ID: 927678421

View in Genome Browser
Species Human (GRCh38)
Location 2:25123783-25123805
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2273
Summary {0: 2, 1: 11, 2: 60, 3: 317, 4: 1883}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927678421 Original CRISPR GTGTGTGCACGTGTGTGCAG TGG (reversed) Intronic
Too many off-targets to display for this crispr