ID: 927684788

View in Genome Browser
Species Human (GRCh38)
Location 2:25162791-25162813
Sequence CTTAGTGCAGAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927684788_927684791 -3 Left 927684788 2:25162791-25162813 CCCAGCTCCATCTCTGCACTAAG 0: 1
1: 0
2: 1
3: 16
4: 208
Right 927684791 2:25162811-25162833 AAGCCTCCAAAACTGCACCTTGG 0: 1
1: 0
2: 1
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927684788 Original CRISPR CTTAGTGCAGAGATGGAGCT GGG (reversed) Intronic
900828349 1:4945056-4945078 CTCAGTGCAGAGCCGGATCTCGG + Intergenic
901292662 1:8136348-8136370 ATTTCGGCAGAGATGGAGCTTGG - Intergenic
905002009 1:34679957-34679979 CAAAGTGCAGAGTTGAAGCTTGG - Intergenic
910450708 1:87341543-87341565 CTTAGTGCGGTGGTGGAGGTGGG + Intronic
911948133 1:104137576-104137598 CATAGGGCAGAGATGAAGGTTGG + Intergenic
915931586 1:160063656-160063678 GGGAGAGCAGAGATGGAGCTAGG + Intronic
917672820 1:177289327-177289349 CTTATTACAGTGATAGAGCTTGG + Intergenic
919439095 1:197605002-197605024 AATAGTTCTGAGATGGAGCTAGG - Intronic
920667462 1:207973376-207973398 CTTAGAGCACTGATGGTGCTTGG + Intergenic
921222337 1:212981941-212981963 CTCAGTGCAGAGGAGGAGCTCGG - Intronic
921539731 1:216398997-216399019 CTTAGTAAAGAGTTGGAGCATGG - Intronic
922206881 1:223455817-223455839 CTGAGTCCAGTGGTGGAGCTGGG - Intergenic
923360986 1:233210937-233210959 CTCAGTGCAGAGAAGGAGCAAGG + Intronic
923427031 1:233881269-233881291 CTAAATGCAGAGATGGAGGTGGG - Intergenic
924147665 1:241093673-241093695 ATTAGTGCTGAGATGGAACCAGG - Intronic
924400956 1:243681098-243681120 ATTCTTTCAGAGATGGAGCTGGG - Intronic
924597446 1:245459760-245459782 AATAGTGCAGACCTGGAGCTAGG + Intronic
924775987 1:247114710-247114732 CTCAGGGTAGAGAAGGAGCTGGG + Intergenic
1063774110 10:9240819-9240841 CTTAGTGGAAGAATGGAGCTGGG - Intergenic
1063999243 10:11649622-11649644 CTCAGTCCAGAGATGGAGTTGGG - Intergenic
1067393205 10:45885000-45885022 TTTAAGGCCGAGATGGAGCTTGG - Intergenic
1067393270 10:45885516-45885538 CTTAGTGCAGTGTTGAAGGTAGG + Intergenic
1067861527 10:49854128-49854150 TTTAAGGCCGAGATGGAGCTTGG - Intronic
1067861592 10:49854644-49854666 CTTAGTGCAGTGTTGAAGGTAGG + Intronic
1069886731 10:71628316-71628338 AATAGTGCAGGGATGGGGCTGGG + Intronic
1070557410 10:77539303-77539325 GATAATGCAGAGATGGAGATGGG + Intronic
1071426841 10:85565704-85565726 CTGAGAGCAGAGAAAGAGCTGGG + Intergenic
1071560993 10:86646769-86646791 TCCAGAGCAGAGATGGAGCTAGG + Intergenic
1074206809 10:111289932-111289954 TTTAGTGCAGGGATGTAGATGGG - Intergenic
1075816967 10:125271862-125271884 CTGAGTGCAGAGCTTGAGCTGGG - Intergenic
1076306827 10:129471340-129471362 CTCAGGGCAGAGAAGGAGATGGG + Intronic
1077790881 11:5438544-5438566 CTGAGTGCAGAGTTTTAGCTTGG + Intronic
1078925584 11:15871981-15872003 CAGAGCTCAGAGATGGAGCTTGG + Intergenic
1081885327 11:46490673-46490695 CTTTTTGCAGGGATGAAGCTTGG - Intronic
1082171659 11:49012376-49012398 CGGAATGCAGAGATGGAGCAGGG + Intergenic
1084906608 11:72353236-72353258 CTCAGTGCAGACTTGGAGATGGG + Intronic
1084969431 11:72762555-72762577 CTCAGTACAGGGCTGGAGCTGGG - Intronic
1085467325 11:76733060-76733082 CCTAGTGCAGGGGAGGAGCTGGG + Intergenic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1086694232 11:89824709-89824731 GGCAGTGCAGAGATGGAGCAGGG - Intergenic
1086711914 11:90019802-90019824 GGCAGTGCAGAGATGGAGCAGGG + Intergenic
1087860619 11:103150006-103150028 CTTAAGGTAGAGAAGGAGCTTGG + Intronic
1089050824 11:115544301-115544323 GTTAATGAAGAGATGGGGCTGGG - Intergenic
1089330558 11:117686166-117686188 CTATGTGGAGAGATGGAGCTGGG + Intronic
1089619829 11:119715776-119715798 GATGGTGGAGAGATGGAGCTAGG - Intronic
1089772949 11:120816355-120816377 CTTAGGGGGCAGATGGAGCTTGG + Intronic
1092156769 12:6287638-6287660 TTTTTTGTAGAGATGGAGCTTGG - Intergenic
1094141363 12:27185307-27185329 CTTAGAACAGAGATGGTTCTGGG - Intergenic
1096604104 12:52752741-52752763 CTCAGGACACAGATGGAGCTGGG - Intergenic
1098460462 12:70727681-70727703 ATTGGTGCAGTGATGTAGCTAGG - Intronic
1100279391 12:93103857-93103879 ATTAGAGCAGAGCTGGTGCTTGG + Intergenic
1102019901 12:109675103-109675125 CTCTGTGCAGAGAAGAAGCTGGG + Intergenic
1102082146 12:110107094-110107116 GTAGGTGCAGAGATGGATCTTGG + Intergenic
1102539057 12:113605327-113605349 CTTTTTGCAGAGATGGGGCGGGG + Intergenic
1102653605 12:114461536-114461558 CTTGTTGTAGAGATGGTGCTGGG - Intergenic
1104120279 12:125791946-125791968 GTGAGTGCAAAGATGGAGCGGGG - Intergenic
1106332751 13:28754520-28754542 CTAAGGGCAAAGATGAAGCTGGG + Intergenic
1108000636 13:45902669-45902691 CTTAATACTCAGATGGAGCTGGG - Intergenic
1108727572 13:53199938-53199960 CTTAGTGCAGAGCTTGCGATTGG + Intergenic
1109326002 13:60869042-60869064 CTTGCTGGAGAGGTGGAGCTCGG + Intergenic
1109669425 13:65585552-65585574 CTTGGTGCAGAGTTCGACCTTGG - Intergenic
1115533978 14:34355253-34355275 ATTAATGTTGAGATGGAGCTAGG - Intronic
1115920746 14:38370578-38370600 CTTAGAGGAAATATGGAGCTAGG - Intergenic
1116081092 14:40173541-40173563 TTTAATGCAGAGTTGGAGCCTGG + Intergenic
1116419237 14:44713826-44713848 CTTAGTGCACATATGGATTTTGG - Intergenic
1116494507 14:45544815-45544837 CTTAGTGCAGCCTTGGGGCTTGG + Intergenic
1117053224 14:51883270-51883292 CTTTCTGCAGAGATGTAACTAGG + Intronic
1117243733 14:53862376-53862398 CTTAGAGCTGGGATGCAGCTGGG + Intergenic
1117485961 14:56197380-56197402 GTTAGTGGGGAGTTGGAGCTTGG + Intronic
1117599725 14:57362829-57362851 CTTATTGTTGAGATGGAGCAGGG - Intergenic
1118299642 14:64603737-64603759 CTTAGTGCAATAATGGATCTAGG + Intergenic
1118838587 14:69494455-69494477 CCTAGGGCAGAGGTGGAACTGGG - Intronic
1121481523 14:94280794-94280816 TTTACTGCAGAAATGGAGATAGG + Exonic
1122484439 14:102069183-102069205 CTGAGTGCAGAGATGTAGTAGGG + Intergenic
1122725010 14:103744783-103744805 CTCAGCCCAGAGGTGGAGCTGGG - Intronic
1124395029 15:29293763-29293785 CTTAATGGAGAGATGGAGTGTGG + Intronic
1124791803 15:32734702-32734724 CCTAGGGCAGAGGTGGAGCAGGG + Exonic
1127622463 15:60747114-60747136 CTTAGAGAAGAGATTGAGCAGGG - Intronic
1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG + Intronic
1128280548 15:66390518-66390540 CCCAGTTCAGAGATGGAGTTGGG + Intronic
1129717325 15:77859950-77859972 TCTAGGGCAGGGATGGAGCTTGG + Intergenic
1130461430 15:84160235-84160257 GATAGGGCAGGGATGGAGCTTGG - Intergenic
1131577522 15:93606469-93606491 CTCAGGGCAGAGAGGAAGCTGGG + Intergenic
1131682581 15:94739234-94739256 CTTACTGCAGAGATGGGGACTGG + Intergenic
1136108288 16:28046765-28046787 CTTTGTGCAGGGATAGAGCAGGG - Intronic
1137365101 16:47853444-47853466 CTTAGGGCTGAGATGGAACAGGG - Intergenic
1137461684 16:48670314-48670336 CTTTGTGCACAGATGGATCTAGG - Intergenic
1137903234 16:52291759-52291781 CTGAGAGAAGAGATGGATCTTGG - Intergenic
1141385417 16:83618565-83618587 GTTAGTGCAGGGCTGGAGCCTGG - Intronic
1145777157 17:27537159-27537181 CTAAGTGCAGTGGTGCAGCTGGG + Intronic
1146561719 17:33875672-33875694 CTTAGTGCACAGATAGAAGTTGG - Intronic
1147573706 17:41586871-41586893 CTGAGTGAAGAGAAGGTGCTCGG + Exonic
1147864035 17:43541392-43541414 CTTAGTACCGGGATGGAGCTGGG - Intronic
1148076823 17:44941938-44941960 CTTCTTGCTGAGATGGTGCTGGG + Intronic
1148552621 17:48559660-48559682 CTTATTGGAGAGCTGGAGATGGG - Intronic
1150263790 17:63818507-63818529 CTTAGTGGAGAGCTGGAGCTTGG + Exonic
1151544830 17:74786376-74786398 CTTGGTGCACAGATGGGGCAGGG - Intronic
1151783244 17:76261664-76261686 CGCACTGCAGAGATGGAGGTTGG + Intergenic
1151852176 17:76697540-76697562 ATCAGTGAAGTGATGGAGCTTGG - Intronic
1156512646 18:37654141-37654163 CTTAGTGGAGAGAAGAAGATAGG + Intergenic
1157466698 18:47953536-47953558 CTCAATGCACAGATGGTGCTGGG - Intergenic
1158985180 18:62808087-62808109 GATAGGGCAGAGGTGGAGCTTGG + Intronic
1160151908 18:76401761-76401783 GTTGGTGGAGAGATGGAGCGCGG - Intronic
1160151928 18:76401824-76401846 GTTGGTGGAGAGATGGAGCGCGG - Intronic
1160989897 19:1856218-1856240 CTTAGAGCAGAGATGTCACTCGG - Intronic
1161731644 19:5964458-5964480 CTTAGTGCACAGTGGGTGCTGGG - Intronic
1162434538 19:10649455-10649477 TTTAATGTAGAGATGGGGCTGGG + Intergenic
1163233667 19:16019395-16019417 CTTGGTGCTGAGAGGGAGCCTGG + Intergenic
1163368522 19:16889333-16889355 GTTACATCAGAGATGGAGCTGGG + Intronic
1163402994 19:17105620-17105642 CTCAGTGGAGAGAGGGAGTTGGG + Intronic
1164628867 19:29747830-29747852 CTGAGGGCAGAGATTGAGCATGG + Intergenic
1164778692 19:30874533-30874555 TTTCCTGCAGACATGGAGCTTGG + Intergenic
1166705089 19:44904033-44904055 CTGAGTGCAGAGATGGGGGCAGG + Intergenic
926157157 2:10462666-10462688 CTGTGTGCAGAGCTGGGGCTGGG - Intergenic
927475425 2:23410895-23410917 TTGAGTACAGAGATGGAACTTGG + Intronic
927684788 2:25162791-25162813 CTTAGTGCAGAGATGGAGCTGGG - Intronic
928742314 2:34369599-34369621 CTGAGTGAAGAAATGGAGTTAGG + Intergenic
930107638 2:47652641-47652663 CATGGAGCAGAGCTGGAGCTAGG - Intergenic
931849637 2:66239424-66239446 CCTAGTGCAGTGATGGAGTGAGG - Intergenic
932398011 2:71461417-71461439 CTCAGAGCTGAGAGGGAGCTTGG + Intronic
934902809 2:98174269-98174291 GTTAGTGAGGAGCTGGAGCTGGG - Intronic
937463131 2:122106452-122106474 CTGAGTGTAGAGGTGGAGGTGGG + Intergenic
939017094 2:136915306-136915328 CTCAGTCCAGAGATGGAGACAGG + Intronic
939814216 2:146874108-146874130 CTCAGTGTACAGATGGAGCAAGG - Intergenic
940088644 2:149891661-149891683 ATTGGTGAAGAGATGGAGCATGG + Intergenic
940735604 2:157448201-157448223 CTTATTTGAGTGATGGAGCTGGG + Intronic
941016261 2:160360584-160360606 CTTGGTGCAGAGCTGGCACTCGG - Intronic
941808348 2:169732554-169732576 GTTGGTGCAGAGGTGGAACTAGG + Intronic
942199358 2:173555255-173555277 GTTAATGCTGAGATGGAGCTAGG + Intergenic
942309604 2:174643060-174643082 CTAAGTGCTTAGATGGAGGTGGG + Intronic
946442264 2:219706763-219706785 CTTGGAGCAGAGATGGTGCCTGG + Intergenic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
948108024 2:235430655-235430677 CTTACTCCAGAGGTGGGGCTTGG - Intergenic
948883305 2:240871133-240871155 TTTGGTGCAGAGATGGAGGAGGG - Intronic
1168770104 20:408979-409001 CTCTGTGCTGAGATGGGGCTAGG + Intronic
1171070812 20:22066688-22066710 TTTAGTGGAGAGATGGATTTTGG + Intergenic
1174094429 20:48076942-48076964 TTTAATGCAGAGATGGAGGCAGG - Intergenic
1174104905 20:48155230-48155252 GTCAGGGCAGAGATGGGGCTGGG - Intergenic
1174124891 20:48297144-48297166 CGAGGTGCAGAGATGGAGATGGG - Intergenic
1179364010 21:40738951-40738973 CTTCCTGCAGGGTTGGAGCTGGG - Intronic
1179426435 21:41282990-41283012 TGTAGTGCAGAGAAAGAGCTGGG - Intergenic
1180022542 21:45137602-45137624 CTGCGTTCAGTGATGGAGCTTGG + Intronic
1181027561 22:20134625-20134647 CTGAGTGCAGAGAGGGGGCTGGG - Intronic
1181495272 22:23284056-23284078 CTTGGTGCAGAGAAGCAGGTCGG - Exonic
1181761058 22:25059142-25059164 TTCAGTGCAGAGTTGAAGCTAGG + Intronic
1183296099 22:37030403-37030425 CTTTGTGCAGAGGTGGACGTAGG + Intergenic
1183697741 22:39432745-39432767 CTTAGGGCAGAGCAGGTGCTGGG - Intronic
1184828839 22:46971298-46971320 CTGAGTGCACAGATGCAGCTGGG - Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
1185173596 22:49306971-49306993 CTCTGTGCAGAGCTGGAGCCGGG - Intergenic
952252390 3:31666998-31667020 CTTAGAGCAGGGATGGAGTCTGG - Intronic
955362007 3:58283697-58283719 GTTAATGCAGAGATGGAGGTTGG + Intronic
959562258 3:107796095-107796117 CTTCATTCAGAGATGGAGGTTGG - Intronic
961384670 3:126516728-126516750 CTCAGGGCAGAGCTGGCGCTGGG - Intronic
963077260 3:141358729-141358751 CTTAGGGCTGGGATGGAGATAGG - Intronic
974046539 4:56903444-56903466 GTTAGGGCACAGATGGAGGTAGG - Intergenic
974881307 4:67760909-67760931 CGTAGAGCAGAGCTGGAGATGGG + Intergenic
975551019 4:75612514-75612536 CTTAGTACAGAGATGAATGTAGG + Intronic
978315405 4:107430343-107430365 CTCAGAGCAAAGATGGAGCAAGG + Intergenic
981656492 4:147117677-147117699 CTTATTGCAGAGCAGGAACTTGG - Intergenic
982283586 4:153711622-153711644 CTTAGAGAAGAGATGGTACTTGG + Intronic
985774732 5:1834943-1834965 CTCCGGGCAGAGATGGAGCCTGG + Intergenic
992378934 5:76218022-76218044 CTTGGTGCTGCGATAGAGCTTGG - Intronic
994121922 5:96124145-96124167 TTTATTGCAGAGATAGAGCTTGG + Intergenic
994471482 5:100213198-100213220 CTGAGTTCAGAGATGGGGCCAGG - Intergenic
994708377 5:103233887-103233909 CTTATTTCAGAGTTGGAGTTGGG - Intergenic
995549322 5:113265388-113265410 CTTAGTGCAGACATTGAGGTTGG - Intronic
997386164 5:133474434-133474456 CTCAGTGCACTGATGGAGCTAGG - Intronic
997583520 5:135031496-135031518 CCTACTGCAGAGAAGGAGCGCGG - Exonic
997888536 5:137654371-137654393 CTAAGTGCAGAGCTGGGGTTCGG - Intronic
997902144 5:137776814-137776836 TTTAGTGCAGTGATGGAGAAAGG + Intergenic
998424293 5:142013345-142013367 TTTAGTGCAGGGGTTGAGCTGGG + Intergenic
1005565612 6:27090545-27090567 GTTCATGCATAGATGGAGCTGGG - Intergenic
1005807094 6:29484317-29484339 CCTACTGCAGAGATGCATCTGGG - Intergenic
1006600192 6:35220122-35220144 CTAAGTGCTGAGGTGGAGTTGGG + Intronic
1009728458 6:67565436-67565458 CTTAGTGCAGAGATATTGCCCGG + Intergenic
1010645358 6:78381232-78381254 CTTTGTTCAGAAATGGAGCCTGG + Intergenic
1011278065 6:85649179-85649201 AATAGGGCAGAGATGGACCTAGG - Intergenic
1015919753 6:138254947-138254969 ATTCGTGTTGAGATGGAGCTAGG - Intronic
1017100003 6:150840158-150840180 CTCTGTGCAGAGATGCAGCGTGG + Exonic
1018833621 6:167466414-167466436 CCGAGTGCAGAAGTGGAGCTGGG - Intergenic
1019923442 7:4177401-4177423 CTTAGTGCGGAGCTGGTGCTTGG + Intronic
1020049738 7:5073412-5073434 CTGAGTGCAGAGAAGGGTCTGGG - Intergenic
1020628707 7:10615102-10615124 GGTAGAGCAGAGCTGGAGCTGGG - Intergenic
1029367425 7:100125701-100125723 GTTACTGCAGAGGTGGAGATGGG + Intergenic
1031010768 7:116524522-116524544 TTTAAGGCAGAGATGGAACTTGG + Intergenic
1031203239 7:118718623-118718645 CTTGGTGGAGAAATGGAACTTGG + Intergenic
1032802735 7:135329508-135329530 CCCAGTGCAGAGACTGAGCTAGG + Intergenic
1034769935 7:153764341-153764363 CTGAGTGCAGAGGAGGAGCAAGG - Intergenic
1034902075 7:154914087-154914109 TTTAGAGGAGAGATGGAGCGGGG + Intergenic
1035332634 7:158106256-158106278 GATAGAGCAGAAATGGAGCTGGG - Intronic
1038548020 8:28441076-28441098 TTTACTGCAGAGATGGAGGGAGG + Intronic
1039946024 8:42129275-42129297 CCTGGTGCAGAGAAGGCGCTGGG + Intergenic
1041383610 8:57277742-57277764 CTCAGTACAGAGGTGGACCTTGG + Intergenic
1044458263 8:92414062-92414084 TTTTCTGCAGAGATTGAGCTGGG + Intergenic
1045971035 8:108080645-108080667 CTTAATGCAGAGATGCTGTTTGG - Intronic
1046748220 8:117898406-117898428 CTCAGTGGACAGAAGGAGCTAGG + Intronic
1048376549 8:133827591-133827613 CTTAAAGCAGAGAAAGAGCTAGG + Intergenic
1051433164 9:17001585-17001607 CTAAGAGCAGAAATGCAGCTAGG + Intergenic
1052955842 9:34252730-34252752 CTTGGTCCACAGACGGAGCTGGG - Exonic
1055406177 9:75975945-75975967 CTTAATTCAGAGATTGAACTGGG - Intronic
1055558027 9:77495335-77495357 CTTAGTATAGAGTTGGTGCTGGG + Intronic
1056327888 9:85495732-85495754 CTTAGGTCAGAGGTGGAGCCAGG - Intergenic
1056613980 9:88146273-88146295 CTTAGTTCAGAGGTAAAGCTAGG + Intergenic
1059585004 9:115596452-115596474 CTGGGTTCAGAGATGGAACTTGG + Intergenic
1059870701 9:118570929-118570951 ATTTTTGCAGAGATGGAGCCTGG - Intergenic
1060834562 9:126745355-126745377 ATTAATACAGAGATGGAGCAAGG + Intergenic
1062633337 9:137477216-137477238 CTTGGAACAGAGATGGAGCCTGG - Intronic
1185596932 X:1312896-1312918 CTTGGGGAAGAGATGGAGCCAGG + Intergenic
1186094928 X:6090102-6090124 CCTCCTGCAGAGATGAAGCTGGG + Intronic
1187032721 X:15504349-15504371 GTTAGTGCAGGGAAGGGGCTTGG + Intronic
1187621443 X:21060926-21060948 CTCAGAGCAGCTATGGAGCTGGG + Intergenic
1189245183 X:39557855-39557877 CTTAGTGCAGATTTGTAGATGGG + Intergenic
1189992452 X:46607908-46607930 CTCAGTGCAGCGCGGGAGCTGGG - Intronic
1190722287 X:53159678-53159700 CTGAGTGCAAAGATGGAGAGAGG - Intergenic
1192036398 X:67567480-67567502 CTCCGTGCAGAGATGGAAGTGGG + Intronic
1194159955 X:90437556-90437578 CATAGGGCAGAGATGAAGGTTGG - Intergenic
1196206751 X:112948504-112948526 CTCAGTGGAGAGATGGACCAAGG + Intergenic
1196457200 X:115898993-115899015 CTCAGTGAAGAGAAGGAGATTGG + Intergenic
1198429844 X:136554309-136554331 ATTAGGGCAGAGATGGAGGGAGG + Intronic
1199819130 X:151427306-151427328 CTTGGTGCAGAGGTGAAGCATGG + Intergenic
1200255715 X:154581554-154581576 CTTTGTGCAGTGAGGGATCTTGG - Intergenic
1200262054 X:154622850-154622872 CTTTGTGCAGTGAGGGATCTTGG + Intergenic
1200506248 Y:4014509-4014531 CATAGGGCAGAGATGAAGGTTGG - Intergenic
1202377829 Y:24254899-24254921 GATAGGGCAGGGATGGAGCTTGG + Intergenic
1202492953 Y:25415222-25415244 GATAGGGCAGGGATGGAGCTTGG - Intergenic