ID: 927679836

View in Genome Browser
Species Human (GRCh38)
Location 2:25132065-25132087
Sequence CACCGGGGGCGGCCCGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 395}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927679827_927679836 -6 Left 927679827 2:25132048-25132070 CCTGGAAAGGGGCGGGGCACCGG 0: 1
1: 0
2: 5
3: 26
4: 244
Right 927679836 2:25132065-25132087 CACCGGGGGCGGCCCGGGGATGG 0: 1
1: 0
2: 3
3: 33
4: 395
927679818_927679836 15 Left 927679818 2:25132027-25132049 CCAAGGGGAGGAAAGAGGGACCC 0: 1
1: 0
2: 4
3: 42
4: 301
Right 927679836 2:25132065-25132087 CACCGGGGGCGGCCCGGGGATGG 0: 1
1: 0
2: 3
3: 33
4: 395
927679826_927679836 -5 Left 927679826 2:25132047-25132069 CCCTGGAAAGGGGCGGGGCACCG 0: 1
1: 0
2: 0
3: 8
4: 138
Right 927679836 2:25132065-25132087 CACCGGGGGCGGCCCGGGGATGG 0: 1
1: 0
2: 3
3: 33
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927679836 Original CRISPR CACCGGGGGCGGCCCGGGGA TGG Intronic
900564922 1:3327490-3327512 CAACGGCGGCGGCCCCGGGCAGG + Intronic
900565242 1:3328922-3328944 CACAGGGGCCTGCCGGGGGAGGG + Intronic
900633657 1:3651723-3651745 CACAGGCGGCGGCCGGGGGAGGG + Intronic
900663090 1:3795837-3795859 CAGCGGGGGCTGCCCGGGCGGGG - Intronic
901109905 1:6785802-6785824 CCCCGGGGGCGGGCTGGGGCCGG + Intronic
901183671 1:7358553-7358575 CAGCCGGGGCTGCCCGGGGCAGG - Intronic
901627285 1:10631454-10631476 GAGCGGGGGCGGCCCGGGCCTGG - Intergenic
901673102 1:10867301-10867323 GGCCGCGGGCGGCGCGGGGACGG + Intergenic
901934564 1:12618570-12618592 GCCCGCGGGCGGCCCGGGCAAGG - Intergenic
903012892 1:20343464-20343486 CACCGGGGGCGGGTGGGGAAGGG - Intronic
903263452 1:22143187-22143209 GGCCGGGGGCGGGCCGAGGATGG + Intronic
903700901 1:25247571-25247593 CACAGGGCGCGGCTTGGGGAGGG - Intronic
903879837 1:26501000-26501022 CACCGGGGGCGGGGCCTGGAAGG + Intergenic
904500132 1:30908544-30908566 CCCCGTGGGCGGCCCCGGCACGG + Exonic
904500204 1:30908795-30908817 CGCTGGGGGCGGCCCGGCGGCGG - Intergenic
906039431 1:42776547-42776569 ATCGGGGGGCGGCCCGGGGAGGG - Intronic
906256520 1:44354974-44354996 GGGCGGGGGCGGCCCTGGGAAGG - Exonic
907237583 1:53062551-53062573 CAGCGGGAGGGGCCTGGGGACGG - Intronic
907311358 1:53540807-53540829 CATCTGGGGCTGCCTGGGGAGGG + Intronic
907470924 1:54673019-54673041 CACCAGGGGCCGCCTGGGGCTGG + Intronic
908605333 1:65792377-65792399 GAGCGCGGGCGGCCGGGGGAGGG + Intergenic
909440705 1:75692481-75692503 CACCGCAGCCGGCCCGAGGATGG + Intergenic
911176139 1:94820314-94820336 AGCCGGGGCCGGGCCGGGGAGGG - Intergenic
911488827 1:98536816-98536838 CACCGGGGTCTGTCAGGGGATGG - Intergenic
912381322 1:109249662-109249684 CGCCGGGGCCGGGCCGGGGTCGG + Intergenic
912385443 1:109269101-109269123 CACGGGGGGCGTCTCTGGGAGGG - Exonic
913173780 1:116255806-116255828 CACCTGGGGAGGCTGGGGGATGG - Intergenic
913300769 1:117367054-117367076 CACCGGAGGCGGCGCGGAGGAGG + Intergenic
913450196 1:118987872-118987894 CACCGGGCCCGGCCCGGGAGAGG + Intronic
914226784 1:145726580-145726602 CACGGGTGGGGGCCCGGGGGAGG + Intronic
914681985 1:149944933-149944955 CAACGAGGGCGGCCGGCGGAAGG - Exonic
914845690 1:151282491-151282513 CCCAGGGGGCGGCGCGGAGAAGG - Intronic
915246274 1:154558442-154558464 CCCAGGGGGGGGCCCGGGGCCGG - Exonic
915246281 1:154558454-154558476 GGCCGGGGGCGGCCCAGGGGGGG - Exonic
915633967 1:157173707-157173729 CACCTGGGGCAGGTCGGGGACGG + Intergenic
915719905 1:157977303-157977325 CACTGGGGGCGGGAGGGGGACGG + Intergenic
916063444 1:161117972-161117994 CAGCGGGAGCGGCGCGGGGAAGG - Exonic
921132134 1:212228941-212228963 CAGCAGGGGCGGACCGGGGAGGG + Intergenic
921138648 1:212285360-212285382 CAGGGCGCGCGGCCCGGGGAGGG - Intergenic
921551890 1:216546961-216546983 CACCGGGGCCTGTCAGGGGATGG - Intronic
922931650 1:229394856-229394878 CACCGGGGCCTGTCCGGGGATGG + Intergenic
924179426 1:241425136-241425158 CACCGGGGCCTGTCAGGGGATGG - Intergenic
924778399 1:247126817-247126839 CTGCGGGCGCGGGCCGGGGAGGG - Intronic
924783259 1:247171603-247171625 CTGCGGGCGCGGGCCGGGGAGGG + Intronic
924885828 1:248215499-248215521 CACCGGGGCCTGTCGGGGGATGG + Intergenic
1063404330 10:5778120-5778142 CACCGGGGCCTGTCAGGGGATGG + Intronic
1063417914 10:5889249-5889271 GGCCGGGGGCTGCCCGGGGCCGG - Exonic
1064230698 10:13528184-13528206 CCCCGGAGGCGCCCCGAGGAGGG + Intronic
1067071733 10:43137814-43137836 CACCGCGGGCTGGCGGGGGAGGG - Intergenic
1070198104 10:74177195-74177217 CCCCGGGGGCGGCCCAGGGCCGG + Intronic
1071570221 10:86692618-86692640 ACCTGGGGGCTGCCCGGGGAGGG - Intronic
1072294172 10:93993815-93993837 CACCGCGGGCGGCCGGGCGGGGG - Intergenic
1074618697 10:115094217-115094239 CTCCCGGGGCGCCCCGGGGCTGG - Intronic
1076792514 10:132784857-132784879 ATCCGGGGGCGGCCCCGGGTGGG - Exonic
1076833777 10:133009810-133009832 CACTGGGTGCGGCACGGGGCAGG + Intergenic
1077060330 11:615065-615087 CACCCGGGGCGGGGCGGGGCTGG + Intronic
1077206882 11:1349070-1349092 CACCCGGAGCTCCCCGGGGATGG + Intergenic
1077230332 11:1455748-1455770 CACTGGGGCCGGCATGGGGAGGG - Intronic
1077307378 11:1874266-1874288 CAGTGGGGGCAGGCCGGGGACGG + Intronic
1077891124 11:6418950-6418972 CACCGGGGCTGGGCCGGGGCAGG + Intronic
1077945018 11:6887734-6887756 CACCGGGGCCTGTCGGGGGATGG - Intergenic
1080606548 11:33869310-33869332 CACCGGGGGTGGCAGGGGCAGGG + Intronic
1082003700 11:47408537-47408559 CGCCGGGGGCGGCCCCGGGCCGG + Intronic
1083258067 11:61508768-61508790 CAACGGGGGAGGCCCGAGGGCGG + Intergenic
1083753865 11:64778564-64778586 CCGCGGGGGCGGGCCGGGGGCGG + Intronic
1084000140 11:66291731-66291753 CAGCGGGGGCTTCTCGGGGACGG + Intergenic
1084128772 11:67118454-67118476 CGCCGGGGCCTGCCCGGGAATGG + Intergenic
1085266656 11:75241459-75241481 CAGCGCGGGCAGCCCGCGGAAGG - Exonic
1085299356 11:75449414-75449436 CCCTGGGGGTGGCCTGGGGATGG - Intronic
1085299894 11:75451621-75451643 CGCCGGGGGCAGCCGGGAGAAGG - Intronic
1085643974 11:78210622-78210644 TACCGGCAGCGGCCCAGGGAGGG + Exonic
1086050335 11:82581637-82581659 CACCGGGGCCTGCCGGGGGGTGG + Intergenic
1087007089 11:93481360-93481382 ACCCGTGGGCGGCCCAGGGACGG + Intronic
1087052612 11:93901504-93901526 CACTGGGGCCTGCCAGGGGATGG + Intergenic
1087141281 11:94768308-94768330 CCCCGCGCGCGGGCCGGGGAGGG - Intronic
1087515233 11:99151857-99151879 CACCGGGGCCTGTCAGGGGATGG + Intronic
1088645518 11:111913493-111913515 CAGCTGGGGCGGCCCGAGGCCGG - Exonic
1090795809 11:130134843-130134865 CACTGGGAGCAGCTCGGGGATGG + Intronic
1091759421 12:3077310-3077332 GCCCGGGGGCGGAGCGGGGAGGG - Intergenic
1092218390 12:6697670-6697692 CACGGGGGGCGGGCTGGGGCTGG + Exonic
1095349062 12:41188373-41188395 CCCCGGGGGTGGCCCGGGGAAGG + Intergenic
1095949276 12:47773168-47773190 CGCTGGGGGCGGGCCGGGGGCGG + Intronic
1096435897 12:51591078-51591100 GGCCGGGGCCGGCCCGGGCAGGG + Intronic
1097246898 12:57611820-57611842 CACGGGGGGCGGGGCGGGGACGG - Intronic
1097990260 12:65825591-65825613 CGCGGCGGGCGGCCCGGGGAAGG + Intronic
1100399112 12:94212481-94212503 CACCGGGGCCTGCCGGGGGGTGG - Intronic
1102238624 12:111310152-111310174 CAGCAGGGGCTGCCCGGGGCTGG - Exonic
1102902592 12:116649866-116649888 GACCGGGGGCTGCCAGGGGGTGG + Intergenic
1103120085 12:118372862-118372884 CAGCGGCGGCGGCCGCGGGAGGG - Exonic
1103348359 12:120265778-120265800 CACAGGGGGCGGCCGGGGGCGGG - Intergenic
1103527655 12:121578769-121578791 CGCAGAGGGCGGCCCGGGGTGGG + Intronic
1104049346 12:125185777-125185799 CAGCGAAGGCGGCCTGGGGATGG - Intergenic
1104449040 12:128854243-128854265 GCCCGGCGGGGGCCCGGGGAGGG + Intronic
1104843680 12:131836195-131836217 CACAGAGGGGGGCCCCGGGAAGG + Intronic
1104941485 12:132397503-132397525 CCCAGGAGGGGGCCCGGGGAGGG - Intergenic
1104989945 12:132619394-132619416 CTCCGGAGGCGACCCTGGGAAGG - Intronic
1105446600 13:20462264-20462286 CCCTGGGGGCGCCCAGGGGATGG + Intronic
1107851406 13:44576545-44576567 CCCCGGGGGTGGCGAGGGGAAGG - Exonic
1108435026 13:50393474-50393496 GACCAGGGGCGGTCGGGGGATGG + Intronic
1109640966 13:65191357-65191379 CACCGGGGCCTGTCAGGGGATGG - Intergenic
1110440280 13:75518953-75518975 CAGGGGGCACGGCCCGGGGAGGG + Intergenic
1110478287 13:75943784-75943806 CACTGGGGCCTGCCGGGGGAAGG + Intergenic
1110861661 13:80350845-80350867 CACCGGGGCCTGTCGGGGGATGG - Intergenic
1111364548 13:87224711-87224733 CACCGGGGCCTGTCGGGGGATGG - Intergenic
1113241911 13:108347550-108347572 CACCGGGGCCTGTCGGGGGATGG - Intergenic
1113312045 13:109141011-109141033 CGCGGGGGGCGGCCCGGGCGGGG - Exonic
1113517693 13:110915486-110915508 CGCCTGGGGCGGCCGGGGGCGGG + Intergenic
1113795025 13:113051818-113051840 CAGCGGGGGCAGCCCTGGGCTGG - Intronic
1114269221 14:21091016-21091038 CTCCGGGGGTGGCCCGGGGCCGG + Exonic
1114664205 14:24368733-24368755 CACCAGGCGCCGCCAGGGGAAGG + Intronic
1115046398 14:29000284-29000306 CACCGGGGACTGCCAGGGCAGGG + Intergenic
1115217293 14:31026143-31026165 CGGTGGTGGCGGCCCGGGGATGG - Exonic
1117932474 14:60857730-60857752 CACCGGGGCCTGTCAGGGGATGG - Intronic
1118316001 14:64726550-64726572 CACCTGGAGCAGCCGGGGGATGG - Intronic
1122784716 14:104158387-104158409 CATTGGGGGCTGCCCGGGGGAGG + Intronic
1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG + Intergenic
1124453615 15:29821781-29821803 CACTGGGGGCGGCCGGGGAGGGG - Intronic
1127588393 15:60398517-60398539 TCCCGGGGGGCGCCCGGGGAGGG + Intronic
1127922482 15:63504441-63504463 ACCCGGGGGCGGGGCGGGGAGGG + Intergenic
1128509988 15:68307497-68307519 CACCTGGGGCTGCCTGGGGAGGG - Intronic
1128750846 15:70147952-70147974 AACTGGGGGCTGCCGGGGGAGGG + Intergenic
1129028823 15:72604339-72604361 CACGGAGGGAGGCTCGGGGATGG + Intergenic
1129144246 15:73633092-73633114 CGCCGGGGGCGGGCCGGGCGGGG - Intronic
1130531129 15:84748535-84748557 CTCCGGGGGCGGAGCGGGGGCGG - Intergenic
1131515349 15:93073161-93073183 CGCGGGGGGCGGCGCGGGAAGGG - Intronic
1132178286 15:99732937-99732959 CCACGGCGGCAGCCCGGGGACGG + Exonic
1132254518 15:100364297-100364319 CACCGGGGCCTGTCAGGGGATGG + Intergenic
1132498739 16:275638-275660 GACGCGGGGCGGGCCGGGGAGGG + Intronic
1132498834 16:275871-275893 GCCCGGGGGCGGCCGGGGGGCGG + Exonic
1132604575 16:788411-788433 GGCCGGGGGCGGGCCGGGGGGGG - Intergenic
1132604583 16:788422-788444 CGGCGGGGGCGGGCCGGGGGCGG - Intergenic
1132618838 16:854980-855002 CAGAGGGACCGGCCCGGGGAAGG + Intronic
1132633685 16:932220-932242 CACAGGCGGGGGCACGGGGAGGG + Intronic
1132889442 16:2196630-2196652 GGCGGGGGGCGGCCCGGGGGCGG + Intergenic
1133036440 16:3036554-3036576 CCCCGGGAGCGGCCTGGGGGCGG - Intronic
1136128093 16:28199866-28199888 CACCGTGCCCGGCCCAGGGAAGG - Intronic
1136261825 16:29082401-29082423 CGCCGGGCGCGGCGCTGGGAAGG - Intergenic
1136637922 16:31537548-31537570 CACCCGGGGCTGTCCGGGGACGG - Intergenic
1137667802 16:50261853-50261875 CACCGGGAGGAGCCCTGGGAGGG - Intronic
1137926668 16:52547196-52547218 GAGCGGCGGCGGCGCGGGGAGGG - Intronic
1139352543 16:66346411-66346433 CACCTGGGGCGGCCAGGAGGTGG - Intergenic
1141604644 16:85145830-85145852 CACTGGGGCAGGGCCGGGGAGGG + Intergenic
1141638622 16:85328815-85328837 CACCGCGGGAGGCCCCGGGGCGG - Intergenic
1141854455 16:86671722-86671744 CACCAGGGCAGGGCCGGGGAGGG - Intergenic
1142690960 17:1605879-1605901 CACAGGAGGTGGCCGGGGGAGGG - Intronic
1142876204 17:2853416-2853438 ATCCGGGGCCGGGCCGGGGAGGG + Intronic
1143018315 17:3903659-3903681 CACAGGGGGCCTCCTGGGGAGGG - Intronic
1143126229 17:4642414-4642436 CAGCAGGGGCGGCGGGGGGAGGG - Intergenic
1145941216 17:28744278-28744300 CAGCGGGGGCGGGGCGGGGCGGG + Intronic
1146180977 17:30697972-30697994 CAGGAGGGGCAGCCCGGGGAAGG - Intergenic
1147584019 17:41642640-41642662 CACCTTGGGAGGCCCAGGGAGGG + Intergenic
1148809283 17:50279944-50279966 CTCCGAGGGCGGCCCATGGATGG - Exonic
1148878607 17:50707821-50707843 CAGCAGGGGCGGCCCGCGGGAGG - Exonic
1148929955 17:51120294-51120316 CTCCGGGGGCGGCCGGGGCGGGG - Intronic
1149614444 17:57987282-57987304 CAGCCGGGCCGGCCCGGGGCAGG - Intronic
1150060555 17:62065288-62065310 CACCGGGGAGGGCCGGGGGGGGG + Intergenic
1150460140 17:65343788-65343810 CACCGGGGCCTGTCGGGGGATGG + Intergenic
1150489015 17:65561705-65561727 CGGCGGGGGCGGGCCGGGGCGGG - Intronic
1150561919 17:66302323-66302345 CGGCGGCGGCGGCCGGGGGAGGG - Intergenic
1150840386 17:68601024-68601046 CACCGCGGGCGGACGGGCGACGG + Exonic
1151251979 17:72843235-72843257 CACCGCGCCCGGCCTGGGGAGGG + Intronic
1155507534 18:26548082-26548104 CGCGGTGGGCCGCCCGGGGACGG - Intronic
1155954006 18:31942443-31942465 CTCCGGGGGCGGCTGGAGGAGGG - Intronic
1156448498 18:37253742-37253764 AACCGGGGGCGGCCGGGGCGCGG - Intronic
1156448595 18:37254057-37254079 CACCGGGGCGGGGCCGGGGGCGG - Intronic
1157294497 18:46433098-46433120 CACCCGGGGCAGCCTGGGGCTGG - Intronic
1158297127 18:56010719-56010741 CACCGGGGCCTGTCAGGGGATGG - Intergenic
1158954063 18:62523292-62523314 CGCCGGGGGAGGGCCGGGGCCGG - Exonic
1159907550 18:74109814-74109836 CACCGGGGTCTGTCAGGGGATGG + Intronic
1160248848 18:77183707-77183729 CACCGGGGCCTGTCCGGGGAGGG - Intergenic
1160453259 18:78979505-78979527 CGCCGGGGGAAGCCCGCGGAGGG + Intergenic
1160519172 18:79494509-79494531 AACCTGGTGCGGCCGGGGGAAGG + Intronic
1160519284 18:79494845-79494867 AACCTGGTGCGGCCGGGGGAAGG + Intronic
1160613969 18:80109732-80109754 GAGCGGGGGCCGCCCCGGGAGGG + Intronic
1160725698 19:616931-616953 CACCGGGGGACGCGCGCGGACGG - Exonic
1160951315 19:1668969-1668991 GGCTGGGGGTGGCCCGGGGAGGG - Intergenic
1161194680 19:2979804-2979826 TGCCGGGGGCGGGCGGGGGAGGG + Intronic
1161219838 19:3113498-3113520 CACCGCTGGCGGCCTGGGGACGG + Intronic
1161321704 19:3644406-3644428 AACCGGGGTCTGCCTGGGGAGGG + Intronic
1161393989 19:4035103-4035125 CGCCTGGGGCGGCCCTGGCACGG + Intronic
1161628408 19:5339756-5339778 CCCCGGGGGCTGCGGGGGGAGGG - Intronic
1161631703 19:5360111-5360133 CACTGGAGGAGGCCCGTGGAAGG - Intergenic
1161925042 19:7293864-7293886 CACCGGGGGCCGGCGGGGGGCGG - Exonic
1162039796 19:7963841-7963863 CAGCGCAGGCGGCCTGGGGATGG + Intronic
1162935360 19:13979109-13979131 CAACGGGGGCGGCCGCGGGCGGG + Intronic
1162954713 19:14091370-14091392 CGGCGGGGGCGGCCCTGGCAGGG - Intergenic
1162962498 19:14136299-14136321 GGCCGGGGTCGGCCCGGGGGTGG + Intronic
1163390305 19:17026720-17026742 CCCCGGCGGCGGCGCGAGGACGG - Exonic
1163552613 19:17974048-17974070 CCCCGGGGGCTGCCGGGTGAGGG - Exonic
1163862234 19:19748484-19748506 GGCCGGGGGAGGCCCGGGCAGGG - Intergenic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165994309 19:39833461-39833483 CACCGGGGGCGGGGAGAGGAGGG + Exonic
1166069293 19:40377933-40377955 CACCAGGGGCGGCCCCCCGAGGG + Intronic
1166215317 19:41330991-41331013 CAGCGGGGGCGGGGCGGGGTGGG + Exonic
1166546866 19:43639429-43639451 CAGCGGGACCGGCCTGGGGAGGG + Intronic
1167108998 19:47447779-47447801 CGCCCGAGGCGGCCCGGAGAGGG - Intronic
1167112864 19:47472057-47472079 GGCGGGGGGAGGCCCGGGGAGGG + Exonic
1167129178 19:47573150-47573172 CGCCCCGGGCGGCGCGGGGAAGG - Intergenic
1167557062 19:50203349-50203371 CGCGGGGGGCGGCCGGGGGCGGG - Intronic
1168326102 19:55539221-55539243 CACCAGGGGAGGCTGGGGGAGGG - Intergenic
1168544714 19:57240792-57240814 CACCGGGCCCGGCGCAGGGAAGG + Intronic
1168654695 19:58118473-58118495 GGCCGGGGCCGGCCCGGGGCGGG + Intergenic
925912653 2:8583551-8583573 CCCCGGGGGGTGCCCGGGGTTGG - Intergenic
925959736 2:9003703-9003725 GACCGCGGGCGGCCCAGGGGCGG - Exonic
926437637 2:12854170-12854192 CACCGCGGGGGGCTCGGGCATGG + Intergenic
926580829 2:14632278-14632300 CACTGCGAGCGGCCCGGGGCAGG - Intergenic
927531752 2:23811582-23811604 CACCGGGGCCTGTCCGGGGGTGG + Intronic
927679836 2:25132065-25132087 CACCGGGGGCGGCCCGGGGATGG + Intronic
927888174 2:26731077-26731099 GTCCGGGGGCTGCCCGGGGTGGG - Exonic
927943275 2:27118933-27118955 CACGTGGAGCGGCCCGGGGGAGG - Exonic
929460945 2:42101651-42101673 CGTCGGGGGCGTTCCGGGGAGGG - Intergenic
931385451 2:61794031-61794053 CACCGGGGCCTGTCCGGGGGTGG - Intergenic
931694234 2:64859897-64859919 CAGCGGGGGCGGCGCCGAGAGGG + Intergenic
932425455 2:71631607-71631629 CACAGGGGGAGGCGAGGGGAGGG + Intronic
934296839 2:91749095-91749117 CCGCGGCGGCGCCCCGGGGAAGG + Intergenic
934304509 2:91810104-91810126 CACCGGGCGCGGTGCGGGGGAGG - Intergenic
934328748 2:92042646-92042668 CACCGGGCGCGGTGCGGGGGAGG + Intergenic
936010238 2:108920878-108920900 CACTGGGAGCTGCCCGGGGCAGG + Intronic
936058825 2:109281315-109281337 TAACGGAGGGGGCCCGGGGAAGG - Intronic
937341753 2:121095770-121095792 CACGGGGGGCAGCCCCAGGAAGG - Intergenic
938796009 2:134718828-134718850 CAGCGGGGCCGGGCCGGGGGCGG + Exonic
938934508 2:136116855-136116877 CAGCCGCGGCGGCCCGGGGCTGG - Intronic
941732282 2:168932164-168932186 CACCGGGGCCTGTCAGGGGATGG - Intronic
941930040 2:170929656-170929678 GCCAGGGGGCGGCCCTGGGAAGG + Intronic
942450914 2:176107619-176107641 CAGCGGGGGCGGCCCCGGCGGGG + Exonic
942454804 2:176130336-176130358 CAGCGGCGGCGGCCCCGGGCGGG - Exonic
942463824 2:176188455-176188477 GACCGGGGGCTGCCTGGGCAAGG - Intergenic
943173329 2:184433110-184433132 CAGCGGGGGTGGCGCGGGGGAGG - Intergenic
944676173 2:202035213-202035235 CCCCGGGGGCAGCGCGGTGAAGG - Exonic
945431707 2:209772184-209772206 CACCGCGGGCCGCCCTGGGCTGG + Intronic
947739588 2:232479081-232479103 CACCGGGCGGTGCCCAGGGAGGG + Intergenic
947748751 2:232522384-232522406 CACGGAGGGCGGGCCGGGGAGGG - Intronic
948142445 2:235683853-235683875 CACTGGGGCCGGGCGGGGGACGG - Intronic
948454423 2:238098192-238098214 CACTGGGGACGGCCTGGGGAGGG - Exonic
948513241 2:238487307-238487329 CACTGGGGGCGGCCTTGGCAAGG + Intergenic
948988679 2:241541173-241541195 CACCGGCCGCGGCCAGGGGCGGG + Intergenic
949030814 2:241796446-241796468 CTCCGTGGCCGGCCCAGGGAGGG - Intronic
1172118238 20:32583982-32584004 ACCCGGGGCTGGCCCGGGGAGGG - Intronic
1172474591 20:35227046-35227068 CACCGGGGACGGGCCTGGGCCGG + Intronic
1172764876 20:37346063-37346085 AGGCGGCGGCGGCCCGGGGAGGG - Intronic
1173548137 20:43914781-43914803 CGCGGGGGGCGGGCCGGGGGCGG - Intergenic
1174999564 20:55612094-55612116 CACCGGGGCCTGTCAGGGGATGG - Intergenic
1175265855 20:57703219-57703241 CAGCGGGGGAGGGCCGGGGAGGG - Intronic
1175267220 20:57710044-57710066 CACCGCGCGGGGGCCGGGGAGGG + Intronic
1175749211 20:61483672-61483694 CAGCGGGGGCGGGGCGGGGGGGG - Intronic
1176234645 20:64048712-64048734 CAGCGGGGGCAGCTCGCGGAAGG + Exonic
1176286695 21:5022464-5022486 GGCCGGGGGCGGGGCGGGGACGG + Intergenic
1176380716 21:6111058-6111080 TACGGGGGGCGGGCCGGGGCGGG + Intergenic
1178372636 21:32038831-32038853 CACCGGGGCCTGCCAGGGCATGG - Intronic
1178714579 21:34952211-34952233 CACCGGGGCCTGTCGGGGGATGG + Intronic
1179511956 21:41879199-41879221 CAGCGGGTGCGGCCCGGGGCCGG + Intronic
1179742756 21:43427182-43427204 TACGGGGGGCGGGCCGGGGCGGG - Intergenic
1179783868 21:43719058-43719080 GGCCGGGGGCGGACCGGGGCGGG - Intergenic
1179783874 21:43719069-43719091 CGCCGGGGGCTGGCCGGGGGCGG - Intergenic
1179870486 21:44241011-44241033 GGCCGGGGGCGGGGCGGGGACGG - Intergenic
1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG + Intergenic
1179905024 21:44418333-44418355 CACCGGGGGGGCCCCGTGGGAGG - Intronic
1180014968 21:45075499-45075521 CGCCGCGGGCGGCCCGGGCCAGG + Intronic
1180187244 21:46145835-46145857 CCCCGGGGGCGGCTCGGTGGCGG - Exonic
1180614762 22:17120215-17120237 CGCGGGGGGCGGCCTGGGGGCGG - Exonic
1180699696 22:17774523-17774545 CGCCGGGGGCGGGCCGGGGCGGG - Intronic
1181720778 22:24772941-24772963 CACCCAGGGAGGCCTGGGGAGGG - Intronic
1181777846 22:25172331-25172353 CTCCTGGGGTGGCCCGAGGAGGG - Intronic
1181811240 22:25405035-25405057 CCCCGGGGATGGCCCGGGCAGGG + Intronic
1182707085 22:32290254-32290276 CACCGGGGCCTGTCAGGGGATGG - Intergenic
1183228146 22:36564285-36564307 CCCCGGGGGCGGGGCGGGGCGGG - Exonic
1183240388 22:36653472-36653494 GACCGGGGGCTGCCCGGGCTGGG + Intronic
1183279028 22:36922418-36922440 AAGCGGGGGAGGCCCAGGGAAGG - Intronic
1184109584 22:42387169-42387191 CACCGTGGGAGCCCAGGGGAGGG + Intronic
1184461274 22:44639551-44639573 CAGCTGGGACAGCCCGGGGAAGG + Intergenic
1184472133 22:44702139-44702161 CCCGGGGGGCGGGGCGGGGAAGG - Intronic
1184770020 22:46591544-46591566 CACCGTGCACGGCCCGGGGGTGG - Intronic
950549038 3:13655352-13655374 GGCCGGGAGCGGCTCGGGGACGG - Intergenic
950815739 3:15700282-15700304 CACCGGGGCCTGTCCGGGGTGGG + Intronic
952344043 3:32467845-32467867 CCCCGGGGGCTCCCCAGGGAGGG - Intronic
952901540 3:38114813-38114835 CACCTGGTGCCGCCTGGGGAAGG + Intronic
952926141 3:38320671-38320693 CACCGGGGCCTGTCAGGGGATGG - Intergenic
953447360 3:42979559-42979581 CGCCGGGGGCGGCCAAGGGGAGG + Exonic
953924782 3:46977184-46977206 CACCGCGCCCGGCCCAGGGAAGG - Intronic
953988846 3:47467881-47467903 CACCAGGGCCTGCCGGGGGATGG - Intronic
954277677 3:49553344-49553366 CACAGGGGAAGGCCCAGGGAGGG + Intergenic
954473862 3:50724671-50724693 CACCGGGGCCTGTCGGGGGATGG + Intronic
954615692 3:51967744-51967766 CAGCGCGGGCGGTGCGGGGAAGG - Intronic
954632767 3:52056225-52056247 CACCGGGGCGGGCGCGGCGACGG - Exonic
954632824 3:52056370-52056392 GAGCGCGGGCGGCCCGGGGCCGG + Exonic
955996745 3:64686682-64686704 CACCCCGGGCGTCCCGAGGAGGG + Exonic
961574457 3:127823231-127823253 CGGCGGGGGCGGCCCGAGGTGGG + Intronic
962040836 3:131705978-131706000 CACCTGGTGTGGCCGGGGGAGGG - Intronic
963078249 3:141368025-141368047 CACCAGGAGCTGCCCGGGGATGG + Intronic
963259769 3:143180101-143180123 CACCGGGGCCTGTCAGGGGAGGG - Intergenic
964685017 3:159385851-159385873 CACCGGGGCCTGTCAGGGGATGG - Intronic
964720627 3:159764798-159764820 CACCGGGGGCGGCATGGCGGTGG - Exonic
965531248 3:169772987-169773009 CACCGGTGGGGCCCCGAGGAAGG + Exonic
967157838 3:186709917-186709939 CACCGCGCCCGGCCCGGGAATGG - Intergenic
967272631 3:187743793-187743815 CGGCGGCGGCGGCCCGGGGAGGG - Intronic
968092982 3:195909614-195909636 ACTCGGGGGCGGCCCGGGGCGGG - Intronic
968627560 4:1634027-1634049 CACCAGGAGGGGCCCAGGGAGGG + Intronic
969621500 4:8281090-8281112 CTCCAGGGGCAGCCAGGGGAAGG - Intronic
970075614 4:12216214-12216236 CACCGGGGCCTGCCAGGGGGAGG + Intergenic
970651110 4:18179080-18179102 CACCGGGGCCTGTCCGGGGCTGG + Intergenic
974359170 4:60853606-60853628 CACCGGGGCCGGTCAGGGGGTGG + Intergenic
975612203 4:76213969-76213991 CACCGGGGACCGGCCGGGGAGGG - Intergenic
976545336 4:86328836-86328858 CACCGGGGCCTGTCAGGGGAGGG + Intronic
978795696 4:112705835-112705857 CGCCGGGCGCGGCGCTGGGAAGG + Intergenic
981280626 4:142954533-142954555 CACCGCGGGGGGCTCGGGCATGG - Intergenic
983388222 4:167093448-167093470 CACCGGGGCCTGTCAGGGGATGG - Intronic
985512834 5:321848-321870 CACCGCGGGCGGCACGCGGCGGG - Intronic
985782042 5:1876587-1876609 CTACGGGAGCGGCCCGGGGGCGG - Intergenic
985996386 5:3599575-3599597 CACCGAGGGCGACCCGGAGAAGG + Exonic
986330636 5:6713965-6713987 CCGCGGGGGCGGCGCGTGGATGG + Intergenic
986724392 5:10583243-10583265 CACTTTGGGAGGCCCGGGGAGGG - Intronic
986782090 5:11075640-11075662 CACCCGGGGCAGCCAGTGGAGGG + Intronic
987132423 5:14871880-14871902 CCCCGGGGGCGGGCTGGGGAGGG + Intergenic
987234799 5:15931891-15931913 CACTGGGGGTGAGCCGGGGAAGG - Intronic
988064457 5:26217481-26217503 CACCGGGGCCTGTCGGGGGATGG - Intergenic
988152280 5:27399795-27399817 CACCGGGGCCTGTCCTGGGATGG + Intergenic
989011571 5:36877358-36877380 CACCGGAGCCGGCCGGGAGAGGG - Intronic
989178731 5:38556248-38556270 CCCCAGGGGCGGCCCGGGCGGGG - Intronic
990049683 5:51482298-51482320 CACCGGGGCCTGTCCGGGCATGG + Intergenic
993095650 5:83474702-83474724 CAATGGGGGCGGGGCGGGGAAGG + Intronic
994024492 5:95066817-95066839 GACCGGGGGCGGAGCGGGGATGG + Intronic
994210743 5:97085319-97085341 CACCGCGGGGGGCTCGGGCATGG + Intergenic
995337255 5:111013965-111013987 CACCGGGGCCTGTCAGGGGATGG - Intergenic
996329297 5:122311871-122311893 AGCCGGGGGCGCCGCGGGGAGGG + Intronic
997266324 5:132497110-132497132 CAGCGGCGGGGGCCGGGGGACGG + Intergenic
997470482 5:134114641-134114663 CACTGGGGGCGGGCCGGGCCGGG - Intergenic
998692157 5:144598867-144598889 CACCGGAGGCGGGCAGTGGAAGG - Intergenic
1000469591 5:161623763-161623785 CAGCGGTGGCGGCTAGGGGAGGG + Intronic
1002054135 5:176589185-176589207 AACTGCGGGCGGCCCCGGGAGGG + Intronic
1002784470 6:391515-391537 CTCCGGGCGCGGCGCGCGGAGGG + Intergenic
1002784971 6:393387-393409 CGGCGGGGGCGCGCCGGGGAGGG + Intronic
1003050671 6:2778180-2778202 CAACGGGGCTGGGCCGGGGAGGG - Intronic
1004587439 6:17015992-17016014 CACCGGGGACGGGCCGGCGCGGG + Intergenic
1004840939 6:19584539-19584561 CACCAGGGCCTGTCCGGGGATGG + Intergenic
1006302271 6:33200068-33200090 CCCCCGGGGCGGGGCGGGGAAGG - Intronic
1006318414 6:33304585-33304607 CCCCTGGGGCGGCCCGTGCAAGG + Exonic
1006671451 6:35731988-35732010 GAGCGGGGGCGGAGCGGGGACGG + Intergenic
1006671479 6:35732083-35732105 GACCGGGGGAGGCCCGGGACGGG + Intergenic
1007701778 6:43770118-43770140 CCCCCGGGGCGGGCCGGGGGCGG + Intergenic
1009994545 6:70883959-70883981 CACAGGGGGTGGCCTGGGAAAGG + Intronic
1011051273 6:83152904-83152926 CACCGCGCCCGGCCTGGGGAGGG + Intronic
1012590607 6:100975364-100975386 CACCGGGGCTGGCTGGGGGAGGG + Intergenic
1012744300 6:103064787-103064809 CACCGGGGCCTGTCCTGGGATGG - Intergenic
1012850759 6:104444150-104444172 CACCGGGGCCTGTCGGGGGATGG + Intergenic
1013369096 6:109455042-109455064 CACAGGGGGCGGGGCGGGGTAGG - Intronic
1013432143 6:110064680-110064702 CACTGGGAGGGGCCCTGGGAGGG - Intergenic
1014096397 6:117466855-117466877 CACAGTGGGAGGCCAGGGGATGG + Intronic
1014230097 6:118893967-118893989 CGCCGGCGGCGGCGCGGAGAGGG - Intronic
1015194167 6:130507172-130507194 CACCGGGGCCTGTCAGGGGATGG - Intergenic
1016386807 6:143537218-143537240 CTCGGGGCGCGGGCCGGGGAGGG + Intronic
1017021286 6:150142673-150142695 CACCTGGCGCGGCCCCGGGCAGG - Intergenic
1017324710 6:153131431-153131453 GGCCGGGGGCCGCCCGGGGAGGG - Intergenic
1017737728 6:157380307-157380329 CTGCGGGCGCGGCCCTGGGACGG - Intergenic
1018400322 6:163414594-163414616 CAGCGGCGGCGGCGGGGGGAGGG - Intronic
1018774208 6:166998857-166998879 CCCCGGGGGGGCGCCGGGGAAGG - Intergenic
1019920736 7:4161708-4161730 CACTGAGGGTGGCCCTGGGAAGG + Intronic
1020560544 7:9726141-9726163 CCCCGGCGGCGGCGCGAGGACGG + Intergenic
1020584832 7:10053308-10053330 CACTGGGGGCTGCTCGGGGTGGG + Intergenic
1020698311 7:11444587-11444609 CACCGGGGTCTGTCAGGGGATGG + Intronic
1021450366 7:20778381-20778403 CCCCGGGGCCCTCCCGGGGAGGG - Intergenic
1025007111 7:55363525-55363547 CACCGGGTGCGGTGCGGGGCAGG - Intergenic
1025862487 7:65344545-65344567 CACCGGGGCCTGTCAGGGGATGG - Intergenic
1026360339 7:69597745-69597767 CAAGGGGGGCGTCCCTGGGAGGG - Intergenic
1029372453 7:100158301-100158323 CACCGGGGGCGGCCCGGGCTTGG - Exonic
1029448233 7:100626729-100626751 CACTGGGGGCGGGGCGAGGAGGG + Intronic
1031253104 7:119413436-119413458 CAGCGGGGTGGGCCCGGGGGAGG + Intergenic
1034469781 7:151248970-151248992 CGCGGGAGGCGGCGCGGGGAGGG + Exonic
1034488756 7:151381841-151381863 CACGGGCGGCGGCCCCGAGAAGG + Intronic
1034869949 7:154675192-154675214 CACCGGGGCCTGTCCGGGGGCGG + Intronic
1035314878 7:157991503-157991525 CACCGGGTGCTGCCCGTGCAGGG + Intronic
1036952452 8:13154188-13154210 CACCTGGTGCGGCCCTGGCACGG - Intronic
1038176343 8:25184719-25184741 GACCGCGGGCGGCGCGGGCACGG + Intronic
1039772097 8:40697716-40697738 CACCGGGGCCGGTCAGGGGGTGG - Intronic
1041686715 8:60651859-60651881 CACGGCGCCCGGCCCGGGGAAGG + Intergenic
1041690148 8:60679624-60679646 CGGCGGCGGCGGCTCGGGGACGG + Intronic
1041739109 8:61139652-61139674 CTCAGGGGGAGGCACGGGGAGGG + Intronic
1042246430 8:66712873-66712895 CTCCGACGGCGGCCCGGGGCGGG + Intronic
1043873881 8:85463934-85463956 GCTCGGGGGCGGCCCGGGGGAGG - Exonic
1044343154 8:91070679-91070701 CCCCGGCGGCGGCGCGGGGTAGG - Intronic
1045483853 8:102614629-102614651 CACCGGGGCCTGTCCGGGGGTGG + Intergenic
1045582929 8:103499810-103499832 CACCGCGGGCGCCCCGCGGGCGG - Intergenic
1047345971 8:124028943-124028965 CACCGGGGCCTGTCAGGGGATGG - Intronic
1048981151 8:139703864-139703886 CTTCGGGGGCGGCCGGGGGACGG + Intergenic
1049412951 8:142481541-142481563 CAGCGAGGGCTGCCTGGGGAGGG + Exonic
1049479740 8:142816200-142816222 CACTGGAGGTGGCCCGGGAAGGG + Intergenic
1049573964 8:143382083-143382105 CCCAGGAGGCGGCCCAGGGAGGG - Intronic
1049684594 8:143934229-143934251 CGCCGGGGGCGGGGCGGGGAGGG + Intronic
1049755294 8:144308821-144308843 CAGAAGGGGCGGCCTGGGGAAGG + Intronic
1049775014 8:144400125-144400147 GGGCGGGGGGGGCCCGGGGACGG - Intronic
1051641689 9:19230295-19230317 CACAGGGGTCGGGCGGGGGAGGG + Intergenic
1052459421 9:28743340-28743362 CACCGGGGCCTGTCGGGGGATGG - Intergenic
1053013103 9:34646610-34646632 CATCGGGGGCGGCGCGGGGAGGG + Intronic
1055454351 9:76459156-76459178 CTCTGGGGGCGGCCCCGGGGCGG + Intronic
1056932475 9:90890360-90890382 CACCAGGGGCAGACCGGGGAGGG + Intronic
1057017891 9:91669791-91669813 CACCGGGGTCTGTCAGGGGATGG - Intronic
1057199882 9:93134292-93134314 GGCCGGGGGCGGGCCGGGGGCGG - Intergenic
1057313299 9:93954698-93954720 GCCCGCGGGCCGCCCGGGGAGGG - Intronic
1057772958 9:97983803-97983825 CCCCTGGGGCGGCCGGGGGGAGG + Intronic
1058063573 9:100524896-100524918 CACCGGGGCCTGCCAGGGGTGGG - Intronic
1059455671 9:114398560-114398582 AGCAGGGGGCGGCCCGGGGGGGG + Intergenic
1060171822 9:121468175-121468197 CACCGGGGCCTGTCAGGGGATGG - Intergenic
1060296455 9:122346926-122346948 CACCGAGGGCCGCCGGGCGAGGG - Intergenic
1061150455 9:128825121-128825143 CACCAGGGGAGCCCCGGGGCTGG + Intronic
1061517171 9:131096671-131096693 CACAGGTGGCTGCTCGGGGACGG - Intronic
1061580216 9:131531558-131531580 GCCCGGGGGCGGCCGGGGGAGGG - Intergenic
1061666191 9:132162089-132162111 CGGCGGGAGCGGCGCGGGGAAGG + Exonic
1061941230 9:133885216-133885238 AACCAAGGGCGGCCCAGGGAAGG + Intronic
1062008765 9:134256072-134256094 CACTGGGGGCTGGCAGGGGAGGG - Intergenic
1062038726 9:134394551-134394573 CTCTGGGGGAGGCCCGGGCAGGG + Intronic
1062305925 9:135907212-135907234 CACCGGGCCCGGCGCGGCGAGGG - Exonic
1062346842 9:136118916-136118938 CACCGAGGGCGTTCGGGGGAGGG - Intergenic
1062424714 9:136500794-136500816 CAGCGGGGGCGGCCTGGAGACGG - Exonic
1062517665 9:136944382-136944404 CACCAGGCGCCGTCCGGGGACGG + Intronic
1185836128 X:3346867-3346889 AACCGCAGGCGGCTCGGGGAAGG + Intergenic
1186426126 X:9465292-9465314 GGGCGGGGGCGGCCCGGGGGCGG + Exonic
1187759470 X:22564576-22564598 CACCGGGGCCTGTCAGGGGATGG + Intergenic
1188542661 X:31266963-31266985 CGGCGCGGGCGGGCCGGGGAGGG + Intronic
1188896910 X:35680185-35680207 CACCGGGGCCTGCCGGGGGTTGG - Intergenic
1191004181 X:55692862-55692884 CACCGGGGCCTGTCGGGGGATGG + Intergenic
1192030626 X:67509032-67509054 CAGCGGGTGCAGCCCAGGGAGGG + Intergenic
1192212520 X:69136953-69136975 CACTGGGGGCGGGGCGGGGCCGG - Intergenic
1192975586 X:76280695-76280717 CACCGGGGCCAGTCTGGGGATGG - Intergenic
1193455272 X:81724385-81724407 CAGCTGGGGCAGCCAGGGGAGGG + Intergenic
1198215532 X:134550919-134550941 CCCCGGGGGCGGTGCGGGGTGGG + Intergenic
1198254676 X:134914787-134914809 CACCGAGGACGGCTGGGGGAGGG - Intronic
1198276140 X:135097720-135097742 GGCTGGGGGCGGCCCCGGGAAGG - Intergenic
1198312721 X:135437023-135437045 CAGCGGGCGCGTCCCGGGCAGGG - Intergenic
1198370579 X:135985453-135985475 CACCGGCGGCCGCCCGCGGTCGG - Exonic
1198978283 X:142362347-142362369 CACCGGGGCCTGTCAGGGGATGG - Intergenic
1199640784 X:149858894-149858916 CACCTGTGGCGGCACGGGGGAGG - Intergenic
1200093017 X:153644482-153644504 GAGTGGGGGCGGCCCGGCGAGGG + Intronic
1200787547 Y:7273748-7273770 CCCCGGGGGCGCCCCGGGCGCGG + Intergenic