ID: 927685361

View in Genome Browser
Species Human (GRCh38)
Location 2:25167345-25167367
Sequence CTTCATGTTTAAATGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927685361_927685372 23 Left 927685361 2:25167345-25167367 CCCTGCCCCATTTAAACATGAAG 0: 1
1: 0
2: 0
3: 11
4: 180
Right 927685372 2:25167391-25167413 GTGGACTGTCTCTCCTTCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 74
927685361_927685369 4 Left 927685361 2:25167345-25167367 CCCTGCCCCATTTAAACATGAAG 0: 1
1: 0
2: 0
3: 11
4: 180
Right 927685369 2:25167372-25167394 TGGGGAATCCAAATGCCAAGTGG 0: 1
1: 0
2: 1
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927685361 Original CRISPR CTTCATGTTTAAATGGGGCA GGG (reversed) Intronic
903452696 1:23465404-23465426 CTTCATCTTTAAAATGGGAATGG - Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
904979321 1:34483732-34483754 CTTCAGGGTAAAATGGGGCCTGG + Intergenic
908356582 1:63329268-63329290 TTTTATGTTAAAATGGGGGAGGG - Intergenic
908673108 1:66570767-66570789 CTACAAGTTTAAATGGAGGATGG - Intronic
909950645 1:81716014-81716036 TTTCATATGAAAATGGGGCAAGG + Intronic
913064964 1:115242440-115242462 CTTCTTGTTTAAATGGCATATGG + Intergenic
918069143 1:181122314-181122336 CTCCATGCTGAAATGGGCCACGG - Intergenic
918822197 1:189269634-189269656 TTTTATTTTCAAATGGGGCAAGG + Intergenic
919151699 1:193709084-193709106 CTTCATGTTTACATGGCAAAAGG - Intergenic
919960323 1:202461063-202461085 GTTCCAGTTCAAATGGGGCATGG + Intronic
920548297 1:206837060-206837082 CTTCATGTCTAAATGGCTCTGGG + Intronic
922110168 1:222548253-222548275 CTTCATGTTTAGATGGGTTGGGG - Intergenic
1065293707 10:24255478-24255500 CTTCATGTCCAGATGTGGCATGG - Intronic
1065540370 10:26760283-26760305 TTTGTTGTTTAGATGGGGCAAGG - Intronic
1067049858 10:43008901-43008923 CTTAATATTTAAAGGGGGCCGGG + Intergenic
1070473150 10:76803621-76803643 CTTCATTATTAAATTGGGAATGG + Intergenic
1071959047 10:90791073-90791095 TTTCATTTTGAAAAGGGGCAGGG + Intronic
1075288233 10:121205390-121205412 CTTCATGCTTGCATGGGACAGGG - Intergenic
1078625447 11:12951922-12951944 CCAAATGTTAAAATGGGGCAGGG + Intergenic
1081396841 11:42596258-42596280 CTTCATGATAAAAAGGTGCAAGG - Intergenic
1081455603 11:43219454-43219476 CTTAATTTATAAATGAGGCACGG + Intergenic
1081919024 11:46755500-46755522 ATTTATATTTAAATGGGGCCAGG - Intronic
1084391128 11:68877810-68877832 CTTCAGTTTTAAATGCTGCAGGG - Intergenic
1085263599 11:75223511-75223533 CTTCCTCTACAAATGGGGCAGGG + Intergenic
1085835481 11:79951360-79951382 CTTGATGTAGAAAGGGGGCAGGG - Intergenic
1087932753 11:103997571-103997593 CTTAATGTTTATATGGTGCTTGG + Intronic
1089543911 11:119207182-119207204 ATTGATGTTTAAGTGAGGCAAGG + Intronic
1090995641 11:131863578-131863600 ATTCATGTTTGAATGAGGAAGGG + Intronic
1092072950 12:5648122-5648144 TTTCATCTGTAAATTGGGCACGG + Intronic
1093318156 12:17677542-17677564 GTTCCTGTGTAATTGGGGCAGGG - Intergenic
1094001412 12:25698771-25698793 CCTCAAGTTTAAATGGAGCCAGG - Intergenic
1096630765 12:52925519-52925541 CTTCAGGTATCAATGGGGCAAGG - Intronic
1097754175 12:63390519-63390541 CTTTATCTTGAAATGGGGGAGGG + Intergenic
1098089116 12:66882177-66882199 CTATGTGTTTACATGGGGCACGG - Intergenic
1100064001 12:90617882-90617904 CTTCAGTTTGAAATGGGGCTGGG + Intergenic
1101021938 12:100561430-100561452 CTTCATTTCTAAATGGGCCAGGG - Intronic
1103353294 12:120300750-120300772 ATTCATCTTAAAATGGGGGAAGG + Intergenic
1105996872 13:25680920-25680942 CTTCAGGTTGAATTGGGTCAAGG + Intronic
1108237775 13:48427004-48427026 CTGCTTGTTTAAAAAGGGCATGG - Intronic
1108806785 13:54167541-54167563 CTTCAAGTATATAAGGGGCATGG + Intergenic
1112495162 13:99898345-99898367 CTTAATGTTAAAAAGGGGCAGGG + Intergenic
1112668820 13:101611548-101611570 CTACATGTTTAAAATGGGAAAGG + Intronic
1112958649 13:105093224-105093246 CTTCATGTTAAAACTGGGCATGG - Intergenic
1113198451 13:107837161-107837183 CTTCCTGTTTAAAGGGGGCTAGG - Intronic
1121365161 14:93302368-93302390 CATCATATTAAAATGGGGCTTGG - Intronic
1121551698 14:94807684-94807706 CTTCATATTAAAATGGCGCTTGG + Intergenic
1125187886 15:36953051-36953073 CCCCATGTATAAAAGGGGCATGG - Intronic
1127006326 15:54574163-54574185 CTACATATTTTAATGGTGCAAGG - Intronic
1127073523 15:55305271-55305293 CTTCCTGCTGAACTGGGGCATGG + Intronic
1132158217 15:99512177-99512199 CTTCATGTTGACATGGCGAATGG + Intergenic
1134202687 16:12211932-12211954 CTTCATGTGTCAATGTGGCTAGG - Intronic
1134223436 16:12373437-12373459 CCTCATCTTTAAATGGGTCTAGG + Intronic
1137533440 16:49299207-49299229 CTTCCTGTTTGAATGAGCCAGGG - Intergenic
1139073101 16:63408027-63408049 TTTCATGTTTAAAAGGAGCTAGG - Intergenic
1141258935 16:82432991-82433013 CTTCCTGTTAAAAAGGGGCCTGG - Intergenic
1143874077 17:9978805-9978827 CTTCTTGCTTCAATGGGCCATGG + Intronic
1147858931 17:43504979-43505001 CTTTTTTTTTAAATGGGGCTGGG + Intronic
1150125913 17:62634778-62634800 CTCCATCTTTAAAAGGGGCTGGG - Intronic
1150307410 17:64097856-64097878 CTTCATGTTAAAATGGCTCTAGG - Intronic
1154309833 18:13258810-13258832 AATAATGTTCAAATGGGGCAGGG + Intronic
1156153412 18:34270757-34270779 TTTCCTGATGAAATGGGGCAGGG - Intergenic
1157062844 18:44312928-44312950 CTTTATGTTAAAATGGGCGAAGG - Intergenic
1162633555 19:11947405-11947427 CTTGATGAATAAATGAGGCATGG + Intronic
1164823458 19:31267371-31267393 CTCCATGTTCAAATGGGCCATGG + Intergenic
1166073788 19:40402043-40402065 CTGCATTTTTAAATGGGGGTGGG - Intronic
1167537988 19:50067557-50067579 CTTCATGTTTTAATCAGGGATGG - Intergenic
927685361 2:25167345-25167367 CTTCATGTTTAAATGGGGCAGGG - Intronic
929724515 2:44410859-44410881 CTTCATTTTTAGATGGGGGGTGG - Intronic
929742687 2:44620548-44620570 GTTCCTGTTTCAATGGGGAATGG - Intronic
931041612 2:58306744-58306766 CTTCATGCAGAAATGTGGCATGG + Intergenic
931464640 2:62475549-62475571 CTTCCTGTTTATATGGGGTCTGG - Intergenic
931688443 2:64814899-64814921 CTTCATCTTTTAATGGGAGAAGG + Intergenic
931874105 2:66493349-66493371 CTTCATGTTAAACTGGGAGAGGG - Intronic
934580546 2:95434420-95434442 CTGCAGGTTTGAGTGGGGCAAGG - Intergenic
934598903 2:95642297-95642319 CTGCAGGTTTGAGTGGGGCAAGG + Intergenic
934896655 2:98125477-98125499 CTTCATCTGTAAACTGGGCATGG + Intronic
936532250 2:113284291-113284313 CTGCAGGTTTGAGTGGGGCAAGG + Intergenic
937136337 2:119556918-119556940 CTTCATGTTCAAATGGGTAGTGG + Intronic
937578126 2:123449326-123449348 ATTCATGTTAACATCGGGCAAGG - Intergenic
938573313 2:132582338-132582360 ATTCATGATTACATGGGGGAAGG + Intronic
938832239 2:135063070-135063092 CTTCACATTTAAAGAGGGCAAGG - Intronic
939029299 2:137051653-137051675 CTTTATTTTTAACTTGGGCAAGG - Intronic
939864683 2:147459717-147459739 CTTCAGGTTTCACTGGGTCAGGG - Intergenic
940691990 2:156929810-156929832 TTTCATGCTTAAATTAGGCAAGG + Intergenic
941635089 2:167927536-167927558 CTTCATTTTTAAAATGGGGATGG + Intergenic
942910908 2:181243297-181243319 CTTCATGGTTAAATGGTTAATGG + Intergenic
945564413 2:211378762-211378784 TTATATGTTTACATGGGGCAAGG + Exonic
947533926 2:230929154-230929176 CTCAATGTTTAAGTGGGGCTTGG - Intronic
948312966 2:237003114-237003136 CTTCTTGTTCTGATGGGGCAGGG + Intergenic
1173182668 20:40816442-40816464 CTGCATATCTGAATGGGGCATGG + Intergenic
1174315702 20:49699414-49699436 CTTGATGGTTATATGGGGCCTGG - Intronic
1176916632 21:14633629-14633651 CTTCATGGACAAATGGAGCAGGG + Intronic
1177060442 21:16367307-16367329 ATTCAGGTTTAATTTGGGCATGG + Intergenic
1179222523 21:39421382-39421404 CAGAATGTTTAAATCGGGCAGGG - Intronic
950048250 3:9964618-9964640 CATCTGGTTTAAATGGTGCATGG + Intronic
950150541 3:10683446-10683468 CTTCATGTGGAACTGGGGAAAGG + Intronic
951988321 3:28646345-28646367 TTTCATGTTTTAATTAGGCATGG + Intergenic
952590011 3:34940972-34940994 TTTTATTTTTAAATGAGGCAAGG + Intergenic
953409961 3:42685319-42685341 CCTCATTTCTAAATGGAGCACGG - Intergenic
955104395 3:55882891-55882913 CCTCTTGTTTATTTGGGGCATGG - Intronic
955935323 3:64097512-64097534 CTTCATTTTTAACTGAAGCAAGG + Exonic
956815634 3:72905763-72905785 TTTCATGTGGATATGGGGCAGGG - Intronic
957040273 3:75330877-75330899 CCTTATCTTTAAATTGGGCATGG - Intergenic
957340203 3:78885837-78885859 CTTCATCTGTAAAATGGGCAGGG - Intronic
957716564 3:83935994-83936016 CAGCAAATTTAAATGGGGCAGGG + Intergenic
960472021 3:118077202-118077224 CTTCTTGTTTAAATAAGGTATGG - Intergenic
961045068 3:123702457-123702479 CCTTATCTTTAAATTGGGCATGG - Intronic
962225032 3:133598781-133598803 CTTCTTGTTTAAAAAGGGGAGGG - Intronic
963214749 3:142732423-142732445 GTTCAAGTTTATATGGGCCAAGG + Intronic
963902265 3:150743936-150743958 CTTCATGTCTCAGTGGAGCAGGG - Intronic
964981733 3:162690874-162690896 CTCCATGTTTAAATGGGAATTGG - Intergenic
965151953 3:164988957-164988979 CTTCATCTTTATATGGGACAAGG + Intronic
968343113 3:197975772-197975794 CTTTCTATTTAAATGGGGCTAGG + Intronic
968786172 4:2623738-2623760 CTTCATGCTTGACTGGGGGAGGG + Intronic
970383988 4:15537783-15537805 CTTCTGGTTGAAATGGGGCTGGG + Intronic
970480534 4:16468510-16468532 ATTCTTGTGTAAAGGGGGCATGG + Intergenic
971582408 4:28358741-28358763 GTTGATTTTTAAATGGGTCACGG + Intergenic
972366286 4:38378122-38378144 GTTCTTGTTGAAATGGGGCATGG + Intergenic
972482683 4:39512728-39512750 CTGCAAGTTTAAATAGGGGATGG + Intronic
973550048 4:52025183-52025205 GTTGATGTTTTAATGGGGTAGGG + Intronic
974968222 4:68791286-68791308 ATTCATGTTGAAATGAGGGAGGG + Intergenic
977450221 4:97186586-97186608 ATTCATCTTTAAACGGGGAACGG - Intronic
979129107 4:117017863-117017885 CTTCATGGTTAAATGTTGGAAGG - Intergenic
982225404 4:153160912-153160934 CTTCATTTTTAAAAAGGGGAGGG + Intronic
983524406 4:168746156-168746178 TTTTATGTTTAAGTGGGGGAGGG - Intronic
985378624 4:189369185-189369207 CTGCATGTTTGCATGAGGCATGG - Intergenic
986477709 5:8152769-8152791 ATTCTTATTTAAATGGGGCCAGG + Intergenic
987204488 5:15610872-15610894 CTTCAGCTGTAAATGGGGCTGGG - Intronic
987477839 5:18414292-18414314 TTTCATATTTAAATCAGGCAAGG - Intergenic
987651536 5:20747366-20747388 AATCATCTTTAAATGGGTCATGG - Intergenic
987819222 5:22940661-22940683 CTTCATGTTTATATGCGGAGGGG + Intergenic
988744025 5:34114109-34114131 AATCATCTTTAAATGGGTCATGG + Intronic
989115762 5:37950992-37951014 CTGCCTGTTGAAATTGGGCATGG + Intergenic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
992009371 5:72511532-72511554 CTTCATCTGTAAAAAGGGCAGGG - Intergenic
994379967 5:99059002-99059024 CTTCATGATTAAGTGGTCCAAGG - Intergenic
994686726 5:102964064-102964086 CTTCCTGTTTATTTGTGGCATGG - Intronic
999007549 5:147999204-147999226 CTTCATTTTTAAATGAGCCTAGG - Intergenic
999300858 5:150489524-150489546 CCTCATCTGAAAATGGGGCAGGG - Intronic
999778862 5:154832997-154833019 CATCATTTTTTAATGGGGGAGGG + Intronic
1000929679 5:167236165-167236187 CTTCCTGTCTAAATGAGCCATGG + Intergenic
1004173838 6:13321633-13321655 CACCATGTTTAAATGGGTTAAGG - Intronic
1009465550 6:63964112-63964134 CTTCAAATTAAAATGGGGGAAGG - Intronic
1010092501 6:72001508-72001530 ATTCAGGTGTATATGGGGCAGGG - Intronic
1012948700 6:105494987-105495009 CTGCATGTTTGCTTGGGGCAGGG - Intergenic
1014135901 6:117889474-117889496 CTTCATTTTTAAATAAAGCATGG - Intergenic
1014139939 6:117929976-117929998 CTTCATCTTTAAATTGGAGATGG - Intronic
1015150138 6:130028392-130028414 TTTCATGTTTAAAGGCAGCATGG + Intronic
1015413331 6:132919747-132919769 CTTCCAGTTTAAATGGTTCATGG - Intergenic
1016320738 6:142842901-142842923 AATCATGTTTAAATGTGGCCAGG - Intronic
1017606792 6:156143465-156143487 TTTTATATATAAATGGGGCAGGG + Intergenic
1018368561 6:163147413-163147435 ATTCATCTTTAAGTTGGGCATGG - Intronic
1020399186 7:7755822-7755844 TTTTATGTTTAAATGGCTCATGG - Intronic
1023627986 7:42135902-42135924 CTTAATGCTTACATGTGGCAGGG - Intronic
1024148632 7:46543745-46543767 CCTAAAGTTTAAATGGGGAAGGG - Intergenic
1026548512 7:71346488-71346510 CTTCTTTTGTAAATGAGGCAAGG + Intronic
1027890124 7:83962789-83962811 CTTCCTCCTTAAATGGGGAAGGG - Intronic
1029527662 7:101104866-101104888 CTTGGTGTTTAGATGGGGAAGGG + Intergenic
1030173496 7:106628062-106628084 CTACATGGTTAAATGGTCCATGG - Intergenic
1031925071 7:127631264-127631286 TTTCATTTTTAACTGAGGCAAGG - Intergenic
1033415571 7:141158562-141158584 CTTTATCTATAAATGTGGCAAGG + Intronic
1033760880 7:144435432-144435454 AGTAATGTGTAAATGGGGCATGG - Intergenic
1035872576 8:3151953-3151975 CTTCATGTGTAAGAGGGGAATGG - Intronic
1037287241 8:17314415-17314437 CTTCATTTTTAAAATGGGGAAGG + Intronic
1039251394 8:35668808-35668830 CTTCTTGTTGAAATGGAGCCTGG + Intronic
1041958541 8:63584402-63584424 GTTCATGGATAAATGAGGCAGGG - Intergenic
1042086138 8:65111399-65111421 CTGAATGTTCAATTGGGGCAGGG + Intergenic
1044634061 8:94304884-94304906 CTTCATTTTTAAATAAGGAAAGG + Intergenic
1044739947 8:95315822-95315844 CTTCAGGTATAAATGTGGCATGG - Intergenic
1044772295 8:95649015-95649037 ATAAATGTTGAAATGGGGCAAGG + Intergenic
1046101429 8:109618699-109618721 CATCATTTTTAAAGGAGGCAGGG - Intronic
1048986975 8:139739990-139740012 CTAGGGGTTTAAATGGGGCAGGG - Intronic
1050609277 9:7334586-7334608 CTTAATGTGCAAATGGGCCACGG + Intergenic
1053406103 9:37877441-37877463 CTTCATTTGTTAATGGGTCATGG - Intronic
1057111206 9:92472918-92472940 CTTCAGTTTTAACAGGGGCAGGG - Intronic
1057917939 9:99071952-99071974 CTCCAAGTCTAAATGGGGCTGGG - Intergenic
1058037811 9:100272524-100272546 CTACCTTTTTAGATGGGGCAGGG + Intronic
1058531573 9:105911003-105911025 CTTGATGTTTACATGGTGAATGG + Intergenic
1185739921 X:2523532-2523554 CTTCATGATTAGATGGGGTTTGG - Intergenic
1187214410 X:17262580-17262602 TTCCATTTTTAAATGGAGCAAGG + Intergenic
1188360067 X:29242338-29242360 TGTCATCTTTAAATGGGGCATGG - Intronic
1188985979 X:36768725-36768747 CTTCATGTGTGGATGGTGCATGG - Intergenic
1194749633 X:97670125-97670147 CTTCTTGTGTAAATTGGCCAAGG - Intergenic
1194934675 X:99934135-99934157 CTTCTGGGTTTAATGGGGCACGG - Intergenic
1195630674 X:107052513-107052535 CTTCCTGCTGAAATGGGGCATGG + Intergenic
1195666164 X:107433196-107433218 CTTCCTGATTAAATGAGGAAAGG + Intergenic
1195955018 X:110318853-110318875 TTAAATGTTTAAACGGGGCAAGG - Intronic
1198095686 X:133377702-133377724 ATTCATGTTTAAAGGGGGGGAGG - Intronic
1199955672 X:152740515-152740537 CTTCATAGAGAAATGGGGCAGGG - Intergenic
1202091120 Y:21191657-21191679 CTTCATGTTGAAATTGTACATGG - Intergenic
1202575394 Y:26318878-26318900 GTTCCAGTTCAAATGGGGCATGG - Intergenic