ID: 927677798

View in Genome Browser
Species Human (GRCh38)
Location 2:25119343-25119365
Sequence AGCCAAAGGCTGGTCCGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927677798_927677805 -4 Left 927677798 2:25119343-25119365 CCTGACCGGACCAGCCTTTGGCT 0: 1
1: 0
2: 0
3: 6
4: 60
Right 927677805 2:25119362-25119384 GGCTGTGAGGAGTGCAGCCGGGG 0: 1
1: 0
2: 1
3: 27
4: 298
927677798_927677804 -5 Left 927677798 2:25119343-25119365 CCTGACCGGACCAGCCTTTGGCT 0: 1
1: 0
2: 0
3: 6
4: 60
Right 927677804 2:25119361-25119383 TGGCTGTGAGGAGTGCAGCCGGG 0: 1
1: 0
2: 2
3: 35
4: 438
927677798_927677810 19 Left 927677798 2:25119343-25119365 CCTGACCGGACCAGCCTTTGGCT 0: 1
1: 0
2: 0
3: 6
4: 60
Right 927677810 2:25119385-25119407 AACATGCTGCCGGTGGCTAAGGG 0: 1
1: 0
2: 0
3: 5
4: 65
927677798_927677807 12 Left 927677798 2:25119343-25119365 CCTGACCGGACCAGCCTTTGGCT 0: 1
1: 0
2: 0
3: 6
4: 60
Right 927677807 2:25119378-25119400 GCCGGGGAACATGCTGCCGGTGG 0: 1
1: 0
2: 0
3: 10
4: 99
927677798_927677806 9 Left 927677798 2:25119343-25119365 CCTGACCGGACCAGCCTTTGGCT 0: 1
1: 0
2: 0
3: 6
4: 60
Right 927677806 2:25119375-25119397 GCAGCCGGGGAACATGCTGCCGG 0: 1
1: 0
2: 0
3: 13
4: 135
927677798_927677803 -6 Left 927677798 2:25119343-25119365 CCTGACCGGACCAGCCTTTGGCT 0: 1
1: 0
2: 0
3: 6
4: 60
Right 927677803 2:25119360-25119382 TTGGCTGTGAGGAGTGCAGCCGG 0: 1
1: 0
2: 4
3: 19
4: 248
927677798_927677809 18 Left 927677798 2:25119343-25119365 CCTGACCGGACCAGCCTTTGGCT 0: 1
1: 0
2: 0
3: 6
4: 60
Right 927677809 2:25119384-25119406 GAACATGCTGCCGGTGGCTAAGG 0: 1
1: 0
2: 0
3: 8
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927677798 Original CRISPR AGCCAAAGGCTGGTCCGGTC AGG (reversed) Intronic
904827590 1:33284212-33284234 AGCCATAAGCAGGTCCAGTCCGG + Intronic
923340725 1:233004855-233004877 AGCCAGGGGCTGGTCAGGTGGGG + Intronic
1063808883 10:9680905-9680927 AGGCAAAGGCTGGACCAGTTTGG + Intergenic
1064262294 10:13795797-13795819 AGCCAGAGGCTGGGCAGGTCAGG - Intronic
1071830601 10:89368320-89368342 AGCCAAAGGCTTGTGAGGTGTGG - Intronic
1075066028 10:119289447-119289469 AGCCACAGGCAGGTCAGGTGCGG - Intronic
1085312624 11:75525456-75525478 AGCCAGAGGCTGGGGGGGTCCGG + Exonic
1096120942 12:49089194-49089216 AGCGAAATGCTGGTCCTCTCTGG + Intergenic
1096514008 12:52146575-52146597 ACCCAAAGGGTGGTGGGGTCTGG - Intergenic
1096603626 12:52748381-52748403 AGCCAATGGATGGTCGGTTCAGG - Intergenic
1102201498 12:111060717-111060739 AGCTACAGGCTGGGCCGGGCTGG - Intronic
1104058125 12:125245791-125245813 AGCCAGAGGCTGGAAGGGTCTGG - Intronic
1123113396 14:105883192-105883214 GGCCAAAGGCTGGGCCTGCCAGG - Intergenic
1133879548 16:9768003-9768025 AGCCACAGGCTGGCTCTGTCTGG + Intronic
1142441819 16:90103317-90103339 AGCCAGAGGCTGCTCCTGTTGGG - Intergenic
1147196164 17:38768263-38768285 AGCCACAGGCTGCTCTGGCCAGG - Exonic
1150455234 17:65301962-65301984 AGTCAAAGGCTGGGCTGGGCTGG - Intergenic
1154177161 18:12093175-12093197 AGCCAAAGGCAGGGCAGGGCAGG + Intergenic
1155263302 18:24066517-24066539 AACCAAAGGCTGGTGAGGCCTGG - Intronic
1160818368 19:1046650-1046672 AGCCAAAGGCTGGCTGGATCAGG + Intronic
1165805730 19:38579733-38579755 AGCCAAAGGATGTTCTGGGCCGG - Intronic
925900908 2:8508854-8508876 AGCCAGAGGCTGGGCCAGACAGG + Intergenic
927477567 2:23425654-23425676 AGCCAAGGGCTGCTCCTTTCGGG - Intronic
927677798 2:25119343-25119365 AGCCAAAGGCTGGTCCGGTCAGG - Intronic
931160463 2:59684548-59684570 GGCCAAAGACTGGCCAGGTCAGG + Intergenic
937010626 2:118559837-118559859 AGCCAATGGCTGGGCAGGGCAGG + Intergenic
946766738 2:223047499-223047521 ACCCAAAGCCTGGTCTGCTCAGG + Intergenic
947872100 2:233444911-233444933 AGTCAAAGGCTGGTGAGCTCTGG + Intronic
1168876872 20:1177891-1177913 GGCCAGAGGCTGGTCAGGTCAGG - Intronic
1168979630 20:1993653-1993675 AGCCAAAGGGTGGTCCTCTTGGG + Intronic
1172325696 20:34032793-34032815 AGCCCAAGGAAGGTCAGGTCTGG - Intronic
1172630614 20:36375879-36375901 AGCCAACGGCAGGTTAGGTCTGG + Intronic
1179510713 21:41871435-41871457 AGCCACAGGCTGTCCCTGTCTGG + Intronic
1179635056 21:42703458-42703480 AGGCAAAGGCTGGCCGGGTGTGG + Intronic
1181767016 22:25099450-25099472 ATCCAAAGGCTGCTCCGATAGGG - Intronic
1182117573 22:27765979-27766001 AGCCAAAGGCTGGATCTGCCGGG - Intronic
1182254053 22:29025415-29025437 TGCCATAGGCTGGTGTGGTCAGG - Intronic
1184464618 22:44661399-44661421 AGCCCAGGGCTGGTCGGGTTGGG - Intergenic
950423499 3:12912260-12912282 AGCCAAAGGCTGGGCTGGGAGGG + Intronic
951678710 3:25272280-25272302 AGCCATCGGCTGGTCAGGGCTGG + Intronic
953561500 3:43996462-43996484 AGGCAAAGGCTGGTGGGGCCAGG + Intergenic
961594774 3:128007282-128007304 AGCCAGAGGCTGGGCAGGTCTGG - Intergenic
968362084 3:198154284-198154306 AGCCAGAGGCTGCTCCTGTTGGG - Intergenic
970781420 4:19742253-19742275 AGCCAAAGACTGGTCAGGCCTGG + Intergenic
987483808 5:18496398-18496420 ATGCAATGGCTGGTCTGGTCTGG + Intergenic
990550530 5:56872884-56872906 AGCCAAAGGCTGCTGCTGTACGG - Exonic
997583362 5:135030852-135030874 AGGGAAAGGCAGGTCCTGTCTGG - Intronic
999244648 5:150147420-150147442 AGCCCATGGCTGCTCCGGGCTGG - Intronic
1006531912 6:34662862-34662884 AGCCCAAGACTGGTCCAGCCTGG + Intronic
1008609382 6:53171907-53171929 AGCCGAAGGCTAGTCCTGTGTGG - Intergenic
1016428845 6:143962163-143962185 AGCCCAAGGCAGGCCTGGTCTGG + Intronic
1019253596 7:34423-34445 AGCCAGAGGCTGCTCCTGTTGGG + Intergenic
1019420623 7:949096-949118 AGTGAAGGGCTGGTCTGGTCCGG + Intronic
1032920720 7:136543468-136543490 ACCCACAGGCTGGTAAGGTCAGG - Intergenic
1038004481 8:23418127-23418149 AGCCAAGGTCTGGGCAGGTCTGG - Intronic
1040870260 8:52093459-52093481 AGACAAAGGCTGGTGGGGCCAGG - Intergenic
1041406238 8:57502274-57502296 AGCCAAAGGCTGCTAGGGTCTGG - Intergenic
1049800813 8:144516746-144516768 GGCCCAGGGCTGGTCCGGCCTGG + Exonic
1051025664 9:12607757-12607779 ACCCAATGGCTGGTCTGGTCTGG + Intergenic
1053203132 9:36166147-36166169 TCCCAAAGGCTGGTCCGGGTGGG + Intergenic
1058655518 9:107217046-107217068 AGTCAAAGGCTGGTGAGGACTGG + Intergenic
1060806998 9:126584084-126584106 AGCCAAGGGCTGGTCAGTTGAGG - Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062746771 9:138217946-138217968 AGCCAGAGGCTGCTCCTGTTGGG - Intergenic
1189291487 X:39889038-39889060 AGCCAAAGGATGGTGAGCTCAGG - Intergenic
1191867910 X:65720499-65720521 AGGCCAAGGCAGGTCAGGTCAGG + Intronic
1201190348 Y:11438653-11438675 AGCCAAAGGCTGGCCCTGGTTGG + Intergenic