ID: 927680052

View in Genome Browser
Species Human (GRCh38)
Location 2:25133053-25133075
Sequence GGGTCAGAAAATGCAGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927680052_927680061 5 Left 927680052 2:25133053-25133075 CCCCCAGCTGCATTTTCTGACCC 0: 1
1: 0
2: 2
3: 23
4: 254
Right 927680061 2:25133081-25133103 TTTATCCCTCTTAATTTTCTTGG 0: 1
1: 0
2: 4
3: 45
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927680052 Original CRISPR GGGTCAGAAAATGCAGCTGG GGG (reversed) Intronic
901648948 1:10732454-10732476 GGGGCAGAAAATACACGTGGTGG + Intronic
901916828 1:12506513-12506535 GGGCGAGAAGACGCAGCTGGGGG - Intronic
904336342 1:29800664-29800686 AGATGAGAAAAGGCAGCTGGGGG - Intergenic
905212925 1:36386542-36386564 GGGACCGAAACTGCAGCAGGAGG - Intergenic
907165246 1:52404674-52404696 GGTTCAGAAAAAGCACCTAGAGG - Exonic
911379499 1:97094655-97094677 TGGTCAGACGATGCAGGTGGAGG + Intronic
911413973 1:97547295-97547317 GGGGCAGGAAATGCAGAAGGAGG + Intronic
911466638 1:98262806-98262828 GGGACACAATATGAAGCTGGAGG + Intergenic
913259177 1:116982951-116982973 GCTGCAGCAAATGCAGCTGGTGG - Intronic
914955953 1:152162636-152162658 GGTGCATAAGATGCAGCTGGAGG - Intergenic
915111297 1:153566020-153566042 GGGCCAGAGGAGGCAGCTGGGGG + Intronic
915318119 1:155041189-155041211 GCATCAGACAAGGCAGCTGGTGG + Intronic
915496573 1:156286212-156286234 GGGTCAGAAAAGGCAGGGGAAGG - Intronic
919044714 1:192436094-192436116 AGGTCAGAAAATTAGGCTGGGGG + Intergenic
919857471 1:201715543-201715565 GGGTTAGAGAATGAGGCTGGGGG + Intronic
920261132 1:204688826-204688848 GGGTCAGGATATGGAACTGGTGG + Intergenic
920505940 1:206515432-206515454 GGGCCTGGAAATGCAGGTGGAGG + Intronic
922257337 1:223903863-223903885 GGGACAGAAAGTGCAGCAAGTGG - Intergenic
922415101 1:225414181-225414203 GGGTCAGACTCTGGAGCTGGGGG + Intronic
923632109 1:235657475-235657497 GGGTCTAAAAATGCACATGGTGG + Intergenic
923997552 1:239512442-239512464 GGGTCAGAGAAAGGATCTGGAGG - Intronic
1063227651 10:4031600-4031622 AGGCCAGAAAATCAAGCTGGAGG + Intergenic
1063790508 10:9440333-9440355 GGATCAGAAAATAGAGCTGAAGG + Intergenic
1063937784 10:11097041-11097063 GATTCAGAAAATGTGGCTGGAGG + Intronic
1063979762 10:11444107-11444129 GTCTCAGAAAATGTAGCTGCAGG + Intergenic
1067309601 10:45100630-45100652 GGGTGAGAAAATGCAGAAGTGGG + Intergenic
1067415873 10:46102466-46102488 GACTCATAAAATGCACCTGGAGG + Intergenic
1067435961 10:46278012-46278034 GACTCATAAAATGCACCTGGAGG + Intergenic
1068884399 10:62083579-62083601 CCATCAGAAAATGAAGCTGGGGG + Intronic
1070336542 10:75460478-75460500 GGCTCAGAAAGTGCAAATGGTGG + Intronic
1075505377 10:123016912-123016934 GGGCCAGCTAATGGAGCTGGTGG + Intronic
1076497564 10:130906934-130906956 GGGGAAGAAAGTGCAGTTGGGGG + Intergenic
1076687337 10:132204050-132204072 GGGGCAGGAGATGCTGCTGGGGG + Intronic
1077146872 11:1050369-1050391 GGGTCCTAGAGTGCAGCTGGCGG + Intergenic
1077280987 11:1745353-1745375 GGGGCTGAAGCTGCAGCTGGTGG - Intronic
1077510444 11:2958025-2958047 GGGGCAGAAATGCCAGCTGGTGG + Intronic
1078236446 11:9489378-9489400 GGGTCAGAAAATTCAGTTTAGGG - Intronic
1078781239 11:14441291-14441313 CGGCCAGAAAATGCTGCTGGGGG - Intergenic
1081763787 11:45595171-45595193 CCTTCAGAAAAGGCAGCTGGAGG - Intergenic
1083366950 11:62147115-62147137 AGGTCAGCACATGCAGCTGGAGG - Intronic
1084793514 11:71489792-71489814 GTGTCAAGAAATGCATCTGGTGG + Intronic
1085375010 11:76052463-76052485 AGGTAAGGAAATGAAGCTGGTGG - Intronic
1085528959 11:77180391-77180413 GGCTGAGAAAATGCGGCTGGCGG + Exonic
1085778965 11:79391323-79391345 GGGTGAGTAAATGCATCTGCAGG - Intronic
1086021295 11:82232980-82233002 GGGACAGAAAAAGAAGATGGTGG - Intergenic
1086664054 11:89457531-89457553 GGGCCAGAGACTGCAGCTGAGGG + Intronic
1086872682 11:92057753-92057775 GAGTGAGAAAATGAAGCTGAAGG + Intergenic
1088001089 11:104881307-104881329 GTGACAGAAAAGACAGCTGGTGG + Intergenic
1088184755 11:107154089-107154111 GAGACAGAAAATGCACATGGAGG + Intergenic
1088709050 11:112490235-112490257 GAGTCAGAAAATGCTCCAGGAGG + Intergenic
1089576389 11:119447412-119447434 GGGTCAGAGGGTGGAGCTGGGGG + Intergenic
1089589235 11:119529940-119529962 GGCTTAGAAACAGCAGCTGGAGG - Intergenic
1092269508 12:7012104-7012126 TGATCAAAAATTGCAGCTGGGGG - Intronic
1092948282 12:13476515-13476537 GGGTCAGAAACTGCAGAAAGGGG + Intergenic
1095512572 12:42969073-42969095 GGGTCAGAAAATTTTCCTGGAGG + Intergenic
1096711576 12:53460936-53460958 GGCTCTGAAATTGCTGCTGGAGG + Intronic
1100764070 12:97844007-97844029 GGGTGAGAAAATGAATCTGAGGG + Intergenic
1100873420 12:98937407-98937429 GGGGGAGGAAATGAAGCTGGAGG - Intronic
1100926781 12:99557984-99558006 GGGTCAGAGAACAAAGCTGGGGG - Intronic
1102034732 12:109764643-109764665 GAGTCAGCAAAAGCAGCTGCCGG - Intronic
1103007758 12:117435634-117435656 GAGTCAGAAATGGCTGCTGGAGG - Intronic
1103584892 12:121945219-121945241 GGGCCAGATAATGCAGGTAGAGG - Intronic
1105514111 13:21075800-21075822 GGGTCTGCAAAGGCAGCTCGGGG - Intergenic
1106185948 13:27410035-27410057 GGGTTAGAAAATAAAGCTGGAGG + Intergenic
1106549109 13:30756195-30756217 GGCTCTGAAAATACAGCTGGGGG + Intronic
1107027277 13:35815285-35815307 TAGTCATAAAATGCAGCTGGTGG + Intronic
1110331546 13:74278676-74278698 AGGTGAGAAAAGGCAGCGGGTGG - Intergenic
1112589001 13:100746854-100746876 GGGTGAGAAAAGGCAGGTGATGG + Intergenic
1113080639 13:106516259-106516281 GGGTCAGAAACTGCATCTGCAGG - Intronic
1113898972 13:113785415-113785437 GAGTCAGAAACCGCAGCTGGGGG - Intronic
1113902639 13:113805254-113805276 GGGTCAGAAGAGCCAGCTGCCGG - Intronic
1114976350 14:28105496-28105518 GGGCCAGAAGATGGATCTGGAGG + Intergenic
1115755503 14:36523423-36523445 GAGTTAGAAAAAGCAGTTGGGGG - Intergenic
1117441728 14:55766400-55766422 CGGCCAGAAGATGCGGCTGGGGG - Intergenic
1118708970 14:68504209-68504231 GAGTCAGGAAATACAACTGGAGG - Intronic
1118820114 14:69339627-69339649 GAGTCAGACAGTGGAGCTGGGGG - Intronic
1119168342 14:72514295-72514317 GGGTTAGAAAATACAGCTTTTGG - Intronic
1119327797 14:73771847-73771869 GGGTTAGAAAAGGCTGCAGGAGG + Intronic
1120913365 14:89688154-89688176 AGGTAAGAAAATGGAGCTGCCGG + Intergenic
1121614600 14:95304798-95304820 GGGTCAGACCAGGCTGCTGGGGG - Intronic
1122556059 14:102580682-102580704 GGGTCACAAAAGGCCACTGGAGG + Intergenic
1124576210 15:30910708-30910730 TGGACAGAAACAGCAGCTGGTGG + Exonic
1125505547 15:40265749-40265771 GGGTCAGAGAATGTCCCTGGGGG - Intronic
1125933606 15:43616737-43616759 GGGTCAGAATCTTCAGCTGGAGG - Intronic
1125946704 15:43716199-43716221 GGGTCAGAATCTTCAGCTGGAGG - Intergenic
1127289729 15:57559647-57559669 GAGCCTGACAATGCAGCTGGGGG - Intergenic
1127379794 15:58420814-58420836 GGGTCTGAGAATGCAGATGGGGG + Intronic
1128642111 15:69347120-69347142 TTGTCAAAAATTGCAGCTGGAGG - Intronic
1128868269 15:71132921-71132943 GGGGAGGAAAAGGCAGCTGGGGG - Intronic
1129367514 15:75065600-75065622 GGGCCAGGAAGTGCAGCTGCAGG + Intronic
1130964814 15:88689344-88689366 GGGTCAGGAAATGAAGCTTCAGG - Intergenic
1131248977 15:90818734-90818756 GGCTCAGAGAAGCCAGCTGGTGG + Intergenic
1131390853 15:92047841-92047863 GGGACTGAAACTGCAGCTGGTGG - Intronic
1131640552 15:94288018-94288040 GTGGCAGCAAAAGCAGCTGGTGG + Intronic
1131790188 15:95956156-95956178 TGTTCAGAAAATGAAGCTTGGGG - Intergenic
1132464661 16:72100-72122 GGGAAGGAAAATGCAGCGGGGGG + Intronic
1132511878 16:346888-346910 GGAGCAGAAACTGTAGCTGGCGG + Exonic
1133174771 16:4005945-4005967 GAGTCAGAAAATGGAGCTCTGGG - Intronic
1134325529 16:13204302-13204324 AGGTCAGAGAAAGCAGCTGAGGG - Intronic
1137071095 16:35905490-35905512 GGGTAGGAAAATGCAGCAGCTGG + Intergenic
1137445024 16:48526417-48526439 AGGTGAAAAAATGCAGGTGGGGG + Intergenic
1137465061 16:48700277-48700299 GGGTCTGAAAGTGCATCTTGAGG + Intergenic
1138254701 16:55545379-55545401 GTGGTAGAAAATGCAGCTCGAGG + Intronic
1139595022 16:67952391-67952413 GGGTAAAAAATGGCAGCTGGTGG + Exonic
1139606330 16:68021648-68021670 GGTTCAGAAGATTGAGCTGGCGG - Exonic
1141065748 16:80912260-80912282 GGGTCTGAACAGGCAGATGGGGG + Intergenic
1141995113 16:87631957-87631979 GAATCAGAAAATGCAGCAGGTGG - Intronic
1143369360 17:6428840-6428862 GGGCCAGAAGAGGCAGCCGGAGG - Intronic
1143385319 17:6526100-6526122 GGGTCATAAAGTTCAGATGGGGG - Intronic
1143637519 17:8174667-8174689 GGGTCAGAAAAGGCCAGTGGTGG + Intronic
1145064616 17:19753705-19753727 GGGTCAGAAGATGCAGAAGAGGG - Intergenic
1146058419 17:29592533-29592555 TGGACAGAAAAAGCAGCAGGTGG - Intronic
1146677749 17:34785163-34785185 GAGTCAGAAAATCCTCCTGGGGG + Intergenic
1147748161 17:42708783-42708805 GGGTCAACAAGTGCAGCTGGAGG + Intronic
1148577212 17:48720350-48720372 AGGCCAGAAAATGCAGGTCGCGG - Intergenic
1148579340 17:48733038-48733060 GGGTCAGTAAAGAAAGCTGGGGG - Intergenic
1148865119 17:50624307-50624329 GGGGGAGAGAATGGAGCTGGAGG - Intronic
1149724093 17:58874951-58874973 GGGACAGAAAATGGGGCAGGAGG - Intronic
1150447715 17:65240366-65240388 GAGAAAGAAAATGAAGCTGGAGG - Intergenic
1151521091 17:74630227-74630249 GAGTCAGAAAATGCAGATGGTGG + Intergenic
1151618244 17:75228821-75228843 GGGGCAGAAAAGGCAGCCAGGGG + Intronic
1151634769 17:75338529-75338551 GGAATAGAAAATGCAGCTGTGGG - Intronic
1151831863 17:76557530-76557552 CTGTCAGAAAACGAAGCTGGAGG - Intergenic
1152199802 17:78938737-78938759 CGGGCAGAAAACACAGCTGGCGG + Intergenic
1152891019 17:82881702-82881724 GGGGTGGAAAATGCACCTGGTGG + Intronic
1152945929 17:83197314-83197336 GGTCCAGAAAAAGCAGCAGGCGG + Intergenic
1156191792 18:34728830-34728852 TGCTCAGAAAGTGAAGCTGGTGG - Intronic
1157810044 18:50688404-50688426 AGGTCAGAAAAGGCATGTGGAGG + Intronic
1157901993 18:51526755-51526777 GGGGCAGATAATGCAGCCAGTGG + Intergenic
1160090437 18:75821690-75821712 GGGCCACAAAAAGAAGCTGGAGG + Intergenic
1160294922 18:77629296-77629318 CTGTCACACAATGCAGCTGGAGG + Intergenic
1160535775 18:79590550-79590572 GGCTCAGAAACAGCAGCTGTGGG - Intergenic
1161258944 19:3324944-3324966 GGGTCAGACACTACAGCAGGAGG - Intergenic
1161382188 19:3971215-3971237 GGTGCCGAAAAGGCAGCTGGGGG - Intergenic
1162392511 19:10398073-10398095 GGGTCAGCAATTGAAGGTGGTGG - Intronic
1163054190 19:14706084-14706106 GGGACAGGAGAGGCAGCTGGAGG - Intronic
1163462123 19:17445314-17445336 GGTTCAGGAAGTGGAGCTGGTGG + Intronic
1163570829 19:18081394-18081416 GGGACAGAAAAGGATGCTGGGGG - Intronic
1164884745 19:31769119-31769141 GGGTCTGAAACAGCAGCTGTGGG - Intergenic
1165260202 19:34607896-34607918 GAGTGAGAAGATGAAGCTGGAGG - Intronic
1165272055 19:34718328-34718350 GAGTGAGAAGATGAAGCTGGAGG + Intergenic
1165380563 19:35476536-35476558 GTGTCAGAAAATGTAGTGGGAGG + Intergenic
1165461516 19:35946685-35946707 GGGTAAGAAAATGTAGCTAGAGG + Intergenic
925181336 2:1818948-1818970 GGTGCAGAAAGTGCAGCTGTGGG + Intronic
925920800 2:8636600-8636622 TGTTCTGAAAATGCAGCAGGAGG + Intergenic
926614300 2:14980219-14980241 GGTTGAGAAGAGGCAGCTGGGGG - Intergenic
927430282 2:23021537-23021559 GGCTCAGTAGATGAAGCTGGAGG + Intergenic
927680052 2:25133053-25133075 GGGTCAGAAAATGCAGCTGGGGG - Intronic
929588101 2:43128506-43128528 GGGTCAGAGCATGAAGCTGGAGG + Intergenic
929854796 2:45627825-45627847 GGGTCAGAAAGAGGAGCTCGTGG - Intergenic
929894845 2:45950798-45950820 GGGACAGCAACAGCAGCTGGTGG + Intronic
930736186 2:54781358-54781380 AGGTAAGAAGATGCAGCTGATGG + Intronic
933813125 2:86045434-86045456 TGGTCAGGAAAGGCTGCTGGAGG - Intronic
933813338 2:86047110-86047132 GTGTCAGCAAAGGCAGGTGGGGG - Intronic
934558954 2:95302356-95302378 AGATCTGAAAATGCAGCTTGGGG - Intronic
935523852 2:104142542-104142564 GGGTCAGCAAAGGTCGCTGGTGG - Intergenic
935524856 2:104153061-104153083 GGGTGAGAAATGGCAGCTGTGGG + Intergenic
935625395 2:105168449-105168471 GGGGCAGAAATAGCACCTGGAGG - Intergenic
936266149 2:111009211-111009233 GAGTCAGAAAATGGAGTTTGAGG + Intronic
937131802 2:119519313-119519335 GGGTCACAAAATCCAACAGGAGG - Intronic
938595105 2:132780942-132780964 GGGTAAGAGATTGCAACTGGGGG - Intronic
938972677 2:136446525-136446547 GGTTCAGCAGATGCAGGTGGGGG + Intergenic
942250926 2:174047180-174047202 GGTTCACAAAATGCAGTAGGTGG + Intergenic
943111481 2:183611401-183611423 GGGTGAGAAAGTGCATCTAGGGG + Intergenic
943144445 2:184024254-184024276 GAGTGAGGAAATGCTGCTGGAGG + Intergenic
946311635 2:218885214-218885236 GGGTCAGAAAAAGCTGTGGGAGG + Intronic
946463452 2:219890498-219890520 GGGCCAGAAAATCAGGCTGGTGG + Intergenic
947755946 2:232565300-232565322 GAGTCAGGAAAAGCAGCTGAAGG - Intronic
948210724 2:236191284-236191306 GGGTCAGCTGATGGAGCTGGGGG + Intergenic
1171309306 20:24133613-24133635 TGTTAAGAAAATGCAGTTGGTGG + Intergenic
1172627611 20:36357150-36357172 GGGGCTGGAAATGCAGGTGGGGG - Intronic
1173274925 20:41572194-41572216 TGGTCAGCAGAGGCAGCTGGAGG + Intronic
1176088460 20:63308564-63308586 GGGGCAGAACCTGCAGCCGGCGG + Exonic
1177168189 21:17626689-17626711 GAGTCAGCAAGTGCAGCTGCTGG + Intergenic
1179061522 21:37983741-37983763 GAGTTAGAAAATGTAGCTGGTGG - Intronic
1181086408 22:20441569-20441591 GGGTCTGAAAACCCAGCGGGAGG + Exonic
1182362738 22:29756535-29756557 GAGTCAGAAATTGCAGTGGGTGG - Intronic
1184487027 22:44785918-44785940 GGCTCAGAATTTGGAGCTGGAGG + Intronic
949694334 3:6676981-6677003 GGGTAGGAAAAAGCAGCTTGAGG - Intergenic
950124787 3:10504680-10504702 GGATGGGAAAATGCAGCAGGGGG - Intronic
950640765 3:14346721-14346743 GAGCCAGAAGAGGCAGCTGGGGG + Intergenic
950797347 3:15520906-15520928 GCCTCAGACAAGGCAGCTGGAGG - Intronic
953200700 3:40776435-40776457 GGGACAGACAATGGAGATGGAGG + Intergenic
953585772 3:44199881-44199903 GGGGCTGAAAAAGGAGCTGGAGG - Intergenic
954199805 3:49017570-49017592 GGGCCAGAAAAGGCAGGAGGGGG - Intronic
955398034 3:58571117-58571139 GGGTCAGAAAATACAGAGAGGGG + Intronic
956564465 3:70620140-70620162 GGTTCATAAATTGCAGATGGTGG - Intergenic
960896444 3:122511199-122511221 GGGTCAGAATAGGCAGCTTGGGG - Intronic
960896448 3:122511219-122511241 GGGTCAGAATAGGCAGCTTGGGG - Intronic
963618457 3:147573159-147573181 AGGTCAGAGAAGGCAGCTGGAGG + Intergenic
964209128 3:154209065-154209087 GAGCCAAAAAATGCAACTGGCGG - Intronic
964548829 3:157864437-157864459 GGATTTTAAAATGCAGCTGGGGG - Intergenic
966767195 3:183473828-183473850 GGGTCAGAAAATACAGCCTGTGG - Intergenic
968063996 3:195748052-195748074 GGATCTGGAACTGCAGCTGGCGG + Intronic
970748554 4:19329919-19329941 AGGGCATAAATTGCAGCTGGAGG + Intergenic
974651487 4:64759233-64759255 GGGTCATGAATGGCAGCTGGAGG + Intergenic
976709192 4:88051013-88051035 GGGTCTGAATCTGCAGCAGGTGG - Intronic
978283346 4:107043967-107043989 TGGTTAGAACTTGCAGCTGGGGG - Intronic
978614023 4:110575576-110575598 TGGGCTGAAAATTCAGCTGGAGG + Intergenic
979238589 4:118428597-118428619 GGGACAGAAAGTGCAGCAAGTGG + Intergenic
981229492 4:142336308-142336330 GGGGGAGAAAATACCGCTGGGGG + Intronic
981296219 4:143134963-143134985 GGGTCAGAGAATACAGAAGGAGG - Intergenic
984369951 4:178850732-178850754 GGTACAGAAAATGCAGTTAGAGG + Intergenic
984966701 4:185145654-185145676 AGGTCAGAGCATGGAGCTGGAGG + Intronic
986513365 5:8533322-8533344 GTGTCTTAAAATACAGCTGGTGG + Intergenic
987222763 5:15807359-15807381 GGGTCAGAAGAGGCATGTGGAGG - Intronic
988297630 5:29386867-29386889 GGGTCACAAAATGCATATTGAGG + Intergenic
988869280 5:35371076-35371098 GGGTCACAAAATGCACCAGAGGG + Intergenic
991449045 5:66732306-66732328 GGGCCAGAAAATGAGGCTTGGGG - Intronic
992773170 5:80068310-80068332 GGGAGAGAAAAGGCAGCTGATGG - Intronic
994563938 5:101415947-101415969 GGATTAGAAAATACAGCTGAAGG - Intergenic
994692165 5:103032892-103032914 GGATGAGAAAATACACCTGGAGG + Intergenic
995208263 5:109507080-109507102 GGGGAAGTAAATGCTGCTGGTGG - Intergenic
995525227 5:113045371-113045393 GGGTCATAAAAAGCAGCTGGCGG - Intronic
997223879 5:132194464-132194486 GGGCCAGAAGATGAGGCTGGAGG - Intronic
999171649 5:149600434-149600456 GGGCCAGAGAATGCATCTTGAGG + Intronic
999641578 5:153678440-153678462 AGGGCAGAAATGGCAGCTGGAGG - Intronic
1000011544 5:157238032-157238054 GGGCAAGAAAGTGGAGCTGGAGG + Intronic
1001113753 5:168921663-168921685 GGGACAGGAGATGCAGCCGGAGG - Intronic
1001245093 5:170100261-170100283 CACTCAGAAAATACAGCTGGAGG + Intergenic
1002650763 5:180691512-180691534 GGGTTTGATAATGAAGCTGGAGG - Intergenic
1003441429 6:6146189-6146211 GCCTCAGCAAAGGCAGCTGGGGG - Intronic
1003571430 6:7258773-7258795 GGGTCAGAGAGGGCACCTGGAGG + Intergenic
1003657533 6:8027167-8027189 TGAACAGAAAATGCATCTGGCGG - Intronic
1004511003 6:16284717-16284739 TTGTAAGAAAATGCAGCTAGTGG + Intronic
1004847405 6:19660570-19660592 GGGTTAGAAAATGTAACTGTAGG + Intergenic
1004871413 6:19908314-19908336 GGTTTAGAAAATACAGCTGTAGG + Intergenic
1005143231 6:22658175-22658197 AGATCAGAAAAGGGAGCTGGTGG + Intergenic
1006402000 6:33823069-33823091 GGGCCAGAAAAAGCTGGTGGCGG - Intergenic
1007953780 6:45897518-45897540 GGTGCAGTAGATGCAGCTGGTGG - Intergenic
1008201986 6:48602095-48602117 AGGTCAGTAATTCCAGCTGGGGG - Intergenic
1009558675 6:65209503-65209525 GGGCCAGAAAATCAAGCTGAGGG - Intronic
1010491045 6:76476813-76476835 GGGCCAGAATATTCAGATGGTGG - Intergenic
1011956058 6:93026772-93026794 GGGTCAGAAGAAGGATCTGGTGG - Intergenic
1013805783 6:113994287-113994309 GGGACAGATGATGCAGTTGGTGG - Intronic
1018918399 6:168152933-168152955 GTCTGAGAAAATGCAACTGGTGG - Intergenic
1019939613 7:4278881-4278903 GGTTCAGAAACTGCAGCCAGAGG + Intergenic
1023104204 7:36747439-36747461 GAGTCAGAAAGTGGAGCTGTAGG + Intergenic
1023984745 7:45088188-45088210 GGGTCAACAAATGCTGGTGGAGG - Intronic
1024285840 7:47756778-47756800 GGGACAGAGACTGAAGCTGGCGG - Intronic
1024692543 7:51818789-51818811 GCCTCAGAAAATGCAGGCGGAGG + Intergenic
1028861444 7:95656153-95656175 GGGTCAGAATAAGCAGCTATAGG + Intergenic
1029214531 7:98936933-98936955 GGGAAAGAAAATTCAGCCGGGGG + Intronic
1033046012 7:137962643-137962665 GGGTAAGAGAATGCTGGTGGGGG - Intronic
1035675973 8:1455734-1455756 GGGTCAGGAAGTGCCTCTGGAGG - Intergenic
1035900821 8:3456927-3456949 GGGTGAGACAGTGCAGCAGGAGG - Intronic
1036611668 8:10355743-10355765 GGGTCTGCAGATGCAGGTGGTGG + Intronic
1042872762 8:73413068-73413090 AGGTCAGGAAGTGCAGCAGGAGG + Intergenic
1043186019 8:77150898-77150920 GGGTAAGAAAATGAGGCTGAGGG - Intergenic
1043844485 8:85148883-85148905 GGGCCAGAAAATAAAGGTGGAGG + Intergenic
1045282264 8:100759331-100759353 GGTTCTCAAAATGCAGCTGCTGG + Intergenic
1045292574 8:100846448-100846470 GAGTGAGGAAATGCAGCGGGGGG + Intergenic
1045909878 8:107394519-107394541 GAGTCAGAATAAGGAGCTGGGGG + Intronic
1046948379 8:119996606-119996628 GGGTCAGTAATTAAAGCTGGAGG + Intronic
1049580297 8:143407866-143407888 GGGTCCTAGAATGCTGCTGGGGG + Intergenic
1049781706 8:144432125-144432147 GGTTTAGAAAAAACAGCTGGGGG - Intronic
1051801863 9:20943845-20943867 TGGTAAGATAATGCAGCTTGTGG - Intronic
1056134794 9:83621468-83621490 GGGTCAGAAAAAGCAACTAGGGG - Intergenic
1056656306 9:88512207-88512229 GGGTCCGACATTGCAGCTGGAGG + Intergenic
1059050760 9:110922412-110922434 GGAACAGAAAATGAAGATGGTGG + Intronic
1059095944 9:111414881-111414903 AAGTCAGAAATTGGAGCTGGAGG + Intronic
1060145937 9:121252387-121252409 GTGGCAGGAAATGAAGCTGGAGG + Intronic
1061999597 9:134209264-134209286 GAGTGAGAAACTGGAGCTGGTGG + Intergenic
1062005462 9:134236501-134236523 GGGTCATTGAATGCACCTGGTGG + Intergenic
1062368685 9:136225131-136225153 GGGTCAGAAAATGTAAATGATGG - Intronic
1185673351 X:1828844-1828866 GGGTCATAAAATCGTGCTGGTGG - Intergenic
1186990198 X:15058894-15058916 CTTTCAGAAAATGAAGCTGGAGG - Intergenic
1189211852 X:39290484-39290506 AGGTAAGGAAGTGCAGCTGGAGG - Intergenic
1190204469 X:48391906-48391928 GCGTGAGAGAAAGCAGCTGGTGG + Exonic
1190206067 X:48403497-48403519 GCGTGAGAGAAAGCAGCTGGTGG - Exonic
1190767823 X:53489969-53489991 GTGTCAGCTTATGCAGCTGGAGG - Intergenic
1194851517 X:98875739-98875761 GGATCAGAAAACAAAGCTGGGGG - Intergenic
1197095409 X:122588752-122588774 GTAACAAAAAATGCAGCTGGAGG + Intergenic
1197422620 X:126257720-126257742 GGGTCAGAGAACAAAGCTGGGGG - Intergenic
1198037744 X:132818530-132818552 GGATTAAAAAAAGCAGCTGGAGG + Intronic
1198624281 X:138551743-138551765 TTGTCAGAAAATGCCGTTGGAGG - Intergenic
1200397443 X:155999475-155999497 GGGTCTGAAAGGCCAGCTGGAGG - Intronic
1201365860 Y:13205508-13205530 GAGTCAGAAAAGGGAGATGGGGG + Intergenic
1202386358 Y:24330388-24330410 GGGACAGAAAGTGCAGCAAGTGG + Intergenic
1202484428 Y:25339740-25339762 GGGACAGAAAGTGCAGCAAGTGG - Intergenic