCCCCTATGTGGG - Intergenic
1027431377 7:78116349-78116371 CTTTTTTTTTTTTCCTAAGTTGG - Intronic
1029300631 7:99580100-99580122 CTGCCCTTCATCGCCTAAGTGGG - Intronic
1030832274 7:114239650-114239672 ATGCCTTTTTTTGTCTAAGTAGG - Intronic
1030886375 7:114943388-114943410 TTGTTTATTTTCTCCTAAGTTGG - Intronic
1031287763 7:119893054-119893076 CTGTCTTTTTTTTTTTAAGTTGG - Intergenic
1032717067 7:134518506-134518528 CTTCTTTTTTTCCCCCAAGTTGG + Intergenic
1032946177 7:136855394-136855416 CTGCATGTTCTCTCATAAGTGGG - Intergenic
1033715232 7:143995396-143995418 CTACCTATTTTCTCTTATGTGGG - Intergenic
1033837873 7:145337267-145337289 TTGACTTTTTTCTCAGAAGTTGG + Intergenic
1034046378 7:147932853-147932875 TTGCTTTTTTACTCTTAAGTTGG - Intronic
1035031990 7:155866699-155866721 CTGCCATTTGTCTCCTGAATGGG - Intergenic
1035053293 7:156016975-156016997 CTGCCTCTTTTCCCCTGGGTTGG - Intergenic
1035540570 8:433546-433568 CTGCCTTTCTTTTGCCAAGTTGG + Intronic
1038024238 8:23574668-23574690 CTGGCCTTTATCTCCAAAGTTGG + Exonic
1040936639 8:52788612-52788634 CTGCCTTTTTTGTCCTTTCTTGG + Intergenic
1042161479 8:65900761-65900783 CTGACCTTTTTCTCATAAGGTGG + Intergenic
1043150723 8:76712392-76712414 GTGCCTTTTTTTTTCTTAGTAGG + Intronic
1043830385 8:84981253-84981275 CTGACTTTTCCCTCATAAGTTGG + Intergenic
1044221898 8:89678939-89678961 CTGCCTGTATTCTCCAAAGCCGG - Intergenic
1044940603 8:97338569-97338591 ATGCATATTTTATCCTAAGTGGG - Intergenic
1045595547 8:103650738-103650760 CTGCCTGTATTCTTCAAAGTTGG + Intronic
1045623989 8:104020316-104020338 TTGCCTTTTTTCCCATTAGTAGG - Intronic
1046528413 8:115412212-115412234 CTACCCTTTTTTTCCTAAGTAGG + Exonic
1047675926 8:127201608-127201630 TTTGCCTTTTTCTCCTAAGTTGG + Intergenic
1048046645 8:130779133-130779155 TTCCCTTTTTTCTCCTCAGATGG + Intergenic
1049134814 8:140886839-140886861 CGTCATTCTTTCTCCTAAGTAGG + Intronic
1050142048 9:2526246-2526268 CTGCCTTTATACTCCTGAGGAGG - Intergenic
1052966291 9:34343102-34343124 CTTCCTCTTTTCTCCTAACTAGG + Exonic
1057954082 9:99393439-99393461 CTGCCTTGTTTCTCCTTCCTGGG + Intergenic
1058104520 9:100955309-100955331 CTGCCTGTCTTCTCCTGAGCTGG - Intergenic
1058336497 9:103836168-103836190 CTCCCTTTTTTTTTGTAAGTAGG - Intergenic
1059166487 9:112081228-112081250 CTTCCTTTTTTCACGTAATTTGG - Intronic
1059355389 9:113695614-113695636 TTGCTTTTTTTCTCCCAATTTGG + Intergenic
1059501105 9:114754987-114755009 CTTCCTTTGTTCTCCTAAACAGG + Intergenic
1059714325 9:116899518-116899540 CTGTCATATTTCTCCTATGTTGG - Intronic
1059790664 9:117638483-117638505 CAGCCTTATTTCTTCTAATTTGG - Intergenic
1059798214 9:117722946-117722968 ATCCCGTTTTTTTCCTAAGTTGG - Intergenic
1059817678 9:117936156-117936178 CTGCCTTTTTTCTTCCAGGCAGG - Intergenic
1059980068 9:119761838-119761860 CTGACTTTTTTTTTCTAAGAAGG - Intergenic
1060023462 9:120151507-120151529 CTGCCTTCTTTCTCCTAGGCTGG - Intergenic
1060482214 9:124023152-124023174 CTGCCTTTTCTCTGCTTAGTAGG + Intronic
1061611107 9:131746521-131746543 TGGCCTTTTTTCTCACAAGTAGG + Intergenic
1061928224 9:133818055-133818077 CTGCCTTTTTTGTTCTACGTGGG - Intronic
1062107435 9:134763671-134763693 TTGCCTTTTTTCTCCTCTGCAGG + Exonic
1062143499 9:134973931-134973953 CTTCCTTTTCTCTCCTTTGTAGG - Intergenic
1203459446 Un_GL000220v1:20634-20656 GTGCCTTATCTCACCTAAGTTGG - Intergenic
1186561628 X:10619285-10619307 CTTCACTTTTTCTTCTAAGTGGG - Intronic
1188087590 X:25920072-25920094 CTGCCTGTTCTCTCATAAGTAGG + Intergenic
1188439114 X:30197265-30197287 CTGCCTTTTTTGTTCTATGCAGG - Intergenic
1189474356 X:41338097-41338119 TTGCTTTTTTTCTTCTAAGGGGG + Intronic
1190367774 X:49713125-49713147 CTCCCTTTCTCCTACTAAGTTGG - Intergenic
1190423749 X:50311799-50311821 TTGGCATTTTTCTCTTAAGTTGG + Intronic
1190522618 X:51295674-51295696 CTGCCTTTTTTTTCAGAGGTAGG - Intergenic
1192579178 X:72266774-72266796 CTCCCTTTTTTCTCCCAAGATGG + Intronic
1195664010 X:107412033-107412055 CTTCTTTTTTTCTGCTAACTTGG + Intergenic
1195780931 X:108463144-108463166 CTTCCTTTTTTTTACTAAGAAGG - Intronic
1197430426 X:126355973-126355995 CTGCCTTTTTTTTCCTCTCTGGG + Intergenic
1198031089 X:132754208-132754230 CTGATGTTTTTCTCATAAGTAGG + Intronic
1198399648 X:136256577-136256599 CTGCCATTTCCCTCCAAAGTGGG + Intergenic
1198708607 X:139476983-139477005 CTGCCTTTTTTGTTCTACCTGGG - Intergenic
1199938805 X:152603963-152603985 CTTCCTTTTTGCTCCCAACTTGG + Intergenic
1201438079 Y:13980761-13980783 CTGCCCTGTTTCTTCTAACTGGG - Intergenic
1201719843 Y:17084491-17084513 CTTCCTTTTCTCTCCTATGCAGG + Intergenic