ID: 927672247

View in Genome Browser
Species Human (GRCh38)
Location 2:25078578-25078600
Sequence CAGCAGGGCTGGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1058
Summary {0: 1, 1: 0, 2: 10, 3: 121, 4: 926}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927672247_927672257 21 Left 927672247 2:25078578-25078600 CCAGCTTCCCTCCAGCCCTGCTG 0: 1
1: 0
2: 10
3: 121
4: 926
Right 927672257 2:25078622-25078644 GTCAGAAGAAAATGAGACCTAGG 0: 1
1: 0
2: 5
3: 45
4: 425
927672247_927672256 -1 Left 927672247 2:25078578-25078600 CCAGCTTCCCTCCAGCCCTGCTG 0: 1
1: 0
2: 10
3: 121
4: 926
Right 927672256 2:25078600-25078622 GGGCTCAGGATACTGTATTGAGG 0: 1
1: 0
2: 1
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927672247 Original CRISPR CAGCAGGGCTGGAGGGAAGC TGG (reversed) Intronic
900003525 1:29232-29254 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900023245 1:199748-199770 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900482942 1:2908148-2908170 CAGCAGGGCGGGGAGGGAGCTGG - Intergenic
900535931 1:3177524-3177546 CAGCAGCCCTGGAGGGAAGGTGG - Intronic
900745899 1:4360617-4360639 CAGCAGGGCTGGATGGGGCCTGG - Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901254116 1:7806234-7806256 CAGCAGCACTGCAGGCAAGCAGG + Intronic
901419753 1:9143004-9143026 CAGGAGGGAGGGAGGGAAGAAGG - Intergenic
901436606 1:9250605-9250627 CTGCAGGGGTGGAGAGCAGCTGG - Intronic
901451219 1:9338031-9338053 CAGCTGGGGTGCAGGGAAGAGGG + Intronic
901770837 1:11529625-11529647 CATCGGGGCTGGAGCTAAGCAGG - Exonic
901794196 1:11671174-11671196 CAGGAGGGCGGGAGGGAGGGTGG - Intronic
902070243 1:13728490-13728512 CAGCGGGGCTGTGGGGAAGAAGG + Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902369598 1:15997480-15997502 GAGCTGGGAAGGAGGGAAGCAGG - Intergenic
902539711 1:17145540-17145562 CAGCGTGGCTGGAGAGAAGTGGG - Intergenic
902611891 1:17602575-17602597 CAGCAGGGGTGGGGGAAAGAGGG + Intronic
902930926 1:19730999-19731021 CAGCAGGGCTGCCTGAAAGCAGG + Intronic
902961170 1:19963713-19963735 CAGAGTGGCTGGAGTGAAGCGGG - Intergenic
902975334 1:20084356-20084378 CAGGAGGGCAGAAGGAAAGCCGG - Intronic
903192795 1:21666290-21666312 CAGCAAGGCTGGGGGCCAGCTGG - Intronic
903320362 1:22539314-22539336 TTGCAGGACTGGGGGGAAGCTGG - Intergenic
903361783 1:22781520-22781542 CAGCAGGGCTTGAGGGATCCTGG - Intronic
903620418 1:24694068-24694090 CAGCAAGGCTGAGTGGAAGCTGG - Intergenic
903745700 1:25585287-25585309 CAGCAGGTGTGTGGGGAAGCCGG + Intergenic
903807020 1:26012859-26012881 GATCAGGCCTGGAGGGAAGCAGG - Intergenic
903917326 1:26773893-26773915 CAGCAGGTGAGGAGGGTAGCTGG + Exonic
904373220 1:30063918-30063940 CATCAGGGCTGGTGGGCACCTGG - Intergenic
904442415 1:30540431-30540453 CAGCAGATCAGGAGGCAAGCTGG + Intergenic
904608904 1:31714660-31714682 CAGCAGAGCCGGAGTGATGCCGG + Intergenic
904615386 1:31746717-31746739 GAGAAGGGCTGCAGGGAAGTTGG - Intronic
905538860 1:38744523-38744545 CAAAAGGGCTGGAGGGAACTAGG + Intergenic
905753666 1:40488584-40488606 CAGCATGGCTGGAGGTAGGCTGG - Intronic
905807447 1:40887111-40887133 AAGCAGGTCTGCAGGGAAGAGGG + Intergenic
905869617 1:41395553-41395575 CGGCAGGGCTGGATGGAAGTGGG + Intergenic
905958021 1:42015524-42015546 GAGGAGAGCTGGAGGGAAGGAGG - Intronic
906078976 1:43071253-43071275 CAGCAGGGCTGCAGGAAGGTGGG + Intergenic
906234923 1:44200501-44200523 CTGGAAGGCTTGAGGGAAGCGGG - Intergenic
906967421 1:50472103-50472125 CCGTAGGTCTGGAGGGGAGCTGG + Intronic
907444534 1:54499422-54499444 CCGCAGGGCAAGAGGGAGGCAGG + Intergenic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907497556 1:54854931-54854953 GGGCAGAGCTGGAGGGAAGAGGG - Intronic
909409050 1:75328082-75328104 CAGCAGGGATGGAAAGCAGCTGG - Intronic
910439515 1:87238316-87238338 CAGCATGGGGGCAGGGAAGCTGG + Intergenic
911851502 1:102826906-102826928 CTGCAAGGCTGCAGGGAGGCTGG + Intergenic
912450438 1:109764753-109764775 GAGCAGGGCAGGAGGGGAGGCGG + Intronic
912497264 1:110099691-110099713 CGGCAGGGAGGGAGGGAAGGAGG + Intergenic
912795148 1:112688878-112688900 AGGCAGGGCTCGAGGGAGGCAGG - Intronic
913400246 1:118423638-118423660 GGGCAGGGCTGCAGGGCAGCTGG + Intergenic
913582042 1:120235640-120235662 CAGGAGGGCTTCAGGGATGCTGG - Intergenic
913626132 1:120662751-120662773 CAGGAGGGCTTCAGGGATGCTGG + Intergenic
914563973 1:148847101-148847123 CAGGAGGGCTTCAGGGATGCTGG - Intronic
914608853 1:149283117-149283139 CAGGAGGGCTTCAGGGATGCTGG + Intergenic
914713284 1:150234632-150234654 GAGCAGGGCTGGTGGCCAGCGGG - Intronic
914824592 1:151132203-151132225 CAGCTTGGCTGGAAGGGAGCGGG + Exonic
915722859 1:157996629-157996651 CAGCAGGTCTGGAGAGTAACTGG + Intronic
916175070 1:162031288-162031310 CAGCAGGGATGAATAGAAGCTGG + Intergenic
916389584 1:164316919-164316941 CAGGAGGCCTGGAAGGAAGAAGG + Intergenic
916455984 1:164971422-164971444 CAGCAGAGCTGCAGGGCAGAAGG + Intergenic
917310078 1:173669703-173669725 GGGCAGGGCTGGAGGGGAGTGGG - Intronic
918048784 1:180956571-180956593 CACCAGAGCTGGATGGAGGCTGG - Intergenic
918342943 1:183582206-183582228 AAGAAGGGCTAGAGGGAGGCGGG - Intronic
919525790 1:198648529-198648551 CAGCAGGACTGAATGGGAGCTGG + Intronic
919741694 1:200984834-200984856 AAGCAGGGCTGGAGGGCAAGTGG - Intronic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
919770256 1:201154105-201154127 GAGTTGGGCGGGAGGGAAGCAGG - Exonic
919785994 1:201259166-201259188 GGGCAGAGCTGGAGGGAGGCAGG + Intergenic
920455381 1:206097238-206097260 AAGGAGGGCTGCAGGGAGGCAGG - Intronic
920684934 1:208102171-208102193 CTGGAGGGAGGGAGGGAAGCTGG - Intronic
921285373 1:213604690-213604712 CCCCAGGGCTGCAGGGTAGCAGG - Intergenic
921819447 1:219600599-219600621 CAGCAAGGCTGGAGGGGAGTGGG + Intergenic
922180564 1:223229850-223229872 CAGCAGAGCTGTAGGGGATCAGG - Intronic
922543655 1:226437709-226437731 GAGGAGGGCTGAAGGGAAACTGG - Intergenic
922757729 1:228105797-228105819 CAGCAGAGCTGAAGGCCAGCGGG + Intergenic
923538548 1:234871526-234871548 CAGCAGGGCTGGGGAGAAGCAGG - Intergenic
924116529 1:240753177-240753199 CAGAAGGGAGGGAGGGAAGGAGG - Intergenic
1062822980 10:548504-548526 CAGGAGGGAGGGAGGGAGGCAGG + Intronic
1062944800 10:1452060-1452082 CAGCAGGGGTGCATGGCAGCAGG - Intronic
1063087565 10:2833275-2833297 CAGGAGGACAGGAGAGAAGCAGG - Intergenic
1063335938 10:5213322-5213344 CAGCATGGGTGGAGAGAATCAGG + Intronic
1063685280 10:8231136-8231158 CAGCAGCACAGGAAGGAAGCAGG + Intergenic
1063960013 10:11299317-11299339 CAGCAGGGCTGCAGGCTCGCTGG - Intronic
1064365279 10:14701855-14701877 GAGCAGGGCTGGAGAGATTCAGG + Intronic
1064559001 10:16577257-16577279 CCCCTGGCCTGGAGGGAAGCTGG + Intergenic
1066177774 10:32927304-32927326 CAACAGGAGTGGAGAGAAGCAGG + Intronic
1067061694 10:43081113-43081135 CAGGAGGGGAGGAGGGCAGCAGG - Intronic
1067241969 10:44505248-44505270 TTGCAGGGCTGGAGGGTAGGGGG - Intergenic
1067283069 10:44887556-44887578 AAGCAGGGGTGGAGGGAGTCAGG + Intergenic
1067806233 10:49395320-49395342 CAGCAGGGCTGGTGGGTGGCTGG - Intronic
1067914669 10:50384473-50384495 AAGCAGGGATGGAGGGAAGGAGG - Intronic
1068067288 10:52147855-52147877 CAGCAAGTCTGGATGGAAGCTGG + Intronic
1068080522 10:52313534-52313556 GATCAGGGGTGGAGGGAAGAGGG - Intergenic
1068726775 10:60311937-60311959 CTACAGGGCTGGAGGCAAGTAGG - Intronic
1068951180 10:62779149-62779171 CACAAGGGCTCGAGGGAAGTTGG + Intergenic
1069621947 10:69842813-69842835 CAGCAGGCCTGGCAGGGAGCTGG - Intronic
1069813473 10:71179191-71179213 TAGCAGGGGTGGAGGGAAAGAGG - Intergenic
1069870920 10:71532435-71532457 CGTCAGGGGTGGAGGGGAGCTGG + Intronic
1069875730 10:71561856-71561878 AAGGAGGGGAGGAGGGAAGCAGG + Intronic
1069917343 10:71795756-71795778 CAGCAGGGATGGAGCAGAGCAGG - Exonic
1069957228 10:72059678-72059700 CAGGCGGGCTGGAGTGAAGGGGG + Exonic
1070367942 10:75754091-75754113 GGGCAGGGCTGGCTGGAAGCAGG - Intronic
1071444772 10:85735806-85735828 AAGGAGGGATGGAGGGATGCAGG + Intronic
1071450181 10:85786578-85786600 CAGCAGGGTGGGAGGGATGTCGG - Intronic
1071801420 10:89066319-89066341 GGGCAGGGCTGGAGGGAGCCTGG - Intergenic
1071908524 10:90203020-90203042 CATCAGGGATGGAGAGAAGCAGG - Intergenic
1072050864 10:91701667-91701689 GAGCATGGCTGGAGGGCAGGTGG + Intergenic
1072806987 10:98429930-98429952 CAGAAGGGGTGGAGGGAGCCAGG - Intronic
1072822009 10:98567538-98567560 AAGCTGGCCTGGAGGGAAGCAGG + Intronic
1073050204 10:100662168-100662190 CAGCAGGGCAGGAGCCAATCTGG - Intergenic
1073144438 10:101271268-101271290 CAGGAGGGCAGGAGGGGATCAGG + Intergenic
1073218094 10:101847798-101847820 CAGCAGGGAAGGAGAGAAGAGGG + Intronic
1073315726 10:102579411-102579433 CAGCAGGGGAGGTGGGAGGCTGG - Intronic
1073430187 10:103480795-103480817 CAGCAGGGCTGGTGTGGAGCAGG + Intergenic
1073556508 10:104457491-104457513 CAGCTGGGCTGATGGGGAGCTGG + Intergenic
1073639782 10:105240107-105240129 CAGCAAGGGTGCAGGGATGCAGG - Intronic
1074440680 10:113475042-113475064 CAGCAGTGGTGGAGGGAGGTGGG + Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075613099 10:123869250-123869272 CAGCCAGGCTGCAGGAAAGCGGG + Intronic
1075734057 10:124653339-124653361 CAGGAGGGTTGGAGTAAAGCAGG + Intronic
1076364645 10:129914191-129914213 GTGCAGGGCTGGAGGGAGGTGGG - Intronic
1076408110 10:130226784-130226806 CAGCAGGGGAGGAAGGAAGATGG + Intergenic
1076454348 10:130579052-130579074 CCCTATGGCTGGAGGGAAGCAGG - Intergenic
1076523012 10:131092858-131092880 CTGCAGGACTGTGGGGAAGCAGG - Exonic
1076802279 10:132836117-132836139 GAGCAGGGCTGCAGGGGAGGGGG - Intronic
1076818274 10:132925300-132925322 CAGCAGGGCTTGTGGGAGGTGGG - Intronic
1076836325 10:133022898-133022920 CAGTGGGGCGGGAGGGAGGCAGG - Intergenic
1076847328 10:133075682-133075704 CAGCAGGGCTGGCAGGAGGCTGG + Intronic
1077077297 11:707442-707464 CAGCAGGGCAGGAGGGTAGAGGG - Intronic
1077089775 11:773173-773195 CAGCAGGGGTGCAGGGAGGAAGG - Intronic
1077214959 11:1391346-1391368 GGGCAGGGGTGGAGGGAAGGAGG + Intronic
1077217470 11:1400938-1400960 CAGCAGGGATGGAAGGAAGGAGG - Intronic
1077327971 11:1971841-1971863 GAGGAGGGCTGGTGGGCAGCAGG - Intronic
1077457966 11:2692291-2692313 CAATAGGGATGGAGGGAAGCAGG - Intronic
1077496230 11:2887722-2887744 CCGCACAGCTGGAAGGAAGCAGG + Intergenic
1077499947 11:2904797-2904819 GAGCAGGGCTGGAAGGAAGCAGG + Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1078066783 11:8083815-8083837 CAGCAGGGCAGGGGGGATCCTGG - Intronic
1078337837 11:10477746-10477768 CAGCAGGGCTGGAGGCTGGGTGG + Intronic
1078359845 11:10659546-10659568 GAGCAGGGCTGGAGAAAATCGGG - Intronic
1078442363 11:11378421-11378443 CTGCAGGGCTGGAGGGCACAGGG - Intronic
1078519323 11:12050814-12050836 CTGCAGAGCTGGAGGGAACTGGG + Intergenic
1078759264 11:14238658-14238680 GGTCAGGTCTGGAGGGAAGCGGG - Intronic
1079344479 11:19639944-19639966 CAGCATGGGTGAAGGGAAGATGG + Intronic
1079591477 11:22188488-22188510 CACCATGGCTGGAGGGTAGTTGG + Intergenic
1080551493 11:33376673-33376695 CCTCAGGGCTCAAGGGAAGCTGG + Intergenic
1081484726 11:43518832-43518854 CAACAGTGCTGATGGGAAGCCGG - Intergenic
1081613079 11:44575086-44575108 CAGTAGGGCTGAAGCGAAACTGG - Intronic
1081991377 11:47339409-47339431 GAACAGGGCAGGAGGGAAGTAGG + Intronic
1082174905 11:49048580-49048602 CAGCGGGGCAGGTGGGAGGCCGG + Intergenic
1082243223 11:49892181-49892203 CAGCGGGGCAGGTGGGAGGCCGG + Intergenic
1082657723 11:55873006-55873028 CAGCGGGGCAGGTGGGAGGCCGG + Intergenic
1082835980 11:57650194-57650216 TGGCAGGGCTGGAGGAAAGGAGG + Intronic
1082857800 11:57824628-57824650 GAGTAGGGCTGGACTGAAGCTGG + Intergenic
1083034958 11:59628514-59628536 CAGGAGGGAGGGAGGGAAGGAGG - Intergenic
1083590450 11:63890585-63890607 CACCAGGTCTGGAGGAGAGCGGG + Intronic
1083651596 11:64207704-64207726 CAGAAGGGAGGGAGGGAAGAGGG - Intronic
1083742604 11:64718802-64718824 CATCACGGCTGGAAGGAAGGGGG - Intronic
1083770385 11:64863862-64863884 CAGCCGGGCTGCAGGGAGGAGGG + Intronic
1083794400 11:65006573-65006595 GAGCAGGGGAGCAGGGAAGCCGG + Intergenic
1083835259 11:65262378-65262400 CTGCAGGGCGGGAGGGGTGCGGG - Intronic
1083848888 11:65354109-65354131 CAGCGAGGCTGGAGAGCAGCTGG + Intergenic
1083854154 11:65384120-65384142 CAGCAAGGCTGTAGGGAAGTGGG - Intergenic
1083895761 11:65619007-65619029 CAGCCGGGCTGGTTGGCAGCGGG - Exonic
1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG + Intronic
1084114117 11:67031879-67031901 CAGCAGGGCTGGGTAGTAGCCGG - Intronic
1084424475 11:69077010-69077032 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424552 11:69077259-69077281 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424584 11:69077367-69077389 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084481425 11:69422924-69422946 GAGCAGGGGTGGAGGGGTGCCGG - Intergenic
1084569282 11:69949743-69949765 CAGAAGGGCTGGAAGGAGGCAGG + Intergenic
1084575186 11:69984615-69984637 CAGCAGGCCTGGTGGGGAGGAGG + Intergenic
1084704180 11:70806371-70806393 AAGTAGGGTTGGAGGGAAGTTGG - Intronic
1084949727 11:72657967-72657989 GAGGAGGGGTGGAGGGAAGAGGG + Intronic
1084973559 11:72784238-72784260 CAGGAGGGCTGGAGGGGCTCTGG + Intronic
1085095936 11:73760769-73760791 GAGCCCGGCTGGAGGGCAGCAGG + Exonic
1085523874 11:77153339-77153361 GAGCAGGGTTGGAGGGAAGGGGG + Intronic
1085553415 11:77396806-77396828 TTGGAGGGCTGCAGGGAAGCTGG - Intronic
1085658982 11:78345031-78345053 CAGGAGGGAGGGAGGGAGGCGGG + Intronic
1085697612 11:78718504-78718526 CAGCAGGGCTGGACAGCACCTGG + Intronic
1085704164 11:78771045-78771067 CAGCTGGGCTGGAGAGGAGCTGG - Exonic
1085877815 11:80430115-80430137 CAACAGGGTTGGATGGAACCAGG - Intergenic
1086049910 11:82577564-82577586 AAGCGGGGCTGGAGGGGAGGGGG + Intergenic
1086690869 11:89787506-89787528 CAGCGGGGCAGGTGGGAGGCCGG - Intergenic
1086697651 11:89864004-89864026 CAGCGGGGCAGGTGGGAGGCCGG + Intergenic
1086708508 11:89980484-89980506 CAGCGGGGCAGGTGGGAGGCCGG - Intergenic
1086714931 11:90052149-90052171 CAGCGGGGCAGGTGGGAGGCCGG + Intergenic
1086856111 11:91868060-91868082 CAGCAGGGCTGGGCAGAAGGAGG - Intergenic
1087285761 11:96263724-96263746 CAGCAGGTATGGAGGGGGGCTGG + Intronic
1087362959 11:97183952-97183974 CAGCAGGGCTAGAACAAAGCAGG + Intergenic
1088168551 11:106967757-106967779 AAGCAAGGAGGGAGGGAAGCAGG + Intronic
1088787027 11:113191232-113191254 GAGCAGGGTTGGAGGGAATTCGG + Intronic
1088811564 11:113396009-113396031 AGGTAGGGCTGGAGGGGAGCTGG - Intronic
1088865699 11:113845612-113845634 CACCAGGGCTAGAGGGCAGTAGG + Intronic
1089288302 11:117421619-117421641 GAGCAGGGCTGGAGAAGAGCAGG + Intergenic
1089291409 11:117439700-117439722 CTGCAGGCCTGGAGGCAACCGGG + Intronic
1089401081 11:118165083-118165105 GAGGAGGAGTGGAGGGAAGCAGG - Exonic
1202810950 11_KI270721v1_random:27021-27043 GAGGAGGGCTGGTGGGCAGCAGG - Intergenic
1091376944 12:31286-31308 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1091629246 12:2146865-2146887 AAGCAGGGCTGGACCCAAGCAGG + Intronic
1091741151 12:2960931-2960953 GGGCAGAGCTGGAAGGAAGCTGG + Intronic
1091795227 12:3294247-3294269 CAACAGGGCTGGAGGGTCCCGGG + Intergenic
1091801530 12:3327696-3327718 CAGCAGGCTTGAAGGAAAGCAGG + Intergenic
1091806365 12:3359337-3359359 AGGCAGGGCAGGAGGGAAGGAGG - Intergenic
1092163321 12:6327946-6327968 CGTAAGTGCTGGAGGGAAGCTGG + Exonic
1092249345 12:6883976-6883998 CCCCTGGGCTGGAGGGAGGCAGG + Intronic
1092261140 12:6953878-6953900 CCGCAGGGATGGGGGGAAGGAGG - Intronic
1092760056 12:11801933-11801955 CAACAGGGCTTGAAGGTAGCAGG - Intronic
1092948580 12:13479336-13479358 CAGCAGGGCAAGAGCCAAGCTGG + Intergenic
1094490994 12:30960514-30960536 CAGCAGACCTGGAGGAAAGCAGG - Intronic
1095440618 12:42235972-42235994 CAGCAAGGAAGGGGGGAAGCTGG - Intronic
1095615124 12:44179583-44179605 CAGCAAGGCTGGAACAAAGCAGG - Intronic
1096398002 12:51281308-51281330 CGGGAGGGATGGAGGGAGGCAGG - Exonic
1096521318 12:52186299-52186321 CCTCAGTGCTGGAGGGAAGAGGG - Intronic
1096571882 12:52528142-52528164 AAGAAGGGCTGGAGGAAATCAGG - Intergenic
1096581791 12:52590452-52590474 CAGCAGGGGTGGCAGGGAGCAGG - Intronic
1096753436 12:53778671-53778693 CAACAGAGCGGTAGGGAAGCAGG + Intergenic
1096871244 12:54593784-54593806 CAACAAGGCTGGGGAGAAGCAGG - Intergenic
1096943190 12:55372469-55372491 AAGGAGGGAAGGAGGGAAGCAGG + Intergenic
1097053052 12:56235142-56235164 AAGCAGGGCTGGGGAGAATCAGG - Exonic
1098065264 12:66608012-66608034 CAGCAGGTGGGGAGGGAGGCAGG + Intronic
1098347723 12:69524063-69524085 CAGCATGGCTGGAGGAGGGCAGG + Intronic
1099935237 12:89117572-89117594 CAGCAGGGCAGCAGGGCAGCAGG - Intergenic
1100587870 12:95996148-95996170 CAGCAGGTCTGGATGGAAAGTGG - Exonic
1101813297 12:108126485-108126507 CAGATGGGCTGGGGGGATGCTGG + Intergenic
1102375964 12:112421116-112421138 TACCAGGGCTGGAGGGGAGAAGG - Intronic
1102541445 12:113622332-113622354 CTGGAGGCCTGCAGGGAAGCTGG + Intergenic
1102568818 12:113815048-113815070 GAGCTGGCTTGGAGGGAAGCAGG - Intergenic
1102573065 12:113839276-113839298 CAGGAGGGCAGGAGGCCAGCAGG + Intronic
1104417743 12:128609293-128609315 TAGCAGGGTTGCAGGGAGGCGGG - Intronic
1104558344 12:129822203-129822225 GAGCAGGGCTGGAGGGGAGAAGG + Intronic
1104564203 12:129865555-129865577 GAGCAGGCATGGAGGGAATCTGG + Intronic
1104603407 12:130169137-130169159 CAGTGGGGCTAGGGGGAAGCAGG + Intergenic
1104648600 12:130514635-130514657 CGACAGGGCTGGTGGGGAGCTGG - Intronic
1104661330 12:130613206-130613228 CAGCAGTGCTGGCGGGTTGCCGG + Intronic
1104661475 12:130613939-130613961 CAGCAGAGAGGGAGGGAGGCAGG + Intronic
1104676176 12:130713990-130714012 CAGCAGGTCTGGGGAGGAGCCGG - Intronic
1104845293 12:131843923-131843945 CAGAAGGGCTGGTGGGATGTGGG + Intronic
1104990952 12:132623566-132623588 AAGCAGGGGAGGAGGGAGGCTGG - Intergenic
1105726195 13:23164776-23164798 GAGCAGGGCTGGCAGGAGGCCGG - Intergenic
1105756645 13:23471012-23471034 CAACAGGGTTGGAGGGAGGGAGG + Intergenic
1106281387 13:28275748-28275770 CAGAATGGCAGGAGGGAAGCTGG - Intronic
1106346698 13:28886313-28886335 CAGCAGGGGAGCAGGGAGGCAGG + Intronic
1106507402 13:30383109-30383131 CACCAGGTGTGGTGGGAAGCAGG + Intergenic
1106587740 13:31072012-31072034 CAGCGGTGCTGGAGAGAAGAGGG - Intergenic
1107318400 13:39159411-39159433 CAGCTGGGAAAGAGGGAAGCTGG - Intergenic
1107726891 13:43308026-43308048 CAGCAGTGAGAGAGGGAAGCAGG - Intronic
1108035041 13:46281874-46281896 GAGGAGGGCAGGAGGGAGGCTGG - Intergenic
1109565093 13:64102783-64102805 CAGCATGGCTAGAGTAAAGCAGG + Intergenic
1110392839 13:74995187-74995209 AAAAAGGGCTTGAGGGAAGCTGG - Intergenic
1111834262 13:93368316-93368338 AAGCAGGGAGGGAGGGAAGGAGG - Intronic
1112258700 13:97858234-97858256 CAGCAGGCCTGGAAGGAGGAAGG + Intergenic
1112406325 13:99123789-99123811 CAAAAGGGTTGGAAGGAAGCAGG - Intergenic
1113429990 13:110241322-110241344 CAGCAGGGCTGGAGCCAAGTTGG - Intronic
1113460059 13:110476056-110476078 CAGCAGGGCTGGAGACAGTCTGG - Intronic
1113467948 13:110525213-110525235 TAGCAGCGCTAGAGGGAGGCTGG + Intronic
1113649773 13:112027274-112027296 CAGCAGGGCTGGGGACAGGCTGG + Intergenic
1113910740 13:113840088-113840110 CAGCAGGCCTGGACGCAAGGTGG + Intronic
1113938115 13:114005809-114005831 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938127 13:114005845-114005867 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938164 13:114005957-114005979 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938176 13:114005993-114006015 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938202 13:114006067-114006089 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938225 13:114006141-114006163 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938236 13:114006177-114006199 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938260 13:114006251-114006273 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938271 13:114006287-114006309 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938321 13:114006437-114006459 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938332 13:114006473-114006495 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938381 13:114006623-114006645 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938392 13:114006659-114006681 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938429 13:114006771-114006793 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938440 13:114006807-114006829 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938464 13:114006881-114006903 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938475 13:114006917-114006939 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938499 13:114006991-114007013 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938534 13:114007103-114007125 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938557 13:114007177-114007199 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938569 13:114007213-114007235 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938604 13:114007306-114007328 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938630 13:114007380-114007402 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938641 13:114007416-114007438 CGGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938653 13:114007452-114007474 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1114502161 14:23178462-23178484 CTGCAGGGCTGCTGGGAACCTGG - Intronic
1114559347 14:23579077-23579099 AAGCAGGGGAGGAGGGAAGAAGG + Intergenic
1114689433 14:24566524-24566546 CAGCATGGTTGTAGGGAAGTGGG - Intergenic
1114854317 14:26419647-26419669 CATCAGGGCTGAAAGGAATCAGG + Intergenic
1115772250 14:36676537-36676559 CAGAAGGGTTGGAGGGCAGGAGG - Exonic
1116292274 14:43059371-43059393 CAGAGGGGTTGGAGGGCAGCAGG + Intergenic
1117898576 14:60510992-60511014 CCGCCGGGCTGGAGGGACGCAGG + Intronic
1118593508 14:67419039-67419061 CATCAGGGCTGGGGTGGAGCAGG + Intergenic
1119003629 14:70905497-70905519 CAGCAGGCCAGGAAGGCAGCCGG - Intergenic
1119027997 14:71168969-71168991 CCCCAGGGCTGGAGGGAAAAAGG - Intergenic
1119090151 14:71773611-71773633 CAGCAGGCCTGGAAGGAACCTGG + Intergenic
1119151292 14:72361949-72361971 TAAGAGGGCTGCAGGGAAGCAGG + Intronic
1120042228 14:79767202-79767224 CAGTAGGGCTGGGAGGAAGAAGG - Intronic
1121042310 14:90759114-90759136 CAGAAGAGCAGGAAGGAAGCTGG - Intronic
1121047072 14:90796110-90796132 CAGCTGGTTGGGAGGGAAGCTGG - Intronic
1121361909 14:93269329-93269351 CAGCAAGGCAGAAGGGATGCTGG + Intronic
1121826126 14:97010973-97010995 GAGCAGGCTTGGAGGGAAGGGGG + Intergenic
1121838666 14:97114917-97114939 CAGCAGGGCTTGCGAGAGGCTGG + Intergenic
1122277696 14:100603703-100603725 CAGCAGGGCTGGACGAAGGCTGG - Intergenic
1122635831 14:103129214-103129236 CTGCAGGGCTGGAGCGCAGTGGG + Intronic
1122816611 14:104317111-104317133 CAGGATGGCGGGAGGGAAGCAGG - Intergenic
1122869735 14:104632795-104632817 AGGCAGGGCTGGAGGGTGGCAGG - Intergenic
1122922317 14:104885130-104885152 CAGCTGGGCAGGAGGGAGCCTGG + Intronic
1123040296 14:105487602-105487624 CCGCAGGGCTGGAAGGAACGCGG + Intronic
1123067952 14:105627717-105627739 CAGCAGGGCCGGTGGGAGGCAGG - Intergenic
1123071972 14:105646442-105646464 GAGCAGGGCCGGTGGGAGGCAGG - Intergenic
1123091633 14:105744718-105744740 CAGCAGGGCCGGTGGGAGGCAGG - Intergenic
1123091902 14:105745655-105745677 GAGCAGGGCCGGTGGGAAGCAGG - Intergenic
1123091968 14:105745938-105745960 CAGCATGGCTGGTGGGAGGTGGG - Intergenic
1123097487 14:105773385-105773407 AAGCAGGGCTGGTGGGAAGCAGG - Intergenic
1123184590 14:106504777-106504799 CAGCATGGCTAGAATGAAGCAGG + Intergenic
1123509275 15:20979829-20979851 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1123566499 15:21553576-21553598 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1123602760 15:21990862-21990884 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1123721323 15:23064236-23064258 CCGCAGGGGTGGAGAGCAGCAGG - Intergenic
1123835679 15:24189439-24189461 CAGCAGGGCAGAAGGGAGCCAGG - Intergenic
1123841108 15:24247972-24247994 CAGCAGGGCAGGAGGCAGCCAGG - Intergenic
1124598422 15:31110906-31110928 CAGAAGGGAGGGAGGGAAGGGGG - Intronic
1125405733 15:39351129-39351151 CAGCAGGGCAGGAGGGGAAAAGG + Intergenic
1125517804 15:40332506-40332528 CAGAAGGGCTGTGGGGAAGTAGG - Intronic
1125608541 15:40956063-40956085 CAGCAGCACTGGGGGGAATCTGG - Exonic
1125800193 15:42439277-42439299 CAGCAGGACTGGTCGGGAGCAGG - Exonic
1127262350 15:57335557-57335579 AAGCAGGGCTGGAGAGCAGAGGG - Intergenic
1127355360 15:58193774-58193796 CTGCAAGGCTGCAGGGAGGCTGG + Intronic
1127532012 15:59852595-59852617 CAGCAGGGCTGGAAGGAACATGG + Intergenic
1127634753 15:60858573-60858595 CAGCGGGGATGGGGTGAAGCAGG + Intronic
1127845405 15:62866325-62866347 GGGCAGGGCTGGAGGGGACCTGG - Intergenic
1128213236 15:65916726-65916748 CAGCAGGGAGGGAGGAATGCAGG - Intronic
1128380312 15:67107465-67107487 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128619978 15:69140592-69140614 AAGCAGGGCAGGAGGCAAGTGGG - Intergenic
1129569862 15:76669762-76669784 CAGCATGGCGGGAGGGAATGTGG - Intronic
1129705248 15:77790619-77790641 AGGCAGGGGTGGAGGGAGGCAGG + Intronic
1129856742 15:78830426-78830448 AAGCAGGGCTGGCGGGCAGGGGG + Intronic
1130079730 15:80722059-80722081 TAACAGGGCTGCAGGGAAGATGG - Intronic
1130152567 15:81322687-81322709 CTGCAGGCCTGAAGGGAGGCGGG - Intronic
1130258772 15:82338326-82338348 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130269912 15:82440777-82440799 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130462248 15:84168078-84168100 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130473868 15:84247000-84247022 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130481282 15:84361064-84361086 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130490426 15:84426695-84426717 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130502016 15:84505465-84505487 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130560914 15:84958278-84958300 CAGCAGGCCTGAAGAGAACCAGG - Intergenic
1130596151 15:85251615-85251637 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130770119 15:86915853-86915875 GAGCAGAGCTGCAGGAAAGCAGG + Intronic
1131076388 15:89497709-89497731 AAGAGGGGCTGGAGGGGAGCAGG + Intergenic
1131451174 15:92541530-92541552 GAGCAGGGAGTGAGGGAAGCCGG - Intergenic
1131459401 15:92607715-92607737 CAGCAGGTCGGGAGGACAGCAGG - Intergenic
1131540611 15:93272060-93272082 CAGCGGGGTTGGAATGAAGCAGG + Intergenic
1132049705 15:98596836-98596858 CAGGACGACTGGAGGGCAGCAGG - Intergenic
1132378335 15:101347844-101347866 CAACAGGAGTGGAGGGCAGCAGG + Intronic
1132449976 15:101961708-101961730 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
1202974863 15_KI270727v1_random:280664-280686 CAGCAGGGGCGGTGGGAGGCAGG + Intergenic
1132602528 16:780059-780081 CAGGAGGGCTGGATGCCAGCGGG - Exonic
1132667573 16:1089215-1089237 GAGCAGGGCTGGATGGGAGATGG - Intergenic
1132745623 16:1435009-1435031 CAGCAGGGCAGGCGGGGAGGCGG + Intronic
1132872459 16:2121961-2121983 GAGCAGGGCTGGAGGCTGGCAGG - Intronic
1133056762 16:3149310-3149332 CTGCAGGGCCAGTGGGAAGCTGG + Intronic
1133845134 16:9446517-9446539 CAGCAGGGGTCCAGGGGAGCTGG + Intergenic
1134012987 16:10868920-10868942 TGGCAGCCCTGGAGGGAAGCTGG - Intergenic
1134092780 16:11400316-11400338 GAGCCGGGCTTGAGAGAAGCTGG - Intronic
1134523003 16:14927154-14927176 CAGCAGGGCAGGAGGCCGGCAGG - Intronic
1134551556 16:15141161-15141183 GAGCAGGGCTGGCTGGAGGCTGG - Intergenic
1134710670 16:16325805-16325827 CAGCAGGGCAGGAGGCCGGCAGG - Intergenic
1134718841 16:16370093-16370115 CAGCAGGGCAGGAGGCCGGCAGG - Intergenic
1134948931 16:18342840-18342862 CAGCAGGGCAGGAGGCCGGCAGG + Intergenic
1134955915 16:18382066-18382088 CAGCAGGGCAGGAGGCCGGCAGG + Intergenic
1135058598 16:19251663-19251685 CACCAGGGTGGGAGGAAAGCTGG + Intronic
1135917042 16:26614549-26614571 CTGCAGGGCTGGCAGGAAACAGG + Intergenic
1136054789 16:27680319-27680341 CAGCATGGCTGCAGGGGAGACGG + Intronic
1136107219 16:28038499-28038521 GAGCTGGGGTGGAGGGAAGTGGG + Intronic
1136367119 16:29813974-29813996 TTGCAGCGCTGGCGGGAAGCTGG - Intronic
1136544307 16:30947277-30947299 CAGCAGGGGTGAAATGAAGCCGG - Exonic
1137053845 16:35734331-35734353 CCGCAGGGGTGGAGGCAAGCGGG - Intergenic
1137058211 16:35755375-35755397 CAGCAGGGGTGCAGGTGAGCTGG - Intergenic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1138219192 16:55236619-55236641 CAGCAGGGATGGAGTGAAAAAGG + Intergenic
1138244839 16:55459854-55459876 AAGCACTGCAGGAGGGAAGCTGG - Intronic
1138352529 16:56353553-56353575 CAGCATGGCTGGGTGGCAGCAGG + Intronic
1138444408 16:57054631-57054653 CAGCAAGGCAATAGGGAAGCAGG - Intronic
1138497309 16:57416321-57416343 GAGCTGGGCTGGGGGGAAACCGG - Intergenic
1138991642 16:62397270-62397292 AAGCAGGGAGGGAAGGAAGCAGG + Intergenic
1139048676 16:63096264-63096286 CAGCATGGCTAGAAGAAAGCAGG + Intergenic
1139210033 16:65068025-65068047 AAGCAGGGAGGGAGGGAAGAAGG + Intronic
1139516335 16:67454458-67454480 CAGAAGGGCCCGGGGGAAGCAGG + Intronic
1139633738 16:68245697-68245719 CAGCATGGCGGGAGGTGAGCCGG - Intronic
1139649813 16:68356582-68356604 CGGCAGGGCAGGAAGGAAGTGGG + Intronic
1140468127 16:75198295-75198317 CTGCAGTCCTGGAGGGAATCTGG + Intergenic
1140719819 16:77761447-77761469 CAGCAGGCCTGGAAGGCACCTGG + Intergenic
1140725459 16:77807541-77807563 TAGATGGGCAGGAGGGAAGCTGG - Intronic
1141052543 16:80784786-80784808 GATCAGTGCTGGAGAGAAGCTGG + Intronic
1141088457 16:81113445-81113467 CTGCAAGACTGGAGGGAGGCAGG + Intergenic
1141427212 16:83952075-83952097 AGGCAGGGAGGGAGGGAAGCAGG - Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141961223 16:87410752-87410774 CAGCAGGCCTGCAGGCAAGGTGG - Intronic
1142252780 16:89000350-89000372 CAGCACGTGTGAAGGGAAGCAGG + Intergenic
1142309494 16:89304067-89304089 CAGCAGGGCTGTAGAGAAGCTGG + Intronic
1142411928 16:89921350-89921372 CATCATGGCTGGAGGGACTCAGG - Intronic
1142420327 16:89966062-89966084 CAGCAGGGGTGGAGGGGGCCAGG - Exonic
1142638394 17:1271287-1271309 CGGCTGGGCTGCAGGGAGGCCGG + Exonic
1142683255 17:1562384-1562406 CAGCGGGGATGGAGGGGATCCGG - Intronic
1142692185 17:1613307-1613329 CAGCTGAGCTCCAGGGAAGCCGG + Intronic
1142698052 17:1644304-1644326 CTGCTGGGCTGGAGGAGAGCTGG + Intronic
1142737633 17:1911352-1911374 GAGGAGGGCAGGAGGTAAGCAGG - Intergenic
1142878712 17:2868129-2868151 CTGCTGGGGTGGAGGGCAGCTGG - Intronic
1143167092 17:4902178-4902200 ACGCCAGGCTGGAGGGAAGCCGG - Exonic
1143410827 17:6707378-6707400 CAGCTGGGAAGGAGGGAGGCAGG - Intronic
1143437434 17:6939739-6939761 TAGCAGGGCTGGAGGGAGAGTGG + Intronic
1143447943 17:7019830-7019852 GAGCAGGGCTGGCGGGAGGCAGG - Intergenic
1143643027 17:8210417-8210439 CCGCAGGGCTGGAAGGAGGTAGG - Intronic
1144204683 17:12971760-12971782 CACCAGGGATGGAGGGAAAGGGG - Intronic
1144645667 17:16971979-16972001 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1144758775 17:17695300-17695322 CTCCTGGGCTGGAGGGAGGCCGG - Intronic
1144807689 17:17978594-17978616 CAGCAGGGCTGGACTGAGGCAGG - Intronic
1144888324 17:18478628-18478650 TTGGAGGGCTGGGGGGAAGCTGG + Intronic
1144952166 17:19000213-19000235 CACTAGGGCTGGAGGGAGGCTGG + Intronic
1145011559 17:19371145-19371167 CAGCAGCACTGGAGGGAGGGAGG + Intronic
1145143882 17:20465674-20465696 TTGGAGGGCTGGGGGGAAGCTGG - Intronic
1145166026 17:20614108-20614130 CAGCAGGGGTGGAGGGGTCCAGG - Intergenic
1145194391 17:20876504-20876526 TAGAAGGGCTGGAGGGAATTAGG + Intronic
1145297647 17:21604559-21604581 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1146280732 17:31542457-31542479 CATCAGGGCTGGAAGGAACGTGG + Intergenic
1146501360 17:33367570-33367592 CAGCAGGCATGAAGGGAGGCAGG - Intronic
1146631028 17:34469385-34469407 CATTAGGGTTGGAGGGAAGCTGG - Intergenic
1146822555 17:35996057-35996079 CAGGAGGGAGGGAGGGAAGGGGG + Intronic
1146963294 17:37003514-37003536 CACCAGGGCTGGAGTGCAGTGGG + Intronic
1147120087 17:38330674-38330696 CAGCAGAGCTGGAGCCAAGGTGG + Exonic
1147356926 17:39905651-39905673 CTGCAGGCCAAGAGGGAAGCAGG - Intronic
1147425569 17:40344465-40344487 CCAGAGGGCTGGAGAGAAGCTGG + Intronic
1147636541 17:41967551-41967573 CAGAAGGGCTGGTGGGGGGCAGG - Intronic
1147904976 17:43816726-43816748 CAGCATTAGTGGAGGGAAGCGGG + Intronic
1148998988 17:51737754-51737776 AAGGGGGGCTGTAGGGAAGCAGG - Intronic
1149407805 17:56372406-56372428 CAGCAGGGCTGGAGAGCAATGGG + Intronic
1149555926 17:57573579-57573601 CAGCAGGTCTGGAGTGATGGGGG - Intronic
1149974345 17:61251039-61251061 GGGCAGGGCTGGAGGGATGAGGG - Intronic
1150216734 17:63475588-63475610 CTGCAGGTCAGGAGGGAGGCTGG + Intergenic
1150425768 17:65075843-65075865 CAGAAGGGCAAGAAGGAAGCAGG - Intergenic
1150566765 17:66348768-66348790 CAGCAGAGGGGGAGGGCAGCTGG + Intronic
1150765003 17:67995695-67995717 GTGGAGGGCTGGGGGGAAGCGGG - Intergenic
1150775122 17:68075125-68075147 AGGGAGGGATGGAGGGAAGCAGG - Intergenic
1151466503 17:74289163-74289185 CAGCAGGGCTGGAGGGCAACAGG - Intronic
1151617598 17:75224484-75224506 GAGAAGGGGTGGGGGGAAGCAGG + Intronic
1151698015 17:75727880-75727902 CAGCAGGGCAGGAGGGGGACAGG + Intronic
1151701125 17:75743121-75743143 CCCCAGGGCTGGAGGAGAGCAGG - Intronic
1151724526 17:75876568-75876590 CAAGAGGGCCGGTGGGAAGCCGG - Intronic
1151785149 17:76271777-76271799 CTGCAGGGCTGCGGGGAAGGGGG - Intergenic
1152014551 17:77741861-77741883 CATCAGGGATGGAGGGAGACTGG - Intergenic
1152098431 17:78286686-78286708 CAGCAGCCCTGGAGAGAAGGAGG + Intergenic
1152124644 17:78439003-78439025 CAGAAGGCCCGGAAGGAAGCAGG - Intronic
1152472906 17:80500183-80500205 CAGCATGGCTGCAGTCAAGCTGG - Intergenic
1152626052 17:81388441-81388463 CTCCAGGGCTGGAGGGCAGGTGG + Intergenic
1152671915 17:81613454-81613476 CAGCAAGGCTCGAGGGAAACAGG + Exonic
1152718102 17:81909468-81909490 CAGGAGGGCTGGGGGGCCGCGGG + Intronic
1152726931 17:81952173-81952195 CAGAAGGGTTGAAGGGAAGCAGG + Intergenic
1152740909 17:82017963-82017985 CACCAGGGCAGGAGAGAGGCTGG + Intergenic
1152934089 17:83125958-83125980 CGTCAGGGCTGGAGTCAAGCTGG - Intergenic
1153201831 18:2655497-2655519 GAGCAGGGCTCGGGGGCAGCGGG - Intergenic
1153338384 18:3948472-3948494 CTGCAGTGCTGGAGAGAGGCAGG - Intronic
1153468275 18:5414656-5414678 CAGGAGGGCTGCAGGGAGCCTGG + Intronic
1153631299 18:7072865-7072887 CTGGAGGGCTGGAGGGAGGCAGG + Intronic
1154311025 18:13266281-13266303 ATGCAGGGCTGGAGGGCAGAGGG - Intronic
1154338094 18:13481946-13481968 GAGCAGGGCTGGAGTGGGGCTGG + Intronic
1155081189 18:22411607-22411629 CAGGAGAGCTAGAAGGAAGCTGG - Intergenic
1155305338 18:24472821-24472843 CAGCAGGGCTTCATGGTAGCTGG + Intronic
1156367310 18:36440923-36440945 TAGCAGGGCAGGAGGGTGGCGGG - Intronic
1156917887 18:42483310-42483332 GAGCAGGGCTCTAGGGAAGAAGG - Intergenic
1157288672 18:46394502-46394524 CAGCCTGGCTGGGGGGAAGGTGG - Intronic
1157317904 18:46608713-46608735 CAGCAAGCCTGGAGGGTACCAGG - Intronic
1157396550 18:47346265-47346287 CAGCAGGGATGGAGGGCTGTTGG + Intergenic
1157544676 18:48539445-48539467 GAGCAGGGATGGGGGGAAGGGGG - Intronic
1157563204 18:48663123-48663145 AAGAAGGGCTGGAGGGCATCAGG + Intronic
1157584212 18:48790929-48790951 GAGCAGGGATTGGGGGAAGCTGG - Intronic
1158048136 18:53181752-53181774 CAGCAGATTTGGGGGGAAGCAGG + Intronic
1158514561 18:58120205-58120227 CAGCAAGGATGGAGAGAGGCAGG + Intronic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158580910 18:58681958-58681980 CAGCAGTGGTGGAGGGCAGGAGG + Intronic
1158667981 18:59449939-59449961 CAGAGGGGCTGAAGGGAACCAGG - Intronic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1159368425 18:67500611-67500633 CAGCAAGGCTAGAAGAAAGCAGG + Intergenic
1159771230 18:72547344-72547366 CAGAAGGGCAGGAGGGTAGGAGG + Intronic
1159817811 18:73098704-73098726 GAGCAGTTGTGGAGGGAAGCTGG - Intergenic
1159905181 18:74083339-74083361 CAGCAGGGCTCGACGGAAGCAGG + Intronic
1160343529 18:78110423-78110445 CAGGAGGGTCGGAGGGAACCGGG - Intergenic
1160396425 18:78575694-78575716 CAGCTGGGCTAGAGGGGAGGGGG - Intergenic
1160420866 18:78742942-78742964 GAGCAGGGGTGGAGGGCAGCAGG - Intergenic
1160427770 18:78790173-78790195 GAGCAGGGCTGGGAGCAAGCAGG - Intergenic
1160519622 18:79497159-79497181 AAGAAGGACTGGAGAGAAGCAGG + Intronic
1160635278 19:70840-70862 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1160669175 19:348675-348697 AAGCAGGGCTGGAGGGAGGGAGG - Intergenic
1160681314 19:412835-412857 CGGCAGGCCTGGAGGTCAGCCGG - Intergenic
1160727786 19:625186-625208 CAGCAGGTCCGGAGTCAAGCCGG + Exonic
1160752550 19:741354-741376 CAGCTGGGCTGGAGGGCTGAGGG + Intronic
1160844434 19:1160225-1160247 CAGCCGGGCTGCAGGGATGTGGG - Intronic
1160899973 19:1422888-1422910 CAGCAGGGCAGGTGGGAGGAGGG + Intronic
1160948414 19:1654213-1654235 CAGGATGGCTGGAGCCAAGCGGG - Intergenic
1160969730 19:1762256-1762278 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1160988761 19:1852104-1852126 CAACGGGGCGGGCGGGAAGCTGG + Intergenic
1161026659 19:2040197-2040219 GGGCAGGGCTGGAGAGCAGCTGG + Intronic
1161101674 19:2424720-2424742 CTGCAGGGCTGGAGGTCAGAAGG + Intronic
1161210611 19:3063299-3063321 CAGGAAGGCCGGAGGGAGGCAGG + Intergenic
1161233769 19:3188180-3188202 CCGGGGGGCTGGAGGGAGGCCGG - Intronic
1161354200 19:3810161-3810183 CCGCAGGGCGGGGGGGAGGCCGG + Intronic
1161737201 19:5998683-5998705 CACCGGGGCTGTGGGGAAGCTGG - Intronic
1161770947 19:6230417-6230439 CAGCAGAGCTGGAGGGGACCTGG - Intronic
1161895257 19:7075036-7075058 CAACAGGGCAGCCGGGAAGCAGG - Exonic
1161994235 19:7702661-7702683 TAGGAGGGAAGGAGGGAAGCGGG + Intergenic
1162134745 19:8548430-8548452 AAAGAGGGCTGGAGGGAAACTGG - Intronic
1162174726 19:8822676-8822698 CAACAGGGCAGCCGGGAAGCAGG + Exonic
1162566450 19:11447716-11447738 CAGCAGGGCTGGCCGGCTGCGGG - Exonic
1162725164 19:12685896-12685918 CACCAGGGCTGGAGTGCAGTGGG + Intergenic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1163163431 19:15479428-15479450 CGGCAGTGCTGGAGGGAGACAGG + Exonic
1163460836 19:17436596-17436618 CTGCAGCCCTGGAGGGAGGCTGG - Exonic
1163641586 19:18465375-18465397 TGGCAGGGCTGTAGGGCAGCCGG - Intronic
1163831307 19:19548351-19548373 CAGCAGGGATGGGGAGGAGCTGG - Intergenic
1164918760 19:32072886-32072908 CTGCTGTGCTGGTGGGAAGCAGG - Intergenic
1165050641 19:33139325-33139347 CAGGAGGGCTGGGGAGGAGCAGG + Intronic
1165226227 19:34357198-34357220 CAGCAGTGCTGGAGGCCAGAGGG + Intergenic
1165596916 19:37016689-37016711 CAGCAGTGCTGAGGAGAAGCAGG + Intronic
1166108772 19:40610447-40610469 AGGCAGGGGTAGAGGGAAGCGGG - Intronic
1166766448 19:45254206-45254228 CAGCCGGGCGGGAGGGAGCCAGG + Intronic
1167672117 19:50859370-50859392 CTGCAGGGAGGGAGGGCAGCAGG + Intronic
1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG + Exonic
1168246455 19:55115060-55115082 GAGCAGGGCCTTAGGGAAGCGGG + Intronic
1168472685 19:56652243-56652265 CAGCGGGGAGTGAGGGAAGCTGG + Intronic
1168601677 19:57723714-57723736 CAGTAGGGTGGGGGGGAAGCTGG - Intronic
925048164 2:790092-790114 AAGCATGGCAGGAGGCAAGCAGG + Intergenic
925164810 2:1709448-1709470 CAGCGGGGCTGGGGTGCAGCGGG + Intronic
925164815 2:1709464-1709486 CAGCGGGGCTGGGGTGCAGCAGG + Intronic
925203519 2:1988106-1988128 CAGCTGGGCTGGCGGGAGGGTGG - Intronic
925203533 2:1988159-1988181 CAGCTGGGCTGGCGGGAGGGTGG - Intronic
925253876 2:2465671-2465693 TGGCACGGCTGGAGAGAAGCAGG - Intergenic
925267296 2:2574941-2574963 CAGCAGGATTGGAGGCCAGCAGG - Intergenic
925900441 2:8505512-8505534 CAGCATGGCTGGAGCGATGCGGG - Intergenic
926045950 2:9709729-9709751 CAGCAGGGGTTGGGGGAGGCTGG - Intergenic
926108331 2:10166338-10166360 GAGCAGGGCTGGTGGACAGCAGG - Intronic
927250539 2:20991821-20991843 GAGCATGGCTGGAGGAGAGCAGG + Intergenic
927653788 2:24928655-24928677 CAGCAGTACTGGAGGGGAGGCGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927963279 2:27254223-27254245 CAGGCTGGCTGGAGGGAGGCTGG - Intronic
929149316 2:38733489-38733511 CAGCAGCACAGGAGGGAAGCGGG - Exonic
929502841 2:42504920-42504942 CAGCATGACTGGAGTGAGGCTGG - Intronic
929595109 2:43170780-43170802 GGGCAGTGCTGGAGGGAGGCAGG - Intergenic
929759944 2:44798463-44798485 ATGCGGGGCTGGAGGAAAGCAGG - Intergenic
929811028 2:45189552-45189574 CAGCAGTGGGGAAGGGAAGCCGG - Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
931054168 2:58450011-58450033 CAGAGGGGCTTGAGGGAACCTGG - Intergenic
932122318 2:69113180-69113202 CAGCAGGACTAGGGGGAAGGTGG - Intronic
932168992 2:69536432-69536454 CAACAGGGATGGAAGTAAGCAGG + Intronic
932580690 2:72991105-72991127 AGGCAGGGCTGGAGAGCAGCGGG + Intronic
932594899 2:73087750-73087772 CCCCTGAGCTGGAGGGAAGCAGG - Intronic
932852515 2:75200504-75200526 CGGCAGGGCAGGATGGAGGCGGG - Intergenic
932865622 2:75338554-75338576 GAGCAAGCCTTGAGGGAAGCTGG + Intergenic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
933480748 2:82854133-82854155 AGACAAGGCTGGAGGGAAGCAGG - Intergenic
933656206 2:84888981-84889003 CAGCAGCACGGAAGGGAAGCTGG + Intronic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
933779845 2:85794053-85794075 TATCAGGGCTGGGGGGAGGCAGG - Intergenic
934540956 2:95174642-95174664 CAGCAGGGAGGGATGGAAGGAGG - Intronic
934588571 2:95526891-95526913 CAGCCGGGCAGGTGGGAGGCCGG - Intergenic
934674583 2:96240663-96240685 CTGCAGGGAAGGAAGGAAGCAGG - Intergenic
934714707 2:96536900-96536922 CACGAGGGCTGGAGGGGACCCGG - Intronic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
936096582 2:109534920-109534942 AAGCAGTGCTGGAGGGGAGGGGG - Intergenic
936115596 2:109700456-109700478 CAGGAGGACTGGAAGGAAGCGGG + Intergenic
936566202 2:113584203-113584225 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
936929571 2:117773762-117773784 CAGCAGGTCTGGGGTGAGGCTGG - Intergenic
937028539 2:118719092-118719114 TACCAGGGCTGGAGAGAGGCAGG + Intergenic
937223153 2:120353542-120353564 AGGGAGGGCTGGAGGGAAGAAGG - Intergenic
937234715 2:120423706-120423728 GAGCAGGGCTGGATGGCACCAGG - Intergenic
937890491 2:126934896-126934918 CAGGTGGGGTGGAGTGAAGCAGG + Intergenic
937978608 2:127597140-127597162 CAGCTGTGCTGCTGGGAAGCCGG + Intronic
938034744 2:128027224-128027246 CAGCGGGGCTGGACAGCAGCGGG - Exonic
938240266 2:129737934-129737956 CAGGAGGGCAGGAGGGCAGGAGG - Intergenic
938271919 2:129979946-129979968 GAGCCCGGCTGGAGGGCAGCAGG - Exonic
938371258 2:130769757-130769779 CACCAGGGCTGGAGAAAAGGAGG - Intergenic
938380554 2:130834133-130834155 CAGCTAGCCTGGTGGGAAGCCGG - Intergenic
938444083 2:131363854-131363876 GAGCCCGGCTGGAGGGCAGCAGG + Intergenic
938648596 2:133356438-133356460 CAGCAGAGCTGTAGGGAAAGTGG - Intronic
938860583 2:135364091-135364113 AAGGAGGGCAGGAGGGAAGGAGG + Intronic
939408663 2:141795411-141795433 CAGCAGCCCTTGAGGGAAGATGG + Intronic
941294197 2:163715507-163715529 CAGAGCGGCTGGAGTGAAGCAGG - Intronic
941987459 2:171522888-171522910 CGGCTGGGCGGGAGGGAGGCTGG + Intronic
942181873 2:173387943-173387965 CAGCAGAGCAGAAGGGAGGCTGG + Intergenic
942181937 2:173388496-173388518 CAGAGGGTCTGGAAGGAAGCAGG + Intergenic
943088751 2:183349221-183349243 CAGAGAGCCTGGAGGGAAGCGGG - Intergenic
943182637 2:184562473-184562495 CAGCATGGCTGGAATAAAGCAGG + Intergenic
943346932 2:186749702-186749724 CCACAGGGCTAGAGGGCAGCAGG - Intronic
943716237 2:191155230-191155252 CAGCAAGGTGGCAGGGAAGCTGG - Intergenic
944656820 2:201883790-201883812 CAGCAGGGCAGGACGTCAGCTGG + Intronic
945025687 2:205617737-205617759 CAGCAGGTCAGCAGGGAAACCGG - Intronic
946064387 2:216974258-216974280 CAGCAGGGCTGGAAAGAACCTGG - Intergenic
946236484 2:218327425-218327447 CAGCCTGGCAGGAGGGGAGCAGG + Intronic
946328812 2:218998598-218998620 CGCCAGGGGTGGTGGGAAGCAGG - Intergenic
946394154 2:219434946-219434968 GAGCTGGGCTGGGGGGACGCCGG - Exonic
947722576 2:232378786-232378808 CAGCATGTCTGGAGGGCAGCAGG - Exonic
948207493 2:236169932-236169954 CAGCAGACCTGGAGGAAAGAGGG + Intergenic
948571916 2:238923014-238923036 CTGCAGGTGGGGAGGGAAGCAGG - Intergenic
948610232 2:239162113-239162135 CAGTGGGGCTGCTGGGAAGCAGG - Intronic
948645058 2:239399584-239399606 CAGCAGGACTGGGGGGATACTGG - Intronic
948650663 2:239441388-239441410 CAGCAGGGAGGGAGGGAGGCCGG + Intergenic
948931946 2:241137535-241137557 CAGCAGGGAGGGAGGGAGGGAGG + Intronic
949041777 2:241852931-241852953 GAGCAGGGCTGGGGAGAAGGTGG + Exonic
1168846085 20:945548-945570 CAGGAGAGGTGCAGGGAAGCTGG - Intergenic
1168893822 20:1310477-1310499 GAGCAGGACTGGAGGCAACCTGG + Exonic
1169074618 20:2752952-2752974 ACTCAGGGCTCGAGGGAAGCCGG + Intronic
1169359904 20:4939194-4939216 CACCAGGGGTGGAGGTAAGATGG - Intronic
1170161262 20:13313524-13313546 CAGCAGGGCTGGAGTGTTGCTGG + Intergenic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1171016966 20:21550654-21550676 CACCCGGGCTGTCGGGAAGCTGG + Intergenic
1171344105 20:24452690-24452712 AAGGAGGGCTGGAGGGAAAGGGG - Intergenic
1171459460 20:25290742-25290764 CAGCCGGGCTGCAGGCGAGCAGG + Intronic
1171562925 20:26144159-26144181 TAGAAGGGCTGGAGGGAATTAGG + Intergenic
1171874049 20:30555321-30555343 CACCAGGGCCTGAGTGAAGCAGG - Intergenic
1172427290 20:34863754-34863776 CAGCTGGGCAGCAGGGAGGCTGG + Intronic
1172595726 20:36149769-36149791 CAAGAGAGCTGGAGGGCAGCTGG - Intronic
1172858744 20:38030248-38030270 AAGGAGGGAGGGAGGGAAGCAGG + Intronic
1173557698 20:43978347-43978369 AAGAAGGGCGGGAGGGAGGCAGG - Intronic
1173657407 20:44709890-44709912 CAGCAGGGCTGGAAGTGAGGAGG - Intergenic
1174048192 20:47748562-47748584 GAGCAGGGCTGGAAGGCGGCAGG - Intronic
1174185602 20:48703821-48703843 CAGCAGGGCTGGGGTGGAGGGGG - Intronic
1174301881 20:49588341-49588363 CATCCGGGCTGGAGAGATGCTGG + Intergenic
1174394526 20:50238566-50238588 CAACAGGGCTGGAGAGACACGGG - Intergenic
1175123656 20:56735882-56735904 CAGCAGGGATGAAGGGATGGTGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175258912 20:57662904-57662926 CTGCAGGGCCGGTGGGATGCAGG + Intronic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175390594 20:58624920-58624942 CGGCAGGGCTGGAGAGCAGGGGG + Intergenic
1175449604 20:59051848-59051870 GAGCAGGTCTGGAGGGAGACAGG + Intergenic
1175816207 20:61884482-61884504 CAGGAGGGAGGGAGGGAAGATGG + Intronic
1175923237 20:62459591-62459613 GGGCAGGGCGGGAGGGAGGCAGG - Intergenic
1175971242 20:62687737-62687759 CAGCAGAGGTACAGGGAAGCCGG - Intergenic
1176151782 20:63595233-63595255 CGCCAGGTCAGGAGGGAAGCGGG + Intronic
1176946632 21:14990200-14990222 GAGGAGGGGTGGAGGGAGGCAGG - Intronic
1177046895 21:16182539-16182561 AAGGAGGGATGGAGGGAGGCAGG - Intergenic
1178600902 21:33993483-33993505 CAGCAGGGAAGGGGAGAAGCTGG - Intergenic
1178736142 21:35153766-35153788 CAGCAGGTCTGGAGCACAGCTGG + Intronic
1178744775 21:35238261-35238283 CAGCAGGGGTGGAGGGGAGCTGG + Intronic
1178877319 21:36423037-36423059 CCGCAGGGGTGGTGGGCAGCCGG + Intergenic
1179371020 21:40806076-40806098 CAGCAGGGCTGAGGTGTAGCAGG - Intronic
1179403757 21:41108668-41108690 CCTCATGGCTGGAGGGAAGCTGG + Intergenic
1179407254 21:41136355-41136377 CTGCAGGGCTGGTGGGAGCCAGG + Intergenic
1179450689 21:41466553-41466575 AGGCAGGGCAGGAGGGAAGCTGG - Intronic
1179502849 21:41820904-41820926 CAGCAGGGCTCGGGGGCAGCTGG - Intronic
1179719124 21:43305546-43305568 GAGCAGGGCAGGAGGCGAGCTGG - Intergenic
1179912743 21:44459082-44459104 CAGCGTGGCGTGAGGGAAGCAGG - Exonic
1180098871 21:45574995-45575017 CCACAGGGCTGGCAGGAAGCGGG + Intergenic
1180151561 21:45950801-45950823 CAACAGGGCTGGAGGGAGGGAGG - Intergenic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181545442 22:23599695-23599717 AACCAGGGCTGGAGGGCAGAGGG - Intergenic
1181630250 22:24147344-24147366 AAGCAGGGAGGGAGGGAGGCAGG - Intronic
1181814868 22:25430204-25430226 AACCAGGGCTGGAGGGCAGAGGG + Intergenic
1182098567 22:27642161-27642183 CAGCAGGGGTCGAGGGCAGGGGG + Intergenic
1182473976 22:30565858-30565880 CAGCAGTGCTGAAGGGAGGATGG - Intronic
1182989182 22:34750714-34750736 CAGCAGGGTTGGAGGAAAGTGGG + Intergenic
1183109230 22:35636825-35636847 CAGCTGGGAGGGAGGGAAGAGGG - Intronic
1183174529 22:36213048-36213070 CAGAAGGGCTGGAGTGGGGCTGG + Intergenic
1183417091 22:37688774-37688796 CTCCAGGGCGGGAGGGAGGCTGG + Intronic
1183481032 22:38065683-38065705 CGGCAGGGGTGGGGGAAAGCGGG - Intronic
1183548056 22:38465840-38465862 GGGCAGGGTTGGAGGGGAGCGGG + Intergenic
1183977297 22:41519977-41519999 TTGCAGGGCTGGAGGGAGCCCGG + Intronic
1183978718 22:41527596-41527618 AAGCAGGGCCTGCGGGAAGCCGG - Exonic
1184199733 22:42959844-42959866 CAGCAGGGTTGGAAAGAGGCAGG - Intronic
1184301160 22:43561933-43561955 GAGCAGGGCTGCAGGAAAGGCGG + Intronic
1184378254 22:44128731-44128753 CTGCAGGGCTGGCTGGTAGCAGG - Intronic
1184444878 22:44541200-44541222 CAGCAGGGTAGGGGAGAAGCTGG - Intergenic
1184490742 22:44807347-44807369 CAGCAGGGCAGGATGGAACGTGG + Intronic
1184678198 22:46054568-46054590 CAGCAGGGGTGGAGGGTGGGAGG + Intronic
1185042778 22:48513921-48513943 CAGCAGGGCAGGAGGAAAGGGGG + Intronic
1185058605 22:48593817-48593839 CAGCAGGGCAGGAGGGCGGCAGG - Intronic
1185068893 22:48645595-48645617 CCACAGGGCACGAGGGAAGCAGG - Intronic
1185098621 22:48825664-48825686 CAGCCCGGCTGGAAGGGAGCAGG + Intronic
1185134285 22:49060308-49060330 CAGGAGGGCTGGAGGGTGGAAGG - Intergenic
1185228209 22:49665178-49665200 CAGCGGGGCTGGGGGTCAGCAGG - Intergenic
1185338397 22:50280966-50280988 CATCAGGTCTGGGGGGAGGCTGG + Exonic
949372156 3:3347305-3347327 CAGCATGGCTGGAATAAAGCAGG + Intergenic
950004016 3:9679849-9679871 CAGCAGGGCTGGAGTGTAGCAGG + Intronic
950201945 3:11050720-11050742 CATCAGGGCATGAGGGAAGCAGG - Intergenic
950257490 3:11517772-11517794 CAGCAGAGCTGGAGAGAGTCGGG + Intronic
950448555 3:13052678-13052700 CAGGAGGGCTGTGGGGAAACTGG - Intronic
950482127 3:13250795-13250817 CAGCAGGGGTGGGGGAAAGCTGG - Intergenic
950526863 3:13529348-13529370 CAGGAGGGATGGAGGGAAAAGGG - Intergenic
950646059 3:14377483-14377505 AAGCTGGGCTGAAGGGCAGCAGG - Intergenic
950708416 3:14798061-14798083 CAGCAGGGAGTGAGGGATGCAGG - Intergenic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
951733533 3:25837021-25837043 CAGCAGGGACTGAGGGCAGCAGG - Intergenic
952003254 3:28810294-28810316 GAGCAGGGCTGGAGGGAACTGGG + Intergenic
952437491 3:33286752-33286774 CTGCAAGGCAGGAGAGAAGCTGG - Intronic
952960961 3:38588862-38588884 GAGGTGGGCTGGAGGGCAGCGGG + Intronic
953038935 3:39237796-39237818 CCGGAGGGAGGGAGGGAAGCAGG - Intergenic
953448582 3:42988137-42988159 CAGCTGGGCTGGAGGCCAGAAGG - Intronic
953621467 3:44536357-44536379 CAGCAGCGAAGGAGTGAAGCAGG - Intergenic
953775506 3:45813189-45813211 CAAGAGTGCTGGAGGGATGCTGG - Intergenic
953788999 3:45932039-45932061 CAGCAGGGATGCAGTGAGGCAGG - Intronic
954217560 3:49132969-49132991 CAGAGGGCCTGGAGGGAAACAGG - Exonic
954297141 3:49680610-49680632 CACCAGGGTTGGAGGTAGGCTGG - Exonic
954361825 3:50126237-50126259 CAGAAGGGATGGTGGGAAGAGGG + Intergenic
954709405 3:52497871-52497893 CAACAGGACTGGAGTGAAGATGG + Intronic
954920573 3:54187482-54187504 CTGCAGGGCTGGAGGGTAATGGG + Intronic
955393268 3:58536508-58536530 CAGCAGGGCTGTGGGGGTGCTGG + Intronic
955412324 3:58663814-58663836 CAGCAGGGCCGGGGAGAGGCTGG - Intronic
955503289 3:59606276-59606298 AATCAGGTCTGGAGGGTAGCCGG + Intergenic
955770236 3:62378156-62378178 AAGGAGAGCTGGAGGGAAGAAGG - Intergenic
958177589 3:90016235-90016257 CTGCAGAGCTGGGGAGAAGCGGG + Intergenic
958489796 3:94757791-94757813 CAGCAGGCCTGGAGAGAAGGTGG + Intergenic
960004449 3:112767620-112767642 CAGGAGGGAGGGAGGGAAGTTGG - Intronic
960382010 3:116974458-116974480 CTGCAGGGCTGCAGACAAGCTGG - Intronic
961171482 3:124800772-124800794 CAGAAAGGCTGGAAGGCAGCTGG + Intronic
961328432 3:126125209-126125231 CAGAAGTCCTGGAGAGAAGCAGG - Intronic
961369603 3:126421507-126421529 AAGCAGGGATGGAGAGAAGTGGG + Intronic
961723413 3:128910415-128910437 CCGCTGTGCTGGAGGGAGGCGGG + Intronic
961733400 3:128984365-128984387 CAGCATGGCTAGAAGAAAGCAGG + Intronic
961811910 3:129526914-129526936 CAGGTGGGCTGCAGGGAAGGGGG + Intergenic
962367768 3:134797167-134797189 CAGCAGTCCCTGAGGGAAGCAGG - Intronic
962369040 3:134805527-134805549 CAGGAGGGCAGGAGGCAAGGTGG - Intronic
962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG + Intergenic
962736541 3:138330109-138330131 AGGCAGGGCAGGAGGGATGCAGG - Intergenic
963121164 3:141778229-141778251 CAAGAGGGCTGGAGGGCTGCTGG - Exonic
964019997 3:151998618-151998640 CAGCATGGCTGGATTGAAACAGG - Intergenic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
964421736 3:156510846-156510868 CAAAGGGGCAGGAGGGAAGCCGG - Intronic
964577774 3:158194231-158194253 CAGCCAGGCTGGAGTGCAGCAGG - Intronic
964768708 3:160202690-160202712 CAGCAGGGCTGGGGTCAAGATGG - Intergenic
965083887 3:164069463-164069485 CAGGAGGGAAGGAGGGAAGGTGG + Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
966747974 3:183296416-183296438 CTTCAGGGCTGGAGGGAGCCTGG - Intronic
966912391 3:184566708-184566730 CAGCGGGGCAGGAGGGCAGGGGG - Intronic
967104197 3:186242262-186242284 GGGCAGGGCTGGAGGGCAGGAGG - Intronic
967516276 3:190372601-190372623 CACCAAGGCTGGAGGGTAGTAGG - Intronic
967829444 3:193906185-193906207 CGTCAGTGGTGGAGGGAAGCAGG + Intergenic
968353206 3:198080253-198080275 CTGCGGGGCTGCGGGGAAGCCGG + Intergenic
968500726 4:948602-948624 CTGCAGGCCTGGAGGTGAGCGGG + Intronic
968844242 4:3031092-3031114 AAGATGGGCTGGAGGGAAGGGGG + Intronic
969211356 4:5689939-5689961 CAGCAGAGCTGGAGAGAAGCTGG - Intronic
969227889 4:5811091-5811113 CAGCACTGCAGGAGGGAAGGTGG - Exonic
969965523 4:10990551-10990573 CAGCAGAGGTGGAGCAAAGCTGG + Intergenic
970137746 4:12944412-12944434 CAGCAGGGCAGAAAGGAAGGAGG - Intergenic
970534369 4:17014268-17014290 CAGAAGGGCTGGAAGCAGGCAGG - Intergenic
970767179 4:19563757-19563779 CACCAGGGCTGGAGACAAGAAGG - Intergenic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971051460 4:22867200-22867222 CAGCATGGCTGGAATAAAGCAGG + Intergenic
972430885 4:38980770-38980792 CATCAGGGTGGGAGGGGAGCAGG + Intronic
972750137 4:41980404-41980426 CAGCTGGGCTGGAGTGCAGTGGG + Intergenic
974694024 4:65341045-65341067 GAGGAGGGATGAAGGGAAGCCGG - Intronic
974877684 4:67717968-67717990 CAGCATGGCTGGAGACACGCTGG + Intergenic
975089240 4:70381418-70381440 AAGGAGGGCAGGAGGGAAGGAGG + Intronic
975720536 4:77244707-77244729 CAGCATGGCTAGAAGAAAGCAGG - Intronic
978645394 4:110925079-110925101 CAGCAGAGATGGAGAGAAACTGG - Intergenic
980078618 4:128320513-128320535 AAGGAGGGAGGGAGGGAAGCAGG - Intergenic
981802135 4:148670216-148670238 GAACAGGGATGCAGGGAAGCAGG + Intergenic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
982529262 4:156517989-156518011 AAGGAGGGAGGGAGGGAAGCAGG + Intergenic
982670417 4:158313945-158313967 CAGAAGGGCTGGTGGGCAGGTGG + Intergenic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
983382072 4:167008838-167008860 CAGCAAGAAGGGAGGGAAGCAGG + Intronic
984373343 4:178894652-178894674 CAGCACCGGTGGAGGGAAGGAGG + Intergenic
984744312 4:183199158-183199180 AAGCAGGACTTGAGGAAAGCAGG + Intronic
984852406 4:184165439-184165461 CACCGTGGCTGGAGGGGAGCAGG - Intronic
984853357 4:184172537-184172559 GAGCAGGTCAGGATGGAAGCAGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985017332 4:185650363-185650385 GAGCAGGGCAAGAGGGGAGCAGG + Intronic
985135935 4:186786218-186786240 CAAAAGAGCTGGAGGGAAACAGG - Intergenic
985528588 5:420677-420699 CAGGAGGGCGGGATGGCAGCGGG + Intronic
985552505 5:540787-540809 CAGCAGGCCAGGAGGGAGACGGG - Intergenic
985580934 5:694714-694736 CACCCGAGCAGGAGGGAAGCAGG - Intergenic
985595559 5:786046-786068 CACCCGAGCAGGAGGGAAGCAGG - Intergenic
985657961 5:1141991-1142013 CTGCAGGGCTGCAGGGAAGAGGG - Intergenic
985663624 5:1169855-1169877 CAGCAGGGAAGGAGGGGAGGAGG + Intergenic
985805213 5:2038661-2038683 GGGCCGGGCTGGAGGGACGCTGG - Intergenic
986074936 5:4326816-4326838 CAGTAGAGGTGGAGGGCAGCAGG - Intergenic
986074948 5:4326862-4326884 CAGCAGAGGTGGAGGGCAGCAGG - Intergenic
986144713 5:5066461-5066483 CAGCAGGGCTGGGAGGAAATTGG + Intergenic
986191724 5:5502693-5502715 CAGCATGGCTGGAACCAAGCAGG + Intergenic
986733171 5:10649782-10649804 CCCCAGGGCGGGAGGGAGGCCGG - Exonic
986736589 5:10672961-10672983 CTGCAGGGATGGCAGGAAGCTGG - Intergenic
987539437 5:19235060-19235082 CAGCAAGGCTGGAATAAAGCAGG + Intergenic
988907315 5:35802749-35802771 CAGCAGAGCTGGAGAGGACCAGG + Intronic
989043161 5:37249461-37249483 GAGCAGGGCTGGAGGGGCGGAGG - Intergenic
989463598 5:41728805-41728827 AGGCACGGCTGGAGGGAAGTTGG + Intergenic
989658866 5:43776696-43776718 TAGCTGGGGTGGAGGGAAACTGG - Intergenic
990816752 5:59794477-59794499 CAGGAGGGAGGGAGGGAAGGAGG - Intronic
991259374 5:64650521-64650543 CAGCAGGGCTAGAATAAAGCAGG - Intergenic
992888909 5:81185789-81185811 CGCCAGGGCTAGAGGGAGGCTGG + Intronic
993480163 5:88414972-88414994 CACCCAGGCTGGAGGGCAGCTGG + Intergenic
994342155 5:98642948-98642970 CAGCAATGATGGAGGGCAGCAGG + Intergenic
995077124 5:107999017-107999039 CAGCAGACCTGGAGGGAAATGGG - Intronic
995120074 5:108526614-108526636 TACCAGGGGTTGAGGGAAGCAGG - Intergenic
995207446 5:109497433-109497455 CAAGAGGGATGGAGGGAAGAAGG + Intergenic
995468031 5:112470904-112470926 CATCACTGCTGGAGGGAGGCAGG + Intergenic
996387733 5:122926377-122926399 CTGCAGGGCAGGAGTGAAGCAGG + Intronic
996404076 5:123089748-123089770 CAGCATTGCTGGATGGGAGCTGG + Intronic
998040003 5:138945840-138945862 CAGCAGGGCAGGCTGGAGGCAGG - Intergenic
998159664 5:139806271-139806293 CAGCAGGGCTGGAGGTGGGAAGG + Intronic
998426268 5:142031350-142031372 AAGGAGGGTTGAAGGGAAGCAGG - Intergenic
999231178 5:150062938-150062960 CATCATGGCTTGAGGGAAGTGGG + Intronic
999255351 5:150206897-150206919 CAGCAGGGCAGCAGGGCAGCGGG - Intronic
999275716 5:150328776-150328798 CAGCAGAGAGGGAGTGAAGCAGG + Intronic
1000390948 5:160722774-160722796 GTGCATGGCTGGAGGGAAGCAGG - Intronic
1001223474 5:169924073-169924095 CAGCAGGGCAGGGAGGAAGAGGG - Intronic
1001311039 5:170611175-170611197 CAGCTGGGCAGGAAGGAAGCAGG + Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001919496 5:175588958-175588980 CAGCAAGGAAGGAGGGAAGGAGG + Intergenic
1002063045 5:176637738-176637760 GAGGAGGGCTGGAGGGAGGAGGG + Intronic
1002401811 5:178995177-178995199 CGGCAGGGCTGGAGGGGTGGAGG - Intronic
1002454574 5:179338847-179338869 CACCAGGCGTGGAGGGAAGCCGG + Intronic
1002461431 5:179375845-179375867 CAGCAGGGGAGGGGGGAAGGGGG + Intergenic
1002587618 5:180261167-180261189 CACCAGTGATGCAGGGAAGCTGG + Intronic
1002782991 6:381014-381036 CAGGAGGGGTGGAGGGAAAGAGG + Intergenic
1003153423 6:3571641-3571663 CAGTAGGGCTGGAGCAAGGCTGG + Intergenic
1003236046 6:4295901-4295923 CAGCAGGACTGGGGTGAGGCTGG - Intergenic
1003249443 6:4413126-4413148 CAGCTGGGGTGGGGGAAAGCCGG + Intergenic
1003270429 6:4603056-4603078 CAGCAAGGCTGTGGGGAAGTAGG - Intergenic
1003351660 6:5323682-5323704 GGGAAGAGCTGGAGGGAAGCTGG + Intronic
1003554759 6:7129752-7129774 CAGCCGGGCAGCAGGGAACCTGG + Intronic
1003955900 6:11164824-11164846 CCGCAGGGCAGCAGGGTAGCTGG + Intergenic
1003974101 6:11326656-11326678 CAGGAGGGGCAGAGGGAAGCTGG - Intronic
1005149488 6:22732609-22732631 CAGCAGGGGTGGATGGGTGCCGG + Intergenic
1005161695 6:22871527-22871549 CAGAAAGGCTGGAGGGGAGCTGG + Intergenic
1005264882 6:24101233-24101255 CAACAGGGCTGGAGGAAAATGGG + Intergenic
1005504392 6:26457477-26457499 CAGGAGGGCTTGGGGGAAGCTGG - Intergenic
1005813199 6:29531498-29531520 CAGCAGCCCTGGAGAGCAGCAGG + Intergenic
1006055203 6:31378898-31378920 CTGCAGGGCTGGGGGTAACCGGG - Intergenic
1006129306 6:31859811-31859833 CAGCATGGATGGAGAGGAGCAGG - Exonic
1006332904 6:33405091-33405113 CACCAGGGCCAGAGGGAAACAGG - Exonic
1006420561 6:33931281-33931303 CTTGAGGGCTGGAGGGTAGCGGG + Intergenic
1006516875 6:34550181-34550203 CAGCAGGGCAAGAGAGAGGCTGG - Intronic
1006750649 6:36374628-36374650 CATCAGGGCTGTGGGGAAGCTGG + Intronic
1006791384 6:36703506-36703528 GAGCAGGGTGGGAGGGAATCAGG + Intronic
1006939792 6:37744113-37744135 CATCAGGGCTGGTGGGAGGATGG + Intergenic
1007174317 6:39885715-39885737 CAGCAGGACTGGAGAGATCCCGG + Intronic
1007337976 6:41168469-41168491 CATCCGGGATGGAGGGAGGCAGG - Intergenic
1007340155 6:41186169-41186191 CAGGAGGCCTGGAAGGAAGGGGG + Intergenic
1007761268 6:44135003-44135025 CAGCAGTGCCTGAGGGAAGAGGG - Exonic
1007762476 6:44141116-44141138 CAGCAGGGCTTGAGGGTAGGGGG - Intronic
1007840625 6:44713089-44713111 CAGCAAGGTTGGGGGGAAGTTGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008408693 6:51147923-51147945 CATCAGTGCTGCAGAGAAGCGGG + Intergenic
1008883570 6:56408015-56408037 AAGCAGAGCTAGAGGAAAGCTGG - Intergenic
1009566204 6:65313991-65314013 CAGCAAGGCTGGAGGGGAGTGGG - Intronic
1009928800 6:70151663-70151685 GGGCAGGGGTGGAGGGCAGCTGG + Intronic
1010001885 6:70956675-70956697 CAGGTGAGCTGGCGGGAAGCGGG + Exonic
1011789165 6:90879416-90879438 CAGCTGGGTTGGAGGGGAGAAGG - Intergenic
1011830173 6:91362826-91362848 CAGCATGGCTAGAATGAAGCAGG + Intergenic
1011884383 6:92076049-92076071 CAGCAGCTCTGTGGGGAAGCAGG - Intergenic
1012359404 6:98358662-98358684 CAGCAAGGATGGTGGGAAGGAGG + Intergenic
1014257959 6:119183131-119183153 CATCAGGGCTGGAGGACAGAAGG + Intronic
1014731669 6:125039025-125039047 CAGCAGGGATGGGGGCAGGCGGG - Intronic
1015411484 6:132898370-132898392 CAGCAGGCATTGAGGAAAGCAGG + Intergenic
1015856580 6:137631454-137631476 CCTTAGGGCTGGAAGGAAGCTGG + Intergenic
1016219264 6:141646643-141646665 CAGCTGGGATGGAGGGCACCAGG - Intergenic
1016363708 6:143293783-143293805 AGGCATGGCTGTAGGGAAGCTGG - Intronic
1016804873 6:148202487-148202509 CAGGAGGGCTGCCGGGAGGCTGG + Intergenic
1017010263 6:150058493-150058515 CAGCGGGGCTAGAGGAGAGCAGG - Intergenic
1017033985 6:150250841-150250863 GATCAGGGCAGGAGGGAAGGTGG - Intergenic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1017740032 6:157398282-157398304 CTGCAGTCCTGGAGGGAACCTGG + Intronic
1017758086 6:157546609-157546631 CAGCAGGGGGCCAGGGAAGCTGG + Intronic
1017993627 6:159511386-159511408 GAGCAGGGCTGCTGGGGAGCTGG + Intergenic
1018197604 6:161368711-161368733 CAGAAGGGCGGGTGGGCAGCTGG - Intronic
1018811216 6:167299793-167299815 CCGCAGGGCTGGGGGCAAGGTGG + Intronic
1018829020 6:167428049-167428071 CTGCAGGGCTGCAGGTCAGCAGG - Intergenic
1019357138 7:586495-586517 CAACAGGGCTGGAGGGTGGCAGG - Intronic
1019406148 7:885300-885322 CAGCAGGCGTGGAGGGCAGGAGG - Intronic
1019432688 7:1006834-1006856 CAGCAGGGCTGGGGAGAGGAGGG - Intronic
1019523178 7:1469558-1469580 CGGCTGGGGTGGAGGGCAGCCGG + Intergenic
1019608096 7:1920157-1920179 CTGCAGGGTTGGGGGCAAGCCGG - Intronic
1019700344 7:2471751-2471773 CCCCAGCGCTGGAGGGCAGCGGG + Intergenic
1019920540 7:4160720-4160742 CACCAGGGCTGTCAGGAAGCTGG + Intronic
1019935038 7:4249308-4249330 GAGCAGGACTGGTGGGAAGGTGG - Intronic
1019935984 7:4258309-4258331 CTGCCAGGCTGTAGGGAAGCAGG - Intronic
1020023263 7:4881941-4881963 AAGCAGGGGTGGGGGGAAGTGGG - Intronic
1020083657 7:5299225-5299247 TAACAGGGCTGGAGGGTGGCGGG - Exonic
1020257199 7:6508925-6508947 AAGCAGGTGTGGAGGGAGGCGGG - Intronic
1021334995 7:19389380-19389402 CACCCAGGCTGGAGGGCAGCGGG + Intergenic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1022423566 7:30246469-30246491 CAGCAGCACCGGAGGAAAGCAGG + Intergenic
1022471253 7:30682942-30682964 GAGGAGGCCTGGAGGGAAGCAGG + Intronic
1022941854 7:35249369-35249391 CTGCAGGGCTGCAGGGAGGTTGG - Intronic
1023056926 7:36298268-36298290 CAACAGGGCTGGAAGGAAGTTGG + Intronic
1023746445 7:43326805-43326827 AAGCAGGGCTCCAGGGGAGCCGG + Intronic
1023840909 7:44097020-44097042 CCCCAGGGCTGGAGGGAGGAGGG + Intergenic
1023906021 7:44521936-44521958 CAGCAAGGCAGCAGGGCAGCAGG + Intronic
1023981647 7:45073986-45074008 CAGCAGGGCAGGGTGGAAGTTGG - Intronic
1024213763 7:47228902-47228924 AAGCAAGGTTGGAGGGAGGCGGG - Intergenic
1024283219 7:47736339-47736361 AAGCAGGGAGGGAGGGAAGGAGG - Intronic
1024633479 7:51268069-51268091 CTGCAGGGCAGGAGGGAGGAAGG - Intronic
1025085593 7:56020693-56020715 CTGCAGGGCGGGAGGGCAGGAGG + Intronic
1025607183 7:63047769-63047791 CAGCAGGCCTGGGGCAAAGCAGG - Intergenic
1026111595 7:67462851-67462873 CTCCAGGGCAGCAGGGAAGCCGG + Intergenic
1026896493 7:74012888-74012910 CTGGAGTGCAGGAGGGAAGCTGG + Intergenic
1027223276 7:76227550-76227572 CAGCAAGGCTGGGAGGGAGCAGG - Intronic
1028065209 7:86375781-86375803 CAGCAAGGCTGCAGCGAGGCTGG + Intergenic
1028117298 7:87013551-87013573 CAGCAGGGATGGAGTGAGGAAGG + Intronic
1028167592 7:87556431-87556453 TAGCAGTGCAGGAGGGAAGCTGG - Intronic
1028932036 7:96423988-96424010 AAGCAGGGCTGGAGGAAAGGAGG - Intergenic
1029272112 7:99383505-99383527 CAGCAGGGGAGGAAGGCAGCGGG + Intronic
1029425069 7:100489696-100489718 CATCAGGGGTGGGGGGCAGCTGG + Intronic
1029439167 7:100577794-100577816 TAGCAGGGCTGGCCGGGAGCTGG - Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029673525 7:102050300-102050322 AAGCAGTGCTGGATGGGAGCTGG + Intronic
1029926946 7:104328545-104328567 CAGGAGGGAGGGAGGGGAGCCGG + Intergenic
1030265855 7:107621139-107621161 TAGCAGGGCTGGGGATAAGCTGG - Exonic
1030466103 7:109905839-109905861 CTGCAGGGCGGCAGGGAGGCTGG + Intergenic
1031919143 7:127588627-127588649 GAGCGGGGCTGGAGGGACGCGGG - Intronic
1032530862 7:132618543-132618565 AGGCAGAACTGGAGGGAAGCAGG - Intronic
1032634640 7:133693371-133693393 CAGCAGGGCTAGAATAAAGCAGG - Intronic
1032653457 7:133903411-133903433 CAGCAGAGATGGAGGGAACTGGG + Intronic
1033131782 7:138751252-138751274 CAGCAGGGCCGGTGGGAGGCAGG - Intronic
1033569920 7:142617616-142617638 CAGCAAGGCTGCAGAGAAGATGG + Intergenic
1034033192 7:147790228-147790250 GAGCAGGGCTGGAGGGGTGCTGG - Intronic
1034439035 7:151077229-151077251 CAGGAAGTCTGGAGGGGAGCAGG + Exonic
1034441725 7:151089042-151089064 CAGCAGGGCAGCAGGGCAGCAGG - Intronic
1034455270 7:151166973-151166995 GACCAGGGCTGGCGGGAGGCCGG - Intronic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034512899 7:151550878-151550900 CAGCAGGACTTGAAGGAGGCAGG + Intergenic
1034536673 7:151729705-151729727 CTGCGGGGCTGGACGGCAGCAGG - Intronic
1034590169 7:152131846-152131868 TAGCAGGGCTGGAGTGAGGGAGG + Intergenic
1034738278 7:153449272-153449294 GACAAGGGCTGGAGGGAAGCAGG + Intergenic
1035136937 7:156712859-156712881 CAACAGGGCAGGGGGGAGGCTGG + Intronic
1035184815 7:157118222-157118244 GACCAGTGCTAGAGGGAAGCAGG + Intergenic
1035239966 7:157523177-157523199 CAGCAGGGATGGTGGGGGGCTGG + Intergenic
1035314301 7:157988642-157988664 CAGGGGGGCTGGAGGGAACCGGG + Intronic
1035392315 7:158513074-158513096 CAGCAGGGAAAGAGGGAAGCGGG + Intronic
1035557419 8:577547-577569 CAGCAGGGCTGCCTGGGAGCTGG - Intergenic
1035573150 8:687586-687608 GAGCAGGACTGGAGGGAGGCGGG + Intronic
1035587560 8:787584-787606 CAGCAGTGTTGGGTGGAAGCTGG + Intergenic
1035727861 8:1835612-1835634 CAGCAGGGTGGGAAGGACGCTGG - Intronic
1035819079 8:2572068-2572090 AGACTGGGCTGGAGGGAAGCGGG + Intergenic
1036699828 8:11005394-11005416 TGGAAGGGCTGGAGGGAAGTGGG + Intronic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1036924711 8:12893059-12893081 CAGCAGGGCTGCAGAGAACTGGG + Intergenic
1036965267 8:13290359-13290381 CAGCAGGCCTGGAGGCATCCAGG + Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037502240 8:19497174-19497196 GTGCAGGGCAGGAGGGAAGTGGG - Intronic
1037775788 8:21834803-21834825 CAGGAGGGAGGGAGGGAGGCAGG + Intergenic
1037936683 8:22919748-22919770 CTTCTGGGCTGGAGAGAAGCTGG - Intronic
1037951918 8:23024141-23024163 CAGCAGGAATGGAGGGAATAGGG - Intronic
1037985695 8:23289228-23289250 GGGCAGGGCTGGGGGGAACCAGG + Intronic
1037993743 8:23338575-23338597 CTGCATGGCGGGAGGGAAGGGGG + Intronic
1038347840 8:26748344-26748366 CAGCAGGGCTGGACGGATGTTGG - Exonic
1038540227 8:28385512-28385534 CGCCAGGGCGGGAGGGACGCGGG + Intronic
1038591899 8:28846913-28846935 TACTAGAGCTGGAGGGAAGCTGG + Intronic
1039471122 8:37814441-37814463 CAGAAGGTCTGGAGGCAGGCGGG - Intronic
1039864710 8:41490694-41490716 CAGCATGGGTGAAGGGGAGCGGG + Exonic
1039887854 8:41665335-41665357 CAACCGGGCTAGAAGGAAGCCGG + Intronic
1040007515 8:42632773-42632795 CAGCTGGGCTGGAGGGAGTGAGG - Intergenic
1040417234 8:47206194-47206216 CAACAGTGATGGAGAGAAGCAGG + Intergenic
1040449228 8:47527296-47527318 CAGGAAGGCTGGAGGAAATCTGG - Intronic
1040984404 8:53278276-53278298 CAGCAGGCCTGCAGAGAAGTGGG + Intergenic
1041078070 8:54187274-54187296 CAGCAGGGATGGAGTGCAGAGGG - Intergenic
1041406381 8:57504086-57504108 CAGCAGGGCCTGTGGGGAGCTGG - Intergenic
1041597433 8:59672434-59672456 CAGGAGGGCTGTTTGGAAGCTGG - Intergenic
1041724400 8:61004708-61004730 CAGCAGGGCTGCGGGGGAGCTGG + Intergenic
1041935128 8:63324895-63324917 AAGCAGGTCTGGGGGGAAGCTGG - Intergenic
1041945248 8:63433617-63433639 CAGCAGTGTTGAAGGGAGGCAGG + Intergenic
1042230024 8:66545711-66545733 GAGGAGGGATGGAGGGAAGGAGG + Intergenic
1042611889 8:70608620-70608642 CAGGAGGGCAGGAGGGCACCCGG - Exonic
1044220901 8:89668807-89668829 CCTCAGGACTGTAGGGAAGCGGG - Intergenic
1044328961 8:90893710-90893732 CAGCAGTGCAGGAGGCAATCAGG + Intronic
1044800418 8:95948291-95948313 GAGTTGGGCAGGAGGGAAGCAGG - Intergenic
1045161372 8:99549753-99549775 CAGCGGGCCTGGAGAGAGGCAGG - Intronic
1045485404 8:102627529-102627551 CAGCTGTCCTGGAGGAAAGCGGG + Intergenic
1045521085 8:102904013-102904035 CCGCAGAGCTGAAGGGCAGCTGG + Intronic
1047432622 8:124805849-124805871 CATCTGGGCTGGTGAGAAGCTGG - Intergenic
1047535269 8:125713512-125713534 GGACAGGGCTGGGGGGAAGCTGG + Intergenic
1048430692 8:134367747-134367769 AAGCAGGGCTGGTGGTGAGCAGG + Intergenic
1048505837 8:135020519-135020541 CAGGAGTGTTGGAGGGAAGTGGG - Intergenic
1048510179 8:135055004-135055026 CGGTGGGGCTGGGGGGAAGCTGG - Intergenic
1048842973 8:138581285-138581307 CAGCAGGGGTGGAGTGAGGTGGG - Intergenic
1049003742 8:139841920-139841942 AGACAGGGCAGGAGGGAAGCTGG + Intronic
1049277476 8:141727013-141727035 CGGCTGGGAGGGAGGGAAGCCGG - Intergenic
1049374779 8:142284230-142284252 GAGCAGGGCTGGAGGAAGACAGG + Intronic
1049399504 8:142418660-142418682 CTGCAGGGCTTGAGAGGAGCTGG - Intergenic
1049424511 8:142532144-142532166 GAGGAGGGGAGGAGGGAAGCTGG + Intronic
1049433523 8:142576006-142576028 CACCCAGGCTGGAGGGAAGCAGG + Intergenic
1049452007 8:142666977-142666999 AGGCAGGGGTGGAGGGATGCAGG + Intronic
1049508928 8:143018268-143018290 CAGCAGGGCCGGGTGGAAGGAGG + Intronic
1049512509 8:143036325-143036347 CAGCTGGACGGGAGGGCAGCTGG + Intergenic
1049594599 8:143477580-143477602 CACCAGGCCTGGAGGGAGGCAGG + Intronic
1049611506 8:143558249-143558271 CAGGCGGGCTGGCGGGAAGAGGG + Intronic
1049639817 8:143710423-143710445 CTGCAGGGATGCAGGGATGCAGG - Intronic
1050160916 9:2718005-2718027 CAGCAGGGCCGGAGGGTCGCTGG - Exonic
1050176170 9:2871479-2871501 TATGAGGGCTGGAGGGAAACTGG + Intergenic
1050236431 9:3585952-3585974 CTCCAGGGCTGGAGTGAACCAGG + Intergenic
1050294664 9:4193695-4193717 CACCTGAGCTGGAGGGAGGCTGG + Intronic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052819012 9:33124246-33124268 GAGGAGGGCAGGAGTGAAGCTGG - Intronic
1052995998 9:34551896-34551918 CGGCAGGGCTGGGGGGCGGCAGG + Exonic
1053139484 9:35673859-35673881 GAGCAAGCCTGGAGGGGAGCAGG - Exonic
1053442552 9:38128121-38128143 CATCAGAGCTGGAGGGTACCAGG + Intergenic
1053503194 9:38620015-38620037 CTGCCGGGCTGCAGGGAAGCCGG + Intergenic
1055907841 9:81314567-81314589 CAGCGTGGCTAGAAGGAAGCAGG + Intergenic
1056537068 9:87537868-87537890 TAGCAGGGCCCGAGGCAAGCGGG + Intronic
1057211903 9:93205099-93205121 CAGAATGGATGGAGGAAAGCAGG - Intronic
1057302294 9:93893958-93893980 CAGCAGAGCGGGAGGGAGGTGGG - Intergenic
1057702991 9:97376986-97377008 GAGCAGGGGTGGAGGGATGAAGG - Intronic
1057999380 9:99849519-99849541 CATCAGGACTGGAAGGAAACTGG + Intronic
1058466772 9:105236822-105236844 TAACAGGACTTGAGGGAAGCTGG + Intergenic
1058547180 9:106073052-106073074 CTGCAGGGCAGGAGGGATACAGG - Intergenic
1058746169 9:107992832-107992854 CTGCTGGGCTGGAGGCATGCAGG - Intergenic
1058951770 9:109910670-109910692 CAGCAGGGCATGAGGGCAGAGGG + Intronic
1059311342 9:113390767-113390789 CAGCAGGGCTGGTGGGAGGGAGG + Intronic
1059339241 9:113588115-113588137 CTGCAGGGGAGGAAGGAAGCAGG - Intronic
1059949212 9:119444474-119444496 AACCAGGGCTGGAGGGATGAGGG + Intergenic
1060042111 9:120308694-120308716 CAGGAGGCCTAGAGGGAACCAGG - Intergenic
1060527515 9:124328800-124328822 CAGCGGGGCTGGCGGGGAGGGGG + Intronic
1060934140 9:127506045-127506067 CAGGCGGGCAGGAGGGAGGCAGG + Exonic
1061036756 9:128118551-128118573 GAGCAGGGATGGAGGGATGCTGG + Intergenic
1061043660 9:128153211-128153233 CAGCAGTGCTGGGGGGCAGGGGG - Intronic
1061164576 9:128914826-128914848 CAGCAGGGCAGGGAAGAAGCTGG + Intronic
1061233214 9:129326940-129326962 CAGCAGGGCTGGGTGGGAGTGGG + Intergenic
1061344443 9:130011029-130011051 CAGCAGAGATGGAAGGAAGGTGG + Intronic
1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG + Intronic
1061454279 9:130686016-130686038 CTGCAAGGCAGGAGGGAAGCTGG - Intergenic
1061496513 9:130977903-130977925 CCCCAGGGATGGAAGGAAGCTGG + Intergenic
1061802113 9:133118382-133118404 CAGGTGGGCTGGAGTGAAGAGGG - Intronic
1061849773 9:133407505-133407527 GGGCAGGGCTGGAGGGCTGCGGG + Intronic
1061887994 9:133602442-133602464 TAGCATTGGTGGAGGGAAGCAGG - Intergenic
1061986910 9:134135420-134135442 CCGCGGGGCTGGCGGGGAGCAGG + Intronic
1062011149 9:134267521-134267543 CGGCATGGCTGGAGGGGCGCAGG + Intergenic
1062050990 9:134446951-134446973 AAGCAGGGCTGGAGAGAGACGGG + Intergenic
1062096963 9:134708489-134708511 CAGCAGGGCTGGGTAGATGCGGG - Intronic
1062327732 9:136020221-136020243 ATGCAGGTCTGGAGGGAAACCGG + Intronic
1062352118 9:136144316-136144338 CTGCAGGTCTGGAGAGAGGCTGG + Intergenic
1062386003 9:136311816-136311838 CAGCAGGGCTGGGGGGCCGGGGG - Intergenic
1062478796 9:136742188-136742210 GAGCAGGGCTGCAGAGAAGCAGG + Intronic
1062709952 9:137969863-137969885 CAGTAGGGCAGGAGGGAGGCAGG - Intronic
1203626136 Un_KI270750v1:25127-25149 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1185492196 X:526244-526266 CAGCAGGGGTGGGGGGACGGCGG + Intergenic
1186079293 X:5912897-5912919 CAGGAGGGAGGGAGGGAAGGAGG + Intronic
1186545513 X:10445010-10445032 CAGCAGGTCTCGGGGGAGGCAGG + Intergenic
1187237099 X:17477602-17477624 GGGCAGGGGTGGATGGAAGCAGG + Intronic
1187704564 X:21996918-21996940 CAGCGGGGCTAGAGGAAGGCTGG + Intergenic
1189223335 X:39391698-39391720 CAGCAGGACTGGAGGCTTGCAGG - Intergenic
1190727768 X:53201796-53201818 CAGGAGGGTTGTAGAGAAGCTGG - Intronic
1192436812 X:71148237-71148259 CAGCAGGGCAGGCGGGAGGCAGG - Intronic
1192762089 X:74104518-74104540 CAGCAGGGGTGGAGTGACTCAGG - Intergenic
1193820871 X:86163177-86163199 GTGAAGGGCTGGAGGGAAGGTGG - Intronic
1194662090 X:96639036-96639058 CAGCAGGGATGCAGGGCACCAGG - Intergenic
1194902709 X:99533440-99533462 CAACAGGGCTGCAGGGACCCAGG - Intergenic
1195146756 X:102026262-102026284 CAGCAGGGCTTCAGGGATGTGGG - Intergenic
1195437843 X:104865626-104865648 CAGCATGGCTGGAATAAAGCAGG + Intronic
1197325991 X:125094142-125094164 CAGCAGGGCCTCAGGGACGCTGG - Intergenic
1199117342 X:144008361-144008383 CTGCAGGGCTGCAGGGCTGCAGG + Intergenic
1199445139 X:147912161-147912183 TAGCAGGGCTGAAGAGAAGATGG + Exonic
1199871474 X:151902292-151902314 CTGCAGGGGTGGAGAGAGGCTGG + Intergenic
1199990937 X:152987516-152987538 CAGCAGGTCTGCAGGGCGGCAGG - Intergenic
1200034024 X:153316990-153317012 CAGCAGGTCTGCAGGGCGGCAGG - Intergenic
1201757524 Y:17502451-17502473 CGGCAGGGCTAGAGGGAGCCTGG - Intergenic
1201844030 Y:18403531-18403553 CGGCAGGGCTAGAGGGAGCCTGG + Intergenic
1201857938 Y:18566104-18566126 CAGCAGGGGTGGGCTGAAGCAGG - Intronic
1201875383 Y:18754277-18754299 CAGCAGGGGTGGGCTGAAGCAGG + Intronic