ID: 927683903

View in Genome Browser
Species Human (GRCh38)
Location 2:25157914-25157936
Sequence CTGTGTATGGGAAAGGGGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 395}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927683903_927683911 -4 Left 927683903 2:25157914-25157936 CCAGCCCCCTTTCCCATACACAG 0: 1
1: 0
2: 2
3: 36
4: 395
Right 927683911 2:25157933-25157955 ACAGATATCAATGGATGAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 171
927683903_927683913 7 Left 927683903 2:25157914-25157936 CCAGCCCCCTTTCCCATACACAG 0: 1
1: 0
2: 2
3: 36
4: 395
Right 927683913 2:25157944-25157966 TGGATGAGCAGGAAAAGAGGAGG 0: 1
1: 0
2: 4
3: 56
4: 607
927683903_927683912 4 Left 927683903 2:25157914-25157936 CCAGCCCCCTTTCCCATACACAG 0: 1
1: 0
2: 2
3: 36
4: 395
Right 927683912 2:25157941-25157963 CAATGGATGAGCAGGAAAAGAGG 0: 1
1: 0
2: 1
3: 43
4: 379
927683903_927683914 12 Left 927683903 2:25157914-25157936 CCAGCCCCCTTTCCCATACACAG 0: 1
1: 0
2: 2
3: 36
4: 395
Right 927683914 2:25157949-25157971 GAGCAGGAAAAGAGGAGGCCTGG 0: 1
1: 0
2: 3
3: 100
4: 801

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927683903 Original CRISPR CTGTGTATGGGAAAGGGGGC TGG (reversed) Exonic
900035297 1:402694-402716 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900056918 1:638447-638469 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900510947 1:3060829-3060851 CTGTGTTTGGAAAAGGAAGCTGG - Intergenic
901193311 1:7425430-7425452 CTGTGAATGGCGATGGGGGCAGG + Intronic
902217604 1:14944575-14944597 CTGTGCATGGGAGATGGGCCAGG + Intronic
902555516 1:17244459-17244481 CTGTGGGTGGGAAAGAGGCCAGG - Exonic
902592795 1:17487117-17487139 CTGGGTGTGGGAATGGGTGCTGG - Intergenic
903203975 1:21766600-21766622 CTTTGAATGGGAAAGGGGGTAGG + Intronic
903321617 1:22546784-22546806 CTGTGGGAGGGAACGGGGGCTGG + Intergenic
904810133 1:33158176-33158198 CTGTGTTTAGGACAGGGGGCTGG + Intronic
905127902 1:35728673-35728695 CTGTGTAAGGGACTGAGGGCTGG + Intronic
905429927 1:37914470-37914492 GTGGGGATGGGAAATGGGGCTGG - Intronic
905775993 1:40667444-40667466 CTGTCTCTGTGAAAGGGGCCAGG - Intergenic
908060397 1:60342111-60342133 CAGTCTCTGGGAAAGGGAGCAGG + Intergenic
909475236 1:76074664-76074686 CAGTGGATGGGGACGGGGGCGGG + Intergenic
910851327 1:91651978-91652000 CTGGCTATGGGAAAGTGTGCTGG + Intergenic
910896120 1:92071249-92071271 GTGTGTATGGGGTAGGGGGCAGG - Intergenic
911185027 1:94894595-94894617 CTGTTTTTGGGAAAGGGAGATGG - Intronic
912465033 1:109866535-109866557 GTGTGTATGGGGATGGGGGTGGG + Intergenic
912558222 1:110531511-110531533 CTGTGCATAGGAAAATGGGCTGG - Intergenic
913376275 1:118156291-118156313 CAGTGAATGGGAAATGGAGCAGG + Intronic
914345913 1:146798557-146798579 GTGTGATTGGGAGAGGGGGCAGG + Intergenic
915250542 1:154585204-154585226 CTGTGGATGGGTAAGGAGACAGG - Exonic
916243825 1:162666571-162666593 GTGTGTGGGGGAAAGGGGGAGGG + Intronic
917288275 1:173444184-173444206 CTGTGTTGGAGAAAGGGGTCGGG - Intergenic
918146143 1:181757838-181757860 CGGTGAATGGGAAAAAGGGCAGG - Intronic
918275786 1:182952945-182952967 CGGTGAAGGGGAAAGCGGGCCGG - Exonic
921135459 1:212255627-212255649 TTTTATATGGGAAAGGGGCCGGG - Intergenic
921161243 1:212473450-212473472 CTGTGAATGGGAGAGTGGTCTGG - Intergenic
921165303 1:212502656-212502678 GTATGGCTGGGAAAGGGGGCTGG - Intergenic
921752885 1:218817994-218818016 CTCTGTAAGGGGAGGGGGGCGGG - Intergenic
922257827 1:223908254-223908276 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
922801539 1:228366897-228366919 CAGTCCAGGGGAAAGGGGGCTGG - Intronic
923085728 1:230702314-230702336 CTGTGTGATGGACAGGGGGCGGG - Intergenic
923202262 1:231724168-231724190 CTCTGTGTGGGGAAGGGGGCAGG + Intronic
923671245 1:236043096-236043118 CAAGGTATGGGTAAGGGGGCAGG - Intronic
924339025 1:243011033-243011055 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
924929380 1:248714166-248714188 CTGCATATGGCAAAGGGGGAAGG - Intergenic
1063086040 10:2818442-2818464 CTGTGCATGGGAGGTGGGGCAGG + Intergenic
1063567507 10:7183829-7183851 CTCAGTACGGGAAAGGGAGCTGG - Intronic
1064354111 10:14602986-14603008 GTGTGTGTGGGAAAGAGGGTGGG - Intronic
1065263776 10:23954266-23954288 CAATGAAAGGGAAAGGGGGCCGG + Intronic
1066258867 10:33709265-33709287 CTGGGTCTGGGACAGGGTGCGGG + Intergenic
1067448001 10:46364729-46364751 CTGTATCTGGGAAAGGAGGCTGG - Intergenic
1067537320 10:47122894-47122916 CTGTCTATGAAAAAGGAGGCAGG + Intergenic
1067589377 10:47496032-47496054 CTGTATCTGGGAAAGGAGGCTGG + Intergenic
1067636503 10:48004111-48004133 CTGTATCTGGGAAAGGAGGCTGG + Intergenic
1069183796 10:65396827-65396849 CTGTGTCTGGGATAGGAGGGTGG - Intergenic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069991993 10:72321748-72321770 CTGTGATAGGGAAAGGGGGAGGG - Intergenic
1070371068 10:75782536-75782558 CTGTGAAGCGGAAAGGAGGCCGG + Intronic
1070694346 10:78551041-78551063 CTGTGAATGGGAAATTGGGTTGG + Intergenic
1070770050 10:79077032-79077054 CTGTGTATGGGGAAGCAGGGAGG + Intronic
1071563566 10:86660311-86660333 CTGTGTGTTCCAAAGGGGGCTGG - Intronic
1071608619 10:87015939-87015961 CTGTATCCGGGAAAGGAGGCTGG - Intergenic
1071756219 10:88543257-88543279 CTGTGGATGAAAATGGGGGCTGG - Intronic
1071868845 10:89769229-89769251 CTGTGTATTGAAATGTGGGCAGG + Intronic
1072752011 10:97987880-97987902 GTGTGGTTGGGAAAGGGGGTAGG - Intronic
1073059543 10:100725074-100725096 GTGTGTATGGGGGAGGGGGAGGG - Intergenic
1074767973 10:116714544-116714566 GTGTGTCTGGGGGAGGGGGCAGG - Intronic
1075489777 10:122856736-122856758 CTGTCCAGGGGAGAGGGGGCTGG - Intronic
1075626785 10:123969607-123969629 CTGTCTAGGGGTAGGGGGGCGGG + Intergenic
1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG + Intergenic
1075952876 10:126497190-126497212 CTGCTGATGGGAAAGGTGGCAGG + Intronic
1076076014 10:127534439-127534461 CTGTGGATGGGAAGGGGAGACGG - Intergenic
1076340392 10:129741444-129741466 CCCTGCATGGGAAAGGAGGCTGG + Intronic
1076601471 10:131659377-131659399 CTGTGTCTGGAGAAGGGGCCAGG + Intergenic
1076634454 10:131873289-131873311 CTGTGCAGGGGAAAGTGGCCAGG - Intergenic
1076797181 10:132804011-132804033 CTGTGCTTGGGAAAGGAGCCGGG + Intergenic
1076822350 10:132945732-132945754 TGGAGTCTGGGAAAGGGGGCTGG + Intergenic
1077107278 11:847716-847738 TTGTAGATGGGAAAGGGGGTGGG + Intronic
1077394617 11:2314963-2314985 CTGTCTAGGGGGAAGGGTGCAGG + Intronic
1080035123 11:27701614-27701636 CGGTGAATGGGAAAGTGGGTGGG + Intronic
1080884320 11:36352510-36352532 CTGTAAAGGGGAAAGGGGGAAGG - Intronic
1081667212 11:44923564-44923586 GTGCTTAAGGGAAAGGGGGCTGG - Intronic
1084146680 11:67268708-67268730 CCATGGATGGGAAAGGGGACAGG - Intronic
1084935703 11:72585505-72585527 CTGTGTGTGGGCATGGGGGCTGG - Intronic
1085561357 11:77474666-77474688 CTTTCTGTGGGAGAGGGGGCAGG + Intergenic
1085991742 11:81856177-81856199 CTGTGTGTGGGAATGGGAACAGG - Intergenic
1086433926 11:86763097-86763119 CTGTGTGAGGGAGTGGGGGCAGG + Intergenic
1088498909 11:110462333-110462355 ATCTGTATGGAAAAGGGGGAAGG - Exonic
1089538173 11:119173435-119173457 ATGTGTCAGGGAAAGGGGCCTGG - Intronic
1091406574 12:213226-213248 GTGTGTATGGGAATGGGTGTTGG - Intronic
1091875314 12:3928929-3928951 CTGTATATGGGGAGGTGGGCAGG - Intergenic
1092046630 12:5435536-5435558 TTGTGTATTGGGAAGGGAGCTGG + Intronic
1093089104 12:14901788-14901810 CTGTAGATGGGAAATGTGGCAGG + Intronic
1093235570 12:16605446-16605468 CTGTGTTTGGGCATGGGGGCGGG - Intronic
1096106044 12:48997608-48997630 CTGGGTCTTGGAGAGGGGGCAGG - Exonic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097264995 12:57739357-57739379 GTGTGAGTGGGAAAGGGAGCTGG - Intronic
1097628787 12:62034249-62034271 GTGGGTTTGGCAAAGGGGGCTGG - Intronic
1099662464 12:85581875-85581897 ATGTGTAAGTGAAAGGGGGAAGG - Intergenic
1100282339 12:93129764-93129786 CTGAGTATAGGAAAGTGGACTGG - Intergenic
1100977830 12:100141064-100141086 CTGGGTATGAGAAAGGCGGGAGG + Intronic
1101555898 12:105809052-105809074 TTGAGTATGGTAAAGGTGGCAGG - Intergenic
1101998827 12:109544150-109544172 CTGTGTCTGGGAAGGGCTGCAGG - Intergenic
1102480698 12:113221403-113221425 CTGTGAAGGGGAAATGGGGCGGG + Intronic
1102482464 12:113233198-113233220 TTGTGTGCGGGAAAGGGGGACGG - Intronic
1103942709 12:124509661-124509683 CAGTGTAGGGGGAAGGGGCCAGG + Intronic
1104053633 12:125212778-125212800 CTAAGTATGTGAAAGAGGGCTGG - Intronic
1104282489 12:127390750-127390772 CTGTGGATGGGAAATGGTGGTGG - Intergenic
1104965301 12:132506225-132506247 CTGTGGATGGGAGGAGGGGCCGG + Intronic
1104972509 12:132538358-132538380 CTGGGGATGGGAAAGGGGAGTGG - Intronic
1105243555 13:18628453-18628475 CGGTGTCCGGGAAAGGGTGCGGG - Intergenic
1105474501 13:20718843-20718865 ATGTGTGTGGGTGAGGGGGCAGG - Intronic
1105489019 13:20869450-20869472 CTTAATTTGGGAAAGGGGGCTGG + Intronic
1105782236 13:23715448-23715470 CTGTGCATGGTAAGGGGGGCTGG + Intergenic
1105974612 13:25462640-25462662 CTGGGAAGGGGAAAGGGGGATGG - Intronic
1106027227 13:25966890-25966912 CTGTGCAGGGGAAAGGGGATAGG + Intronic
1106486845 13:30179812-30179834 CAGTGTATGGGCAAGGGTGGGGG + Intergenic
1106728045 13:32506382-32506404 CTGTGTGTGGGAGTGGGGGGTGG + Intronic
1106997972 13:35509428-35509450 ATATGTAAGGGAATGGGGGCAGG + Intronic
1108410514 13:50141855-50141877 CTGTGTGTGGGAGAGGGTGGTGG + Intronic
1109358001 13:61257438-61257460 CTGTGTATGTGGGAGGGGGGTGG - Intergenic
1109800924 13:67377711-67377733 CTGTGTGTGGGAGTGGGGGAGGG - Intergenic
1109927751 13:69168268-69168290 CTCTCAATGGGAAAGGGAGCTGG - Intergenic
1110034729 13:70668880-70668902 GTGTGTATGAGAATGGGGGTGGG - Intergenic
1112420884 13:99247579-99247601 CTGTCTATGGGTAAGGGGCAAGG + Intronic
1113714319 13:112492589-112492611 CTGGCTATGGGAACGGGGCCTGG + Intronic
1113714328 13:112492627-112492649 CTGGCTATGGGAACGGGGCCTGG + Intronic
1113714338 13:112492665-112492687 CTGGCTATGGGAACGGGGCCTGG + Intronic
1113714349 13:112492703-112492725 CTGGCTATGGGAATGGGGCCTGG + Intronic
1113714641 13:112494145-112494167 CTAGGTATGGGAACGGGGCCTGG + Intronic
1113732680 13:112653272-112653294 GTTTGTAATGGAAAGGGGGCTGG - Intronic
1115508881 14:34120343-34120365 CTGAGTTAGGGCAAGGGGGCTGG - Intronic
1115804756 14:37038393-37038415 CTGAGTTTGGGAAAGGGGAGAGG - Intronic
1116718251 14:48455831-48455853 CTGTGTGTGGGGATGGGGGGTGG + Intergenic
1118033371 14:61839878-61839900 TTGTGGAGGGGAAAGGGGGAGGG + Intergenic
1118900499 14:69981529-69981551 GTGTGTGTGGGAGAGGGGGACGG + Intronic
1119572963 14:75692678-75692700 CTGTGTATGGGGAGCGAGGCAGG + Intronic
1120320271 14:82950817-82950839 TTGTGTATGGGATAGGTGGGGGG + Intergenic
1120818715 14:88891919-88891941 CAGTGAAGGGGAAAGGAGGCTGG - Intergenic
1122915647 14:104857091-104857113 CTGTGTAGGGGAGAGAGGGTCGG - Intergenic
1123487744 15:20756178-20756200 CGGTGTCCGGGAAAGGGGGCGGG + Intergenic
1123544234 15:21325236-21325258 CGGTGTCCGGGAAAGGGGGCGGG + Intergenic
1123898465 15:24851584-24851606 CTGTGAAGGGGAGAGTGGGCAGG + Intronic
1125725275 15:41865216-41865238 GTGTGTATGTGTGAGGGGGCGGG + Intronic
1126273908 15:46853674-46853696 CTCTGTATGGCCAAGTGGGCTGG - Intergenic
1126336122 15:47588110-47588132 GTGTGTATGGGATAGGGCGTGGG - Intronic
1126536122 15:49767368-49767390 CTCTCCATGGGAAAGGGGGTAGG + Intergenic
1128681274 15:69653652-69653674 CAGTGAATAGGAAAGGAGGCTGG + Intergenic
1128788052 15:70412773-70412795 CTCCTTATGGGAAAGGGGCCAGG - Intergenic
1129177783 15:73852565-73852587 CAGTTTATGGGAAAAGGGGAAGG - Intergenic
1130153486 15:81330273-81330295 ATGTGAAGGGGAGAGGGGGCAGG + Intergenic
1130885118 15:88086314-88086336 CTGTGTATTTGAAAAGTGGCTGG + Intronic
1131150486 15:90044423-90044445 CTGAGTGTGAGGAAGGGGGCCGG + Intronic
1131195701 15:90352824-90352846 CTGTGCATGGGGAAAGGGACGGG + Intronic
1202952579 15_KI270727v1_random:52507-52529 GGGTGTCCGGGAAAGGGGGCGGG + Intergenic
1132746645 16:1438975-1438997 CTGCGTCTGGGAAGGGGGGCAGG + Intronic
1133118275 16:3590589-3590611 CGCTGTCAGGGAAAGGGGGCTGG - Exonic
1133317317 16:4892755-4892777 CTTTGTATAGGAAAGGAGGTGGG + Intronic
1133457920 16:5959289-5959311 CTGGGAATTGGAAAGTGGGCTGG - Intergenic
1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG + Intergenic
1133665704 16:7965816-7965838 CTCTGTATGAGAAAGGGAGAAGG + Intergenic
1133773048 16:8878730-8878752 CTGTTTATGGGAAAAGGAGATGG - Intergenic
1134340849 16:13344340-13344362 GTGTGTATAGGAATGGGGGGTGG + Intergenic
1134627222 16:15730864-15730886 CGGTGTATGGGAGTGGGAGCTGG - Intronic
1135080026 16:19426333-19426355 CCGGGTCTGGGAAAGGTGGCAGG - Intronic
1135361008 16:21814746-21814768 TTGTATCTGGGAAAGGAGGCAGG + Intergenic
1135775372 16:25253382-25253404 CTGGGGAAGGGAAAGGGGGTAGG - Intronic
1137292848 16:47063665-47063687 CTGTGCCTGGGAAAGGAAGCAGG - Intergenic
1138195301 16:55047575-55047597 CTTTGTATGGGAAGGTGGTCTGG + Intergenic
1138314898 16:56061486-56061508 CTATTGATGGGAAAGGGGGCTGG - Intergenic
1138460165 16:57143300-57143322 CTGTGTGTGGGCATGGTGGCTGG + Intronic
1139474028 16:67193527-67193549 CTGGGTAGGGGTAAGGGGGTGGG + Intronic
1139988070 16:70916710-70916732 GTGTGATTGGGAGAGGGGGCAGG - Intronic
1140324815 16:73991374-73991396 ATGGGTATGGGAAGGGGAGCAGG + Intergenic
1140338309 16:74132740-74132762 CAGTGTGTGGGAAATGGGTCAGG - Intergenic
1140611682 16:76607566-76607588 CTCAGTATGGGAAAGGAGGAGGG + Intronic
1140827122 16:78716931-78716953 CTGATCTTGGGAAAGGGGGCAGG - Intronic
1140951699 16:79824637-79824659 CGGTGTATGAGAAATGAGGCTGG + Intergenic
1141166073 16:81661778-81661800 CTGTGTATGTGTCAGGGGACGGG + Intronic
1141802657 16:86321684-86321706 CTGCGTGTGGTGAAGGGGGCTGG - Intergenic
1142027895 16:87824254-87824276 CTGTGTTTGGGACAGTTGGCGGG + Intergenic
1142089192 16:88200967-88200989 CTGTGTGTGGGCGAGAGGGCCGG + Intergenic
1142125098 16:88406200-88406222 CTGAGTACGGGAAATGGGGTGGG + Intergenic
1142601801 17:1056680-1056702 TGGTGTATGGGAAATGAGGCTGG - Intronic
1142728161 17:1831477-1831499 CTGTGGATGGGAATGGTGGCAGG - Intronic
1143250119 17:5517352-5517374 CTGTGTATGTGGGAGGGGGGGGG - Intronic
1144462947 17:15472824-15472846 CTAGGTATGGGAAAAGGGGAGGG - Intronic
1146958011 17:36948363-36948385 CTGAGCAAGGGAAAGGGGGTGGG - Intergenic
1148829769 17:50424128-50424150 CTGTGGATGGGGAGGAGGGCTGG - Intergenic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149387849 17:56159648-56159670 GTGTGTCTTGGAAAGGGGGAGGG - Intronic
1149560533 17:57604955-57604977 TTGTGTGTGGGGAGGGGGGCGGG + Intronic
1150811511 17:68360640-68360662 CTCTGAATGGGAAAAGGAGCCGG + Intronic
1151623194 17:75259904-75259926 CTTTGTAAGGGAAAGGTGGGAGG + Intronic
1151838579 17:76600826-76600848 TTGTGTATGTGAAGGGGGTCGGG + Intergenic
1152847849 17:82613566-82613588 CAGTGTATGGGAAACAAGGCCGG - Intronic
1153291593 18:3507018-3507040 GTGTGTATGGGGCAGGGGGTGGG + Intronic
1153348752 18:4056132-4056154 TTATCTATGGGGAAGGGGGCAGG + Intronic
1153766556 18:8380328-8380350 CTGTGTTTGGCAAAGGATGCTGG - Exonic
1154402630 18:14056178-14056200 CTGTGTATGGTAGAGTGGGTGGG + Intergenic
1154445382 18:14431428-14431450 CGGTGTCCGGGAAAGGGTGCTGG + Intergenic
1158920434 18:62186563-62186585 CTGTGGGTGGGGACGGGGGCTGG - Intronic
1160302139 18:77691490-77691512 TGGTGTATGGGAGAGGGGGATGG - Intergenic
1160816004 19:1036107-1036129 CTGGGTGAGGGAAAGGGGCCGGG - Intronic
1161202897 19:3025668-3025690 GTGTGGGTGGGGAAGGGGGCGGG + Intronic
1161352849 19:3803481-3803503 CAGTGTTTGGGACGGGGGGCAGG - Intergenic
1161447478 19:4326769-4326791 GTGTGTGTGGGGGAGGGGGCGGG - Intronic
1161545599 19:4878365-4878387 CTGTGTTGGGGAAAAGGGGGTGG - Intergenic
1161741553 19:6024074-6024096 ATGTCTATGGGAAAATGGGCTGG - Intronic
1163522135 19:17797690-17797712 CTGGGTATGGAAAAAGGGGTGGG - Intronic
1164188849 19:22897041-22897063 ATTTTTATGGGAAAGGGGGAAGG + Intergenic
1165104008 19:33457977-33457999 CTCTGTATGGGTTGGGGGGCGGG + Intronic
1165351147 19:35276737-35276759 CTCTGCATGGGAATGGGGGTGGG - Intronic
1165639325 19:37370885-37370907 CTGTGTTGGGGAAAGCGGCCAGG - Intergenic
1166209423 19:41296614-41296636 CTGGGTATGAGAAAGAGGGAGGG + Intronic
1166257244 19:41615297-41615319 CTGTGTCTGGGAGGGGGAGCTGG + Intronic
1166409500 19:42547167-42547189 CTGTGTCTGGGGGAAGGGGCTGG + Intronic
1166788358 19:45382863-45382885 CTGTGGATGGGAACCGGAGCTGG + Intronic
1168468810 19:56624897-56624919 CTCTGGATGGGAGAGGGGGATGG - Exonic
925134261 2:1515377-1515399 CTGCGTCTGTGAAAGGTGGCAGG + Intronic
925150872 2:1613865-1613887 CTGAGTATAGGAAAGTGGGAAGG - Intergenic
925245292 2:2377323-2377345 GTGTGTATGGGAAAGTGTACTGG - Intergenic
925437665 2:3854474-3854496 CTGCTTATGGGAAAGAGGGAAGG + Intergenic
925692845 2:6542425-6542447 CTGTGTGTGGGATTAGGGGCTGG - Intergenic
925985566 2:9212312-9212334 CTGTGGATGTGCAAGGGTGCAGG + Intronic
926280087 2:11438946-11438968 CTGAGTATGGAAAAGGGAACTGG - Intergenic
926862229 2:17321509-17321531 CTGGGGATGGGAAAAGGGGATGG - Intergenic
927459714 2:23287520-23287542 CTCTGTCTGGGAAAGGTGCCAGG - Intergenic
927683903 2:25157914-25157936 CTGTGTATGGGAAAGGGGGCTGG - Exonic
928998523 2:37323897-37323919 CTGTGTGTGGAAAAGTCGGCAGG + Intronic
930666159 2:54100829-54100851 CTATGAATGGGAAATGAGGCTGG + Intronic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
931020323 2:58037426-58037448 TTTTCTATGGGAAAGGGGGCAGG + Intronic
931819042 2:65933323-65933345 CTGTGTATGTGAAATGGAGCAGG + Intergenic
932495229 2:72142850-72142872 CTGTATAAGGGAACGGGGGTGGG + Intronic
932624240 2:73284822-73284844 CTGTGAATCCGGAAGGGGGCGGG + Intergenic
932837402 2:75050453-75050475 CTCTGGATGGGGAAGGAGGCGGG - Intronic
933694862 2:85210235-85210257 ATGTGTGTGGGGAAGGGGCCAGG - Intronic
933877337 2:86632406-86632428 CTGTGCATGGGAAAAGGTGGTGG - Intronic
935148157 2:100410252-100410274 CTGCCCATGGGAAAGGGAGCAGG - Intronic
935197981 2:100831640-100831662 CTATGAAGGGGAAAGGGGGGAGG - Intronic
935198539 2:100835857-100835879 CTGTGGAGGGGAAGAGGGGCAGG - Intronic
935945619 2:108283722-108283744 CTGTGGGTGGGAATGGGGGAAGG - Intergenic
936574359 2:113641185-113641207 CTGTGTCTTGGAAAGAGGGCAGG - Intronic
940424788 2:153518111-153518133 GTGTGTATTGGACAGGGGTCTGG - Intergenic
940678549 2:156754635-156754657 CTGTGTGTGGGAGGAGGGGCAGG + Intergenic
942130053 2:172869553-172869575 CTGTGTATGGGATATGGGATGGG + Intronic
944135814 2:196398087-196398109 GAGTGTAGGGGAAAGGTGGCTGG + Intronic
946190615 2:218005971-218005993 CTGTGTGTGAGACAGGGGTCTGG - Intergenic
946593777 2:221282564-221282586 ATGAGTATGGCCAAGGGGGCAGG - Intergenic
947536129 2:230941412-230941434 CTGGGTCTGGGAGCGGGGGCAGG - Intronic
948139388 2:235661496-235661518 CTAGGAATGGGAAAGGGGGCTGG + Intronic
948487539 2:238290284-238290306 ATGTGTTAGGGAGAGGGGGCGGG - Intergenic
1169832383 20:9838876-9838898 CTGGGTAGGGGCAAGGGGGGCGG + Exonic
1170378864 20:15734062-15734084 CTGGGCAAGGGAGAGGGGGCAGG + Intronic
1172024075 20:31936071-31936093 CTGTGTAGTGGAAAGGGGCTTGG + Intronic
1172488773 20:35317231-35317253 CTGTGTGTAGGAAAGGGGCCGGG - Intronic
1173756552 20:45521745-45521767 GTGGGCATGGGAAAGGGGGTGGG - Intergenic
1173767932 20:45631013-45631035 CTGTGAGTGGGAGAGTGGGCTGG + Exonic
1173911518 20:46674353-46674375 CTCACTATGGGGAAGGGGGCAGG + Intronic
1175403054 20:58711439-58711461 CTGTGTCAGGGACACGGGGCAGG - Intronic
1175687456 20:61041805-61041827 CTGTGGCTGGGCAAGTGGGCTGG + Intergenic
1175766143 20:61594193-61594215 CTGAGCAGGGGAAAGGGGTCAGG + Intronic
1176205028 20:63883608-63883630 CTGAGAATGGGAAAGGGGTCAGG - Intronic
1176389183 21:6154907-6154929 CTGGGGAGGGGGAAGGGGGCAGG - Intergenic
1176450597 21:6858431-6858453 CGGTGTCCGGGGAAGGGGGCGGG - Intergenic
1176828767 21:13723449-13723471 CGGTGTCCGGGGAAGGGGGCGGG - Intergenic
1177320135 21:19510355-19510377 GTGTGTTTGGTAACGGGGGCAGG + Intergenic
1179511479 21:41876894-41876916 CTGTGTGTGGGGAATGGAGCTGG - Intronic
1179734289 21:43383341-43383363 CTGGGGAGGGGGAAGGGGGCAGG + Intergenic
1180001104 21:44995947-44995969 CTGAGGCTGGGAAAGGAGGCAGG - Intergenic
1180870530 22:19144267-19144289 CTTTGTATGGGACGGGGGTCAGG - Intronic
1181079111 22:20401959-20401981 CTCCGTAAGGGAAAGGGGACTGG + Intronic
1182380386 22:29883089-29883111 CGGTGTCCGGGAAAGGGGGCGGG - Intergenic
1182445313 22:30386584-30386606 ATGTCTATGGGGGAGGGGGCTGG - Intronic
1182570193 22:31231486-31231508 CTGGCTATTGGACAGGGGGCTGG + Intronic
1183536345 22:38403797-38403819 TTGTGTCTGGGAATGGGGGTGGG + Intergenic
1183960177 22:41406717-41406739 CTCTGTATGGGGAAGAGGGGAGG - Intergenic
1184335293 22:43849272-43849294 CTGTGATAGGGACAGGGGGCAGG + Intronic
1185195325 22:49465734-49465756 ATGTGTATGGGAAAGAGAGAAGG + Intronic
1185425813 22:50769703-50769725 CTGTGTCTTGGAAAGAGGGCAGG + Intronic
950545699 3:13636784-13636806 GTGTGTATGAGGAAGAGGGCTGG - Intronic
950753868 3:15155909-15155931 TTGTTTATGAGAAAGGGGGTTGG + Intergenic
952335782 3:32401858-32401880 CTGCGGAGCGGAAAGGGGGCTGG + Intronic
952591065 3:34954253-34954275 CTGTGTATGGGGAAGGAGATAGG + Intergenic
952838905 3:37627934-37627956 CTGCCTCTGGGGAAGGGGGCTGG + Intronic
952902475 3:38119363-38119385 CTGGGCATGAGCAAGGGGGCTGG - Intronic
953753853 3:45630371-45630393 CTGGCTATGGGATAGGGAGCAGG - Intronic
954643218 3:52114688-52114710 CTCTGTGTGGCATAGGGGGCAGG + Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
956182112 3:66527284-66527306 CTCTGTATGGGGTGGGGGGCGGG + Intergenic
958033390 3:88142013-88142035 GTGTGTGTGGGGAGGGGGGCTGG + Exonic
961378690 3:126483259-126483281 CTGGGTGTGGGGATGGGGGCCGG - Intronic
961546177 3:127635155-127635177 CTGTGAAGGAGAAAGGAGGCTGG - Intronic
961681472 3:128602955-128602977 CTGCCTCTGGGAAAGGTGGCTGG + Intergenic
961780363 3:129317131-129317153 CTGTGCACGGGAGAGGGGGAGGG - Intergenic
963332010 3:143925123-143925145 GTGTGTATGTGAATGTGGGCAGG - Intergenic
963584452 3:147166665-147166687 ATGAGTATGGGAAAGTTGGCAGG - Intergenic
966145901 3:176811865-176811887 CTGTGTATGGGACTTGGGGTGGG - Intergenic
967387305 3:188924329-188924351 ATGTGTATGAGAAAAGAGGCAGG - Intergenic
967404338 3:189099397-189099419 TTGTGGGTGGGAAGGGGGGCAGG + Intronic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968075969 3:195816307-195816329 CTGTGTAAGGAAAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968460373 4:721732-721754 CTGTGTATGGGCATGGGGAGGGG + Intronic
968460391 4:721784-721806 CTGTGTATGGGCATGGGGAGGGG + Intronic
968485934 4:861778-861800 CTCTGTATGGGCAGTGGGGCTGG - Intronic
968949788 4:3684477-3684499 CTGAGTATGGGAATGCTGGCGGG + Intergenic
969523967 4:7694859-7694881 CTGTCCAAGGGAAAGGGGACTGG - Intronic
970130290 4:12862174-12862196 CTGTATATGGGAAACCGTGCAGG - Intergenic
970236129 4:13960012-13960034 CTGTGAAGGGGAATGGGTGCTGG + Intergenic
970431100 4:15989944-15989966 CTGTGAGTGGGCATGGGGGCTGG + Intronic
971713002 4:30141323-30141345 GTGTGTGTGGGGCAGGGGGCAGG + Intergenic
972023363 4:34343293-34343315 ATGTGTTTGGGAAAAGGGTCTGG - Intergenic
976470568 4:85423978-85424000 CTGTGTGTGTGGAAGGGGGGCGG + Intergenic
977253056 4:94709853-94709875 CTGTGAGTGGGAAAGGGGAGGGG + Intergenic
979238095 4:118424201-118424223 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
979635938 4:122954257-122954279 CTGTCTATGGGACACGGGGATGG - Intronic
981104624 4:140866426-140866448 CTATGTGTGGGAAAAGAGGCAGG - Exonic
982651510 4:158093283-158093305 ATCTGTATGGGAAAGAGGGGTGG + Intergenic
984087730 4:175332933-175332955 CTGGGGATGGGTAAGTGGGCAGG - Intergenic
984088065 4:175336331-175336353 CTACGTATGGGACAGGGAGCTGG + Intergenic
984342888 4:178481653-178481675 CTGGGGGTGGGAACGGGGGCAGG - Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
988798324 5:34673306-34673328 CTGTGTGAGGGCAATGGGGCAGG + Intronic
989168874 5:38455906-38455928 CTGTGTACGTGAAGGGAGGCTGG - Intronic
989466684 5:41764779-41764801 CTGTGGCTGGGAAAGCAGGCAGG + Intronic
992832764 5:80610970-80610992 CTGTGTATGGGAGGGGAGGCCGG - Intergenic
993518076 5:88862748-88862770 CTGTGTCTAGGAAATAGGGCAGG + Intronic
994990482 5:106990240-106990262 CTAGGTTTGGGAAAGGGGGTGGG + Intergenic
995182986 5:109246191-109246213 CTGTGTATGTGCCAGGGGGGTGG + Intergenic
997400811 5:133600408-133600430 CTGTGTAGGATAAAGGGGGGGGG + Intronic
997500136 5:134367273-134367295 CTGTGCTTGGGAATGGGGGAGGG + Intronic
998133742 5:139664063-139664085 CTGGGCATGGGGGAGGGGGCTGG - Intronic
1000163448 5:158624079-158624101 CTATGTAAGGGAAAGGCAGCAGG - Intergenic
1000326338 5:160175493-160175515 CTGACTCTGGGAAAGCGGGCAGG - Intergenic
1000780519 5:165474469-165474491 CTGTGTAAAGGAAAGGAGGCAGG + Intergenic
1000873861 5:166611212-166611234 CTGTGTATGTGGTTGGGGGCGGG - Intergenic
1002738522 5:181416177-181416199 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1003367480 6:5489121-5489143 CTGAGTGTGGGAGTGGGGGCAGG + Intronic
1003864688 6:10352058-10352080 GTGTGTATGGGAAAGGGAACAGG + Intergenic
1005899355 6:30204578-30204600 TTGTGTATGGGGAAGGGGAGCGG - Intronic
1006104930 6:31710733-31710755 CTGTGTATGGGGAGGGGTGGGGG + Intronic
1007378008 6:41469466-41469488 CTGTCTCTAGGAAAGGGGGTGGG + Intergenic
1010715633 6:79226207-79226229 CTGTGTTTGAGAAAGGCTGCAGG + Intronic
1011408791 6:87044201-87044223 CTCTCAATGGGAAAGGGAGCTGG - Intergenic
1011673114 6:89703356-89703378 CCATGTATGGGGAAGGGGGGGGG + Intronic
1012398725 6:98827684-98827706 CTGAGCAAGGGAAGGGGGGCCGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013524131 6:110958882-110958904 CTGTGTGTGGGGAAGGGAGTTGG + Intronic
1014125738 6:117774991-117775013 CTGAGTATGGAAAAGTGGCCAGG - Intergenic
1016888887 6:148985917-148985939 CTGTGAAGGGAAAAGGAGGCAGG + Intronic
1017020259 6:150134261-150134283 CTGTGCCAGGGAACGGGGGCTGG - Intergenic
1017798832 6:157873767-157873789 CTGTCTATGGGAATGGGAGAAGG - Intronic
1018743497 6:166747583-166747605 CTGTGTGGTGGAAAGGGGGAAGG - Intronic
1018744209 6:166749876-166749898 CTGTGTGGTGGAAAGGGGGAAGG - Intronic
1018750341 6:166798765-166798787 CTGTCTGTGGAGAAGGGGGCAGG - Intronic
1018923867 6:168193627-168193649 CAGGGTTTGGGAACGGGGGCAGG + Intergenic
1019243625 6:170691729-170691751 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1019448732 7:1084920-1084942 CTGGGGATGGGACAGGGAGCAGG + Intronic
1019497677 7:1348012-1348034 CTGTGCATGGGAATTGGGGCGGG + Intergenic
1021098599 7:16562333-16562355 CTTAGTACTGGAAAGGGGGCAGG - Intronic
1021592630 7:22280404-22280426 CTGAGCATGGGAAAAGGGCCAGG - Intronic
1022801247 7:33779492-33779514 CAGTGTAGGGGGAAGGGGGAGGG + Intergenic
1023109519 7:36795156-36795178 CTGGGTATGGGACAGGAGGGTGG + Intergenic
1023558597 7:41449149-41449171 GTGTGTATGGGTTGGGGGGCTGG + Intergenic
1023883536 7:44335090-44335112 CAGGGACTGGGAAAGGGGGCAGG - Intergenic
1023988666 7:45114256-45114278 CTGTCCATGGGACAGGGGGAAGG - Intergenic
1027436055 7:78165578-78165600 CTGTGTGTGGGAAAAGGGCTAGG - Intronic
1027963003 7:84970538-84970560 CTGTGTATGAGCCAGGAGGCAGG + Intergenic
1028561486 7:92180391-92180413 CTGGGTGTGGAAAAGGGGGCTGG - Intergenic
1029496474 7:100897544-100897566 CTGTGCATGGGGGAGGGGACAGG + Intergenic
1030061070 7:105621762-105621784 CTGTGTCTGGGAGAGAGGCCAGG - Intronic
1031672515 7:124567133-124567155 CTTTGTATGTGAAAGGAGCCAGG + Intergenic
1031996183 7:128232939-128232961 CGGAGTATGGGTAACGGGGCAGG + Intergenic
1033129014 7:138729597-138729619 GTGTGTATAAGAAAGGAGGCAGG - Intronic
1034412802 7:150950149-150950171 CTGGGTATGGGGTGGGGGGCGGG - Exonic
1034421582 7:150993664-150993686 TTGTGTATGGGATAGGGGCGGGG + Intronic
1035425481 7:158769351-158769373 CTGTGTGTGAGAAAGGTGGGTGG - Intronic
1035504497 8:116431-116453 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
1036959369 8:13227029-13227051 CTGTGTATGGTATAGGGGGCGGG + Intronic
1037002948 8:13743129-13743151 GTGTGTGTGGGGAGGGGGGCTGG + Intergenic
1038013465 8:23493709-23493731 CTGTGTATGGGAACAGAGCCAGG - Intergenic
1038490811 8:27969737-27969759 CTGTGCATGGGAAGGGTGGCAGG + Intronic
1038523328 8:28252354-28252376 CTGTGGATGGGACAGGGCACAGG - Intergenic
1039434009 8:37547271-37547293 GTGTGTATGGGGTGGGGGGCGGG - Intergenic
1039455122 8:37700901-37700923 CTGTCTATGGTACAGGGGGCAGG - Intergenic
1041255436 8:55976477-55976499 CTGTGTGAGTGAAAGGGAGCGGG - Intronic
1041406226 8:57502184-57502206 CTGTGTGTGGGGTTGGGGGCAGG + Intergenic
1042155437 8:65840972-65840994 GTGTGTATGGGAAGGGGGACAGG + Intronic
1044499772 8:92939910-92939932 CTGTGGTTGGGCAAGGGTGCAGG - Intronic
1045330953 8:101155248-101155270 CTGTGTGTGGCAGAGGGGCCAGG + Intergenic
1046644957 8:116776082-116776104 CAGGGTATGGGGAAGGGGCCAGG - Intronic
1046669502 8:117042482-117042504 CTGTGTATGTGAGGCGGGGCGGG + Intronic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048774605 8:137932059-137932081 ATGTGTAAGGGAAAGGAAGCAGG - Intergenic
1048974652 8:139664404-139664426 CTGTGTAGGGGAGGGGAGGCGGG - Intronic
1049058738 8:140259204-140259226 CTGTATTTGGGAAAGTGAGCGGG - Intronic
1051019562 9:12525796-12525818 CTTTCTAAGGGAAAGGGGGAAGG + Intergenic
1051284604 9:15483353-15483375 AAGTGGATGGTAAAGGGGGCGGG - Intronic
1052552652 9:29970312-29970334 CTGTGTCTTGGAAAGGGTGGGGG + Intergenic
1053170081 9:35872102-35872124 CTGGGTATGGGAGAGTGGGAAGG - Intergenic
1053170103 9:35872166-35872188 CTGGGTATGGGAGAGTGGGAAGG - Intergenic
1053461074 9:38272032-38272054 CTGTGAAGGAGAAAGGGTGCTGG - Intergenic
1055788114 9:79892845-79892867 CTGTGTATGTGAGAGGAGGCAGG + Intergenic
1056420928 9:86425481-86425503 GTGTGTATGCGGAATGGGGCAGG - Intergenic
1057386483 9:94609773-94609795 ATGTGTGGTGGAAAGGGGGCAGG - Intronic
1058726582 9:107810430-107810452 CTGTGGTTGGAAAATGGGGCTGG + Intergenic
1058968596 9:110059598-110059620 CTGTGGATGTGAAAGGAGGTGGG + Intronic
1059107216 9:111522076-111522098 CTGTGTACGGGAACAGAGGCTGG + Intergenic
1059535392 9:115075815-115075837 CCCTGTATGGAAAAGGGGACTGG - Intronic
1060187826 9:121574754-121574776 CTGGGCATGGGAAAGGGCCCTGG - Intronic
1061189164 9:129071627-129071649 CCCTGAATGGGAAAGGGGTCTGG + Exonic
1061732789 9:132629442-132629464 CTGCGGATGGGAGACGGGGCAGG + Intronic
1062315175 9:135963642-135963664 CTCTGCATGGGAAGGGGGGTGGG - Intergenic
1203518585 Un_GL000213v1:26086-26108 CGGTGTCCGGGGAAGGGGGCGGG + Intergenic
1203603814 Un_KI270748v1:40952-40974 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1186877518 X:13830928-13830950 CACTGCAAGGGAAAGGGGGCAGG + Intronic
1187498336 X:19815089-19815111 CAGTGTATGGGAAAGTGGTATGG + Intronic
1189397508 X:40636029-40636051 TTGTGGATGGTAAAGTGGGCTGG - Intronic
1189862397 X:45286914-45286936 CTGTGTTTGGGAAGGAGGGAAGG + Intergenic
1189883529 X:45515977-45515999 CTGTGTGGGTGAAAGGGAGCAGG + Intergenic
1190221766 X:48516533-48516555 ATGTGTAGGGCAAAGGGGACGGG + Intronic
1190278138 X:48912303-48912325 CTGAGGATGGCAAAGGGGACAGG + Intergenic
1190311892 X:49122679-49122701 CTGTGGATGGCCCAGGGGGCCGG + Exonic
1190874444 X:54449627-54449649 CAGTGCAGGGGAAAGAGGGCGGG + Intronic
1191840312 X:65509079-65509101 CTGAGTACGGGATAGGGGTCTGG + Intergenic
1194125175 X:90007983-90008005 CTGTGTATGGAAGAGGGAGATGG + Intergenic
1194632468 X:96302332-96302354 CTGTGGATAAGTAAGGGGGCAGG - Intergenic
1195397242 X:104424919-104424941 CAGGGTTTGGGAAAGGGGGCTGG - Intergenic
1195641513 X:107180714-107180736 CTGAGTATGGGAAAGGGGCAGGG + Intronic
1195935022 X:110116891-110116913 GTGTGTGTGTGAAGGGGGGCAGG + Intronic
1197346317 X:125327926-125327948 CTGTGGTTGAGGAAGGGGGCAGG - Intergenic
1198574773 X:137998136-137998158 CTGGGTTTGGGGCAGGGGGCTGG - Intergenic
1199737892 X:150702020-150702042 CAGTGGATGGGAATGGGGGTGGG - Intronic
1199951107 X:152706771-152706793 CAGTGTCTGGGGTAGGGGGCTGG + Intergenic
1199958577 X:152761690-152761712 CAGTGTCTGGGGTAGGGGGCTGG - Intergenic
1200804824 Y:7422490-7422512 CTGGGGAAGGGAGAGGGGGCAGG - Intergenic
1201428176 Y:13877112-13877134 CTGTGTCAAGGAAAGGGGGAAGG + Intergenic
1202385875 Y:24325997-24326019 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1202484911 Y:25344131-25344153 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic