ID: 927685528

View in Genome Browser
Species Human (GRCh38)
Location 2:25168245-25168267
Sequence CGCTGTCTCCAGGGAGCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 282}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927685528_927685540 18 Left 927685528 2:25168245-25168267 CCGCCGGCTCCCTGGAGACAGCG 0: 1
1: 0
2: 1
3: 12
4: 282
Right 927685540 2:25168286-25168308 TCCGCCCAGGGGCCGGACGTGGG 0: 1
1: 0
2: 0
3: 4
4: 68
927685528_927685534 5 Left 927685528 2:25168245-25168267 CCGCCGGCTCCCTGGAGACAGCG 0: 1
1: 0
2: 1
3: 12
4: 282
Right 927685534 2:25168273-25168295 AGCTTCGCGGCCGTCCGCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 50
927685528_927685536 7 Left 927685528 2:25168245-25168267 CCGCCGGCTCCCTGGAGACAGCG 0: 1
1: 0
2: 1
3: 12
4: 282
Right 927685536 2:25168275-25168297 CTTCGCGGCCGTCCGCCCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 27
927685528_927685539 17 Left 927685528 2:25168245-25168267 CCGCCGGCTCCCTGGAGACAGCG 0: 1
1: 0
2: 1
3: 12
4: 282
Right 927685539 2:25168285-25168307 GTCCGCCCAGGGGCCGGACGTGG 0: 1
1: 0
2: 0
3: 1
4: 102
927685528_927685535 6 Left 927685528 2:25168245-25168267 CCGCCGGCTCCCTGGAGACAGCG 0: 1
1: 0
2: 1
3: 12
4: 282
Right 927685535 2:25168274-25168296 GCTTCGCGGCCGTCCGCCCAGGG 0: 1
1: 0
2: 0
3: 1
4: 32
927685528_927685537 11 Left 927685528 2:25168245-25168267 CCGCCGGCTCCCTGGAGACAGCG 0: 1
1: 0
2: 1
3: 12
4: 282
Right 927685537 2:25168279-25168301 GCGGCCGTCCGCCCAGGGGCCGG 0: 1
1: 0
2: 1
3: 22
4: 188
927685528_927685532 -8 Left 927685528 2:25168245-25168267 CCGCCGGCTCCCTGGAGACAGCG 0: 1
1: 0
2: 1
3: 12
4: 282
Right 927685532 2:25168260-25168282 AGACAGCGCCTGCAGCTTCGCGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927685528 Original CRISPR CGCTGTCTCCAGGGAGCCGG CGG (reversed) Intronic
900294611 1:1942697-1942719 CGTTGGCTTAAGGGAGCCGGAGG - Intronic
900593801 1:3471447-3471469 CCCTGTCTCCAGGGACAAGGCGG - Intronic
902170413 1:14605710-14605732 CGCTGTCTCAGGGGTGCCAGAGG + Intronic
902718973 1:18291709-18291731 CGCTGCCTCCAGGAAGCCCTCGG + Intronic
903131541 1:21282643-21282665 TGCTGGCTCCAGGGAGCCAAAGG + Intronic
903783444 1:25838417-25838439 CGCTTTAACCAGGGAGGCGGAGG + Intronic
904050127 1:27634036-27634058 CGCTGTGTTCAGGGATCCTGGGG - Intronic
904484142 1:30813900-30813922 GGCTGTCTCCAGGAAGCCCAGGG + Intergenic
904981279 1:34504321-34504343 CGCTTTATACAGGGAGGCGGAGG + Intergenic
905125742 1:35715008-35715030 CTCTGTCTCCAGGGAACAGTGGG + Exonic
905819680 1:40979833-40979855 GGCTGACTCCAGGGATCCCGGGG + Intronic
907713283 1:56904256-56904278 AGCTGTCTACAGTGAGCCTGTGG - Intronic
918241495 1:182624165-182624187 CCCTGTCCTCAGGGAGCTGGAGG - Intergenic
918275813 1:182953028-182953050 CGCTGTCTCCGGGGACACGGCGG - Exonic
919817207 1:201449040-201449062 AGAGGTCTCCAGGGAGCCAGGGG - Intergenic
920749019 1:208656584-208656606 CTCTGGCTCCAGGGATCCTGTGG + Intergenic
922151420 1:223008139-223008161 CTCTGTCTCCACGGGGCTGGAGG + Intergenic
922472152 1:225883070-225883092 AAATGTTTCCAGGGAGCCGGTGG + Intergenic
922751797 1:228073544-228073566 CGCAGTCGCCTGGGAGCCGTGGG + Intergenic
923523212 1:234752267-234752289 GGCTGTCTGGAGGGAGCAGGAGG + Intergenic
1062814461 10:489534-489556 CGCTGTCACTAGGGAGACGGTGG + Intronic
1065566826 10:27019925-27019947 AGCTGTGTCCAGGGAACCTGAGG - Intronic
1067054231 10:43041923-43041945 CGCTGTGTCCACGCAGCCTGAGG + Intergenic
1067086098 10:43239064-43239086 GGCTCTCTCCAGGGAGCTGCAGG - Intronic
1067528953 10:47056394-47056416 CTCTCTCTCCAGGGAGGAGGTGG - Intergenic
1067730655 10:48808852-48808874 CCCTGTCCCCAGGGACCCAGAGG + Intronic
1069249210 10:66246339-66246361 TGCTGGCTCCATGGAGCTGGAGG + Intronic
1070264263 10:74887053-74887075 CCCTGTCCCCAGAGAGACGGTGG - Intronic
1070805459 10:79268106-79268128 CACTATCTCCAGGGAGCCCTGGG + Intronic
1074183038 10:111079423-111079445 CGCTGACTGCAGGCAGCGGGGGG + Exonic
1074263339 10:111875807-111875829 CACTGTCTGCAGGGATCTGGGGG + Intergenic
1074758429 10:116645546-116645568 CGCTGTCTCCATGCCGCAGGTGG - Intergenic
1075885671 10:125896854-125896876 CGCGGACTCTAGGGCGCCGGCGG - Intronic
1076632804 10:131861677-131861699 CGCTTTCACCAGGGAGTCAGAGG + Intergenic
1076991417 11:278088-278110 GGCAGTCTCCAGGGAGACGCCGG - Intergenic
1077285465 11:1763496-1763518 CCCCGTCTCCAGGGAGGCTGCGG + Intronic
1078419114 11:11193304-11193326 CGCTTTAGCCAGGGAGGCGGTGG + Intergenic
1080644830 11:34180986-34181008 CGCTTGCACCAGGGAGGCGGAGG - Intronic
1082088448 11:48069181-48069203 CGCTTTATCCCGGGAGGCGGAGG - Intronic
1082692367 11:56322350-56322372 CTCTGTGTCCAGGGAGTCTGAGG - Intergenic
1083190974 11:61052369-61052391 CCCAGGCTCCAGGGATCCGGTGG - Intergenic
1083210777 11:61184166-61184188 CTTTGTCTTCAGGGAGCCAGGGG + Intergenic
1083927200 11:65815158-65815180 CATTGTCTCCAAGGAGCCTGGGG - Intergenic
1084000877 11:66294849-66294871 CGACGTCTCCAAGGAGCTGGTGG + Exonic
1084317701 11:68354914-68354936 CCCTGTCCCCACGGGGCCGGAGG + Intronic
1088328954 11:108629673-108629695 TGCAGTCTCCATGGAGCCAGTGG - Intergenic
1088811155 11:113393600-113393622 CACCTTCTCCAGGGAGCCGTTGG - Exonic
1089262386 11:117232066-117232088 CGCGGCTTCCCGGGAGCCGGAGG + Exonic
1090660692 11:128879890-128879912 AGCTGTCTCCAGGGACCCTGAGG + Intergenic
1090976848 11:131686548-131686570 TGCTGTCTCAAGGGTGGCGGAGG + Intronic
1092294696 12:7189141-7189163 CACTGTCTCCATGGAGACAGGGG - Intronic
1092300942 12:7249554-7249576 CCCTGGCTCCAGGGAGGTGGTGG + Intergenic
1092523504 12:9295517-9295539 GGCTGTCACCAGGGATCCTGTGG - Intergenic
1092543792 12:9436382-9436404 GGCTGTCACCAGGGATCCTGTGG + Intergenic
1093193596 12:16104264-16104286 CGCTTTAACCTGGGAGCCGGAGG + Intergenic
1101941493 12:109102392-109102414 CGCTGGATCCCGGGAGGCGGAGG + Intronic
1102248281 12:111368817-111368839 CGCGCTCTCCAGGTGGCCGGGGG + Intronic
1102740109 12:115199485-115199507 CGCTCTCTCTAGGGTGCAGGTGG - Intergenic
1103119420 12:118368720-118368742 CGCTGGAACCAGGGAGGCGGAGG + Intronic
1103523161 12:121549628-121549650 TTCTGCCTCCAGGGAGCCGGCGG - Exonic
1104843194 12:131834369-131834391 CGCTGTCTCCAGGGCAACAGAGG - Intronic
1105557233 13:21458955-21458977 CGCTGGCTCCAGAAAGGCGGCGG + Intronic
1106043685 13:26117755-26117777 GGGTGTGTCCAGGGAGCAGGTGG - Intergenic
1106319004 13:28620998-28621020 CCCTGACTCCTGGGAGCCTGGGG + Intergenic
1107086690 13:36432963-36432985 CGCTGTGTCCTTGGAGCCCGGGG + Intronic
1108400037 13:50031375-50031397 CGCTTGGTCCAGGGAGGCGGAGG + Intergenic
1110414352 13:75235613-75235635 TGCTGGCTCCAGGGAGCTGAGGG + Intergenic
1112674161 13:101678988-101679010 CGCTTGATCCAGGGAGTCGGAGG - Intronic
1113195845 13:107804516-107804538 CCCTGTCTTCAGGGAGCTTGGGG - Intronic
1113958410 13:114112066-114112088 TGCTGTTTCCAGGGAGAGGGAGG - Intronic
1114516305 14:23302149-23302171 CGCGGCCTCCAGGTAGGCGGCGG - Exonic
1114587376 14:23826868-23826890 GGCTGGCTCCACGGAGCTGGTGG + Intergenic
1116893368 14:50291112-50291134 CGCTGAACCCAGGGAGACGGAGG + Intronic
1118916166 14:70108314-70108336 CGCTTTAACCCGGGAGCCGGAGG + Intronic
1119513522 14:75230084-75230106 TGCTGTCTCAAGGGAGCCCTTGG + Intergenic
1123479263 15:20616039-20616061 CATTGTCCCCAGGGAGCAGGGGG + Intergenic
1123638750 15:22384346-22384368 CATTGTCCCCAGGGAGCAGGGGG - Intergenic
1125767313 15:42144378-42144400 CACTGGCTCCAGTGAGCCAGAGG + Intronic
1127410582 15:58702020-58702042 CGCTTGATCCAGGGAGGCGGAGG + Intronic
1127417436 15:58771360-58771382 CGCGGTCTCCATAGAGCTGGGGG + Exonic
1127674875 15:61229129-61229151 CGGGGTCTCCCTGGAGCCGGCGG + Intronic
1127857821 15:62967219-62967241 CCCTGTCCCCAGGGAGGAGGTGG + Intergenic
1127994602 15:64145908-64145930 AGCTGTCCCCAGGGTGCTGGCGG - Intronic
1128291624 15:66482624-66482646 CCCTGTCCCCAAGGAACCGGTGG - Intronic
1128633944 15:69291072-69291094 TGCTGACTCCAGGGAGGAGGGGG - Intergenic
1129704911 15:77788588-77788610 TGCTGTCTCCAGGGACACAGAGG - Intronic
1130160551 15:81394846-81394868 CTCAGTCTCCAGGGAGCCAAGGG + Intergenic
1132015725 15:98314752-98314774 CGCCTTCTCCAGGGAGCGGCAGG + Intergenic
1132546259 16:534754-534776 CCCTGTGTCCAGGCAGCTGGTGG - Intronic
1133097582 16:3458002-3458024 CGCTGCCGGCAGGGAGCGGGAGG + Intronic
1133767887 16:8850453-8850475 CTCTCCCTCCAGGGAGCCAGAGG - Intergenic
1134320829 16:13161122-13161144 GGCTGGCTCCAGGGAGTTGGAGG + Intronic
1134553829 16:15151339-15151361 CGCTTGCACCAGGGAGTCGGAGG + Intergenic
1135632692 16:24048571-24048593 CGCTGGAACCAGGGAGGCGGAGG - Intronic
1136548735 16:30970349-30970371 CGCTGGAACCAGGGAGGCGGAGG - Intronic
1140224357 16:73066474-73066496 CGGTGTCTCCGGGGAGCCGGAGG - Intergenic
1141204564 16:81923568-81923590 CAATGTCTCCAAGGAGCCCGGGG + Exonic
1141764292 16:86048404-86048426 CACTTCCTCCAGGGAGCCAGCGG - Intergenic
1142009201 16:87705187-87705209 CTCTGTCTCCCGGGAGCTGCTGG - Intronic
1142209904 16:88804021-88804043 CGCAGTCTCCTGCGGGCCGGTGG - Exonic
1142484674 17:238976-238998 CACTGTCTGCAGGGATCAGGTGG + Intronic
1144476630 17:15594644-15594666 CGATGTCTACAGGGAGCAGAAGG + Intronic
1144669377 17:17124314-17124336 CTGTGCCTCCAGGGGGCCGGTGG + Intronic
1144921622 17:18768758-18768780 CGATGTCTACAGGGAGCAGAAGG - Intronic
1145062183 17:19740195-19740217 TGCTTTCACCAGGGAGCCTGCGG - Intronic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1147690253 17:42310438-42310460 GGCTGTCCCCAGGGAGCTTGAGG + Intronic
1148157745 17:45433057-45433079 GGCTGTCTCCAGGGAGAAAGAGG + Intronic
1148581577 17:48747521-48747543 AGCTCTCTCCACGGAGCTGGAGG - Intergenic
1150389420 17:64781747-64781769 GGCTGTCTCCAGGGAGGAAGAGG + Intergenic
1150790024 17:68196155-68196177 GGCTGTCTCCAGGGAGGAAGAGG - Intergenic
1151742440 17:75992881-75992903 CGCTTGATCCAGGGAGCTGGAGG - Intronic
1151873675 17:76853770-76853792 CGCTTGCACCAGGGAGGCGGGGG - Intergenic
1151946950 17:77324900-77324922 CGCTGGAACCAGGGAGGCGGAGG - Intronic
1152373575 17:79905805-79905827 CACTGTCTGCATGGAGGCGGAGG - Intergenic
1154032862 18:10768285-10768307 CGCTGTGTTCAGGGACACGGAGG + Intronic
1155056546 18:22188836-22188858 CTCTGCCTCCAGGGATCCTGGGG + Intronic
1155166951 18:23239483-23239505 AGAAGTCTCCAGGGAGCTGGGGG - Intronic
1157043005 18:44061659-44061681 TGCTCGCTCCAAGGAGCCGGTGG - Intergenic
1157337500 18:46752314-46752336 CAGGGTCTCCAGGGAGCCGGTGG - Intronic
1157761480 18:50268554-50268576 CGGTGCCTCCAGGGCCCCGGTGG + Intronic
1158563884 18:58537870-58537892 TGCTGACTTCAGGGAGCCTGTGG - Exonic
1158885680 18:61824899-61824921 CCCTCTTTCCAGGGAGCCTGGGG - Intronic
1160007090 18:75075557-75075579 CCCTGGCTGCAGGGAGCCGCTGG - Intergenic
1160522673 18:79517456-79517478 CGCTGTGTCCAGTGGGACGGTGG + Intronic
1160749374 19:726867-726889 CGCTGTCACCTGGAAGCCAGTGG + Intronic
1161571050 19:5031081-5031103 CACTGTCCCCAGGGAGCCACCGG - Intronic
1162144443 19:8605253-8605275 CGCTGCCTCCGGGGAGGAGGTGG + Exonic
1162470360 19:10869388-10869410 CTCTGTCTCCAGGCATTCGGGGG + Exonic
1163586518 19:18167329-18167351 AGCAGTCGCCAGGGAGCCGCAGG - Intronic
1165424769 19:35739753-35739775 CCCTGTCTCCAGGGCGCCTGGGG + Exonic
1168126938 19:54289508-54289530 TGTTGTTTCCAGGGAGACGGGGG - Intergenic
1168173514 19:54606952-54606974 TGTTGTTTCCAGGGAGACGGGGG + Intronic
1168271868 19:55254532-55254554 CTCTGCCGCCAGGGAACCGGTGG + Intronic
1168467657 19:56617192-56617214 CGCTTTAACCAGGGAGGCGGAGG - Intronic
927685528 2:25168245-25168267 CGCTGTCTCCAGGGAGCCGGCGG - Intronic
928518450 2:32065101-32065123 CGCTGGAACCAGGGAGTCGGAGG - Intronic
929218015 2:39436776-39436798 CGCTGGCGCCAGGGAGCAGTCGG - Intronic
929967985 2:46549774-46549796 CGTTCTACCCAGGGAGCCGGGGG - Intronic
932513458 2:72319917-72319939 CGCTGGAACCAGGGAGTCGGAGG - Intronic
937415746 2:121713168-121713190 CGCTGTGTCCCGGAAGTCGGGGG - Intergenic
938073966 2:128322343-128322365 CGCCTCCTCCAGGGAGCCCGCGG + Intergenic
938083735 2:128384805-128384827 CGCTGCCTGCAGGGAGGCCGAGG + Intergenic
938120490 2:128629523-128629545 CCCTGTCTCCAGGGGGCCACTGG + Intergenic
940702278 2:157060588-157060610 CGCTTGAACCAGGGAGCCGGAGG + Intergenic
942516337 2:176757413-176757435 TGCTGTCTCAAGGGTGGCGGGGG + Intergenic
943686105 2:190819736-190819758 CGCTGGAACCAGGGAGTCGGAGG + Intergenic
944388562 2:199192215-199192237 CGCTTGAACCAGGGAGCCGGAGG - Intergenic
944624036 2:201551822-201551844 CGCTTTAACCCGGGAGCCGGAGG + Intronic
944627448 2:201585970-201585992 TGCTGTCTCAAGGGTGGCGGAGG - Intronic
945338297 2:208618527-208618549 CTCTGTCACCAGGGAACTGGGGG + Intronic
946360396 2:219216175-219216197 CGAAGCCTGCAGGGAGCCGGGGG + Exonic
948805681 2:240452712-240452734 TGCGGTTTCCAGGGAGACGGGGG + Intronic
1169198721 20:3697374-3697396 CCCTGGCTCCTGGGGGCCGGGGG - Intronic
1170870279 20:20199884-20199906 GGCGGTCTCCAAGGATCCGGTGG + Exonic
1170991122 20:21303020-21303042 TTCTGTGCCCAGGGAGCCGGAGG + Intergenic
1172903648 20:38352669-38352691 CGCTGTAGCCTGGGAGGCGGAGG + Intronic
1172952368 20:38730289-38730311 CGCTGTCACCACGGAGGCAGAGG + Intergenic
1173760174 20:45553059-45553081 TGCTGTCTCCATGGAGTGGGGGG - Intronic
1174894087 20:54430148-54430170 TGCTGTCTCAAGGGTGCCAGAGG + Intergenic
1175158191 20:56988403-56988425 TGCTCTCTCCAGGGATCCCGAGG - Intergenic
1178113384 21:29392697-29392719 CGCTGTCTCTTTGGAGCCGTTGG + Intronic
1180004388 21:45013339-45013361 CTCTGTCCCCAGAGGGCCGGTGG - Intergenic
1180036386 21:45252512-45252534 CGGAGTCTTCAGGGAGCGGGGGG - Intergenic
1180288508 22:10775280-10775302 CGCTGAATCCAGGGAGGCAGAGG + Intergenic
1180340963 22:11618294-11618316 CGCTGACTTCACGGAGCCTGGGG + Intergenic
1180979938 22:19873696-19873718 GGCCGTCTCCAGGGAGACGCAGG + Intergenic
1181164523 22:20976288-20976310 TGCTGGCACCAGGGAGCAGGTGG + Exonic
1181787506 22:25237698-25237720 CGCTGTCTCTAAGCAGCCTGCGG + Intergenic
1183614961 22:38938443-38938465 CGATGTCTCCTGGGAGAAGGTGG + Intergenic
1183829546 22:40410487-40410509 CGCTGGCTGCAGTGAGGCGGCGG + Exonic
1183892558 22:40942117-40942139 CGCTTGAACCAGGGAGCCGGAGG - Intergenic
1184365402 22:44047918-44047940 GGCTGACTCAGGGGAGCCGGAGG - Intronic
1184452055 22:44588744-44588766 CGTTCCCTCCAGGGAGCTGGTGG + Intergenic
1184618329 22:45653683-45653705 CGCTCTAACCAGGGAGTCGGAGG - Intergenic
1184728258 22:46358409-46358431 AGCTGTCACCATGGAGCCTGGGG - Intergenic
1185055371 22:48576159-48576181 CGCTGGCTGCGGGGCGCCGGGGG - Intronic
1185339286 22:50284385-50284407 CTCTGTCCCCAGGGAGGCAGAGG + Intronic
950565316 3:13766515-13766537 AGCTGACTCCAGGTAGCTGGAGG + Intergenic
957275167 3:78081558-78081580 CGCTGAACCCAGGGAGGCGGAGG + Intergenic
958026721 3:88058620-88058642 GGCAGTCTCAAGGGAGGCGGCGG + Intronic
959932496 3:111999346-111999368 CCCCGTCTGCAGGGAGCCGGAGG + Exonic
960729750 3:120713892-120713914 CGCTGAACCCAGGGAGGCGGAGG - Intronic
960848018 3:122022318-122022340 CGCAGTCCCCCGGGAGGCGGGGG - Intergenic
961162405 3:124740159-124740181 CCCAGTGGCCAGGGAGCCGGTGG - Exonic
961371388 3:126433967-126433989 GGCTGACTCCAGGGGGCCCGGGG + Intronic
961563589 3:127747714-127747736 TCCTGTCTCAAGGGAGCCTGAGG - Intronic
965977673 3:174644474-174644496 TGCTGTCTCCAGGGTGGCAGAGG + Intronic
973269335 4:48245207-48245229 CGCTTTAACCAGGGAGTCGGAGG + Intronic
973791850 4:54385198-54385220 CCCTGTCTCCCTGGAGCCGGTGG + Intergenic
975499978 4:75073945-75073967 TACTGTCTCCAGGGAGCAGAAGG + Intergenic
976167643 4:82272290-82272312 CTCTGTCCCCAGGGAGATGGGGG - Intergenic
978316900 4:107448099-107448121 CGCTTCCTTCAGGGAGCCTGTGG + Intergenic
978576813 4:110197114-110197136 CAGGGTCTCCCGGGAGCCGGGGG - Intronic
980103814 4:128567722-128567744 GCCTGACTCCAGGGAGCAGGGGG - Intergenic
982010272 4:151099434-151099456 CGCAGCCTCCAGTGAGCCCGCGG + Intergenic
984698425 4:182801761-182801783 CTCTGTCTCGGGGAAGCCGGGGG + Exonic
986249654 5:6044597-6044619 CGCAGTCTCCAGGAAACCAGAGG - Intergenic
986850232 5:11803234-11803256 CGCTTTAACCAGGGAGTCGGAGG + Intronic
987345439 5:16974835-16974857 CGCTGAATCCTGGGAGGCGGAGG - Intergenic
993001842 5:82388541-82388563 GGATGTCTCCAGGGAGACGAAGG - Intergenic
995230481 5:109755848-109755870 TGCTGTATCCAGGGATCCAGGGG + Intronic
996117470 5:119634165-119634187 GGCTGTCTCCTGGGAGACAGAGG + Exonic
997433461 5:133857678-133857700 CGCTGTCTCCTCGGAGCTGTTGG + Intergenic
998528198 5:142861493-142861515 AGCTGTGTCCAGGGATCAGGTGG + Intronic
999147705 5:149406874-149406896 CTCTGTGGCCAGGGAGCCGCAGG + Intergenic
999302311 5:150498811-150498833 TGCTGTCCCCAGGTAGCGGGAGG - Intronic
1003270916 6:4607128-4607150 TGCTGTCTGCAGGAAGCAGGAGG + Intergenic
1005310477 6:24554118-24554140 CGCTATCTCCAGGTAGACAGCGG + Intronic
1005557894 6:27006970-27006992 CTCTGTCTGCACGGAGCCAGAGG - Intergenic
1005595034 6:27370865-27370887 CGCTTTATCCCGGGAGGCGGAGG - Intergenic
1006063176 6:31441160-31441182 CCCTGTCTCCCGGGAGCCTCAGG - Intergenic
1006135929 6:31896748-31896770 AGCAGGCTCCAGGGAGTCGGGGG + Exonic
1006504301 6:34478141-34478163 CGCTGGAACCCGGGAGCCGGAGG - Intronic
1006558269 6:34887870-34887892 CGCTGTGCCCGGGGACCCGGGGG - Exonic
1006922076 6:37633726-37633748 TCCTGTGTCCAGGGTGCCGGTGG - Exonic
1007571536 6:42894720-42894742 CGCTGTCTCTTCGGAGCTGGTGG + Intergenic
1007760434 6:44130137-44130159 CACTTCCACCAGGGAGCCGGAGG - Intronic
1008358548 6:50586431-50586453 CTCTGGCTCCAGGGAGCCCTTGG - Intergenic
1008370441 6:50724636-50724658 GGCTGTCTCCAAGGAGCCGCGGG - Intronic
1009024278 6:57979423-57979445 CGCTTGAACCAGGGAGCCGGAGG + Intergenic
1009882271 6:69583435-69583457 CGCTGGAACCAGGGAGTCGGAGG + Intergenic
1010816227 6:80360919-80360941 CGCTTTAACCAGGGAGGCGGAGG + Intergenic
1013776313 6:113682357-113682379 CGCTGAACCCAGGGAGGCGGAGG + Intergenic
1015976401 6:138795866-138795888 CCCTGCCTCCAGGGAGCTTGCGG - Intergenic
1016732189 6:147438972-147438994 CGCTCTCCCCAGGCAGCCTGGGG + Intergenic
1017040871 6:150307780-150307802 CCCTGCCTCCTGGGAGCTGGGGG + Intergenic
1017112809 6:150948722-150948744 CGCTGTAACCTGGGAGGCGGAGG - Intronic
1017469246 6:154723409-154723431 CGCTGGAACCAGGGAGGCGGAGG - Intergenic
1017827127 6:158089923-158089945 CGGTGTCTCCTGGAAGCCAGAGG + Exonic
1018286698 6:162248042-162248064 TCCTCTCTCCAGGGAGCCTGTGG - Intronic
1019817805 7:3213937-3213959 CGCTGCCTCCCAGGAGCCTGGGG + Intergenic
1022628153 7:32059519-32059541 AGCTGTCTGCAGGCAGCCGAGGG - Intronic
1023052274 7:36263322-36263344 CCCTGTCTCAAGGGAGGGGGGGG + Intronic
1023843324 7:44108425-44108447 CACTCTCTTCAGGGAGCCCGAGG + Intronic
1024254643 7:47531742-47531764 TGCACTCTCCATGGAGCCGGTGG + Intronic
1029124492 7:98287196-98287218 CGCTCTCCCCAGAGACCCGGGGG + Intronic
1029304999 7:99612676-99612698 CGCTTGAACCAGGGAGCCGGAGG - Intergenic
1034267835 7:149789772-149789794 CGCAGTGTCCAGGGAGCCTGGGG - Intergenic
1034389235 7:150770842-150770864 CGCTTTATCCCGGGAGACGGAGG + Intergenic
1035160249 7:156944764-156944786 CTGAGTCTCCAGGGAGCTGGGGG - Intergenic
1035600720 8:895416-895438 CTCTGTTTCCGGGGAGCAGGGGG + Intergenic
1036176226 8:6540958-6540980 TGCTGTCCCCAGGGGGCAGGTGG + Intronic
1036526660 8:9541381-9541403 CGCTTGCACCAGGGAGGCGGAGG - Intergenic
1037811407 8:22089219-22089241 CGCTTTCGCCCGGGAGCCGGGGG + Exonic
1037815804 8:22111170-22111192 CCCTGCCTCCAGGGAGCCTGTGG - Intergenic
1040636561 8:49281219-49281241 TGCTGTCTCAAGGGAGGCAGAGG + Intergenic
1042399570 8:68330689-68330711 CGCTGTCGCTAGGGAGCGGCTGG + Intronic
1042485603 8:69342355-69342377 CGCTGGATCCAGGGCGCCTGTGG - Intergenic
1043874479 8:85468674-85468696 CGCTGGATCCCGGGAGGCGGAGG + Intronic
1044704883 8:94999205-94999227 CGCTTTAACCAGGGAGGCGGAGG - Intronic
1045215569 8:100145636-100145658 CGCGGCCTCCAGGCAGGCGGCGG - Intronic
1049546597 8:143234594-143234616 CCCTGGGTCCAGGGAGCCAGCGG - Intergenic
1049619163 8:143590043-143590065 CACGGTCTCCAGGGTGCAGGAGG + Exonic
1049686292 8:143940540-143940562 CCCGGACCCCAGGGAGCCGGAGG - Intronic
1049961367 9:741404-741426 CACTGCAACCAGGGAGCCGGGGG - Intronic
1050278509 9:4025469-4025491 CGCTTGCACCAGGGAGTCGGAGG - Intronic
1052754267 9:32524865-32524887 TGCTGGCTGCAGGGAGCCGAAGG + Intronic
1053575907 9:39357442-39357464 TGCTGTTCCCAGGGAGCGGGAGG - Intronic
1053840423 9:42185379-42185401 AGCTGTTCCCAGGGAGCGGGAGG - Intronic
1054097476 9:60916133-60916155 AGCTGTTCCCAGGGAGCGGGAGG - Intergenic
1054118879 9:61191763-61191785 AGCTGTTCCCAGGGAGCGGGAGG - Intronic
1054588873 9:66990799-66990821 AGCTGTTCCCAGGGAGCGGGAGG + Intergenic
1055986882 9:82061961-82061983 AGCTGTTCCCAGGGAGCGGGAGG + Intergenic
1056584510 9:87919603-87919625 AGCTGTTCCCAGGGAGCGGGAGG - Intergenic
1056612356 9:88133317-88133339 AGCTGTTCCCAGGGAGCGGGAGG + Intergenic
1057047982 9:91900439-91900461 CTCTTGCTCCAGGCAGCCGGAGG - Intronic
1057160294 9:92884253-92884275 AGCTGTTCCCAGGGAGCGGGAGG - Intergenic
1057291669 9:93810795-93810817 GCCTGTCTCCTGGGAGCTGGGGG + Intergenic
1059299123 9:113298541-113298563 CCCTGAATCCAGGGAGCTGGGGG + Exonic
1060821707 9:126665180-126665202 AGCTAGCTCCAGGGAGCTGGAGG - Intronic
1061396388 9:130346134-130346156 CGCTGACTCAGGGGAGCCTGTGG - Intronic
1061469664 9:130814201-130814223 CGCTTTAACCAGGGAGTCGGAGG + Intronic
1061481714 9:130900723-130900745 CGCTGGCTCCAGGGAGGGGAAGG - Intergenic
1061540849 9:131277309-131277331 CCCTGCGCCCAGGGAGCCGGAGG - Intergenic
1061641952 9:131965622-131965644 TGGTGTCACCAGAGAGCCGGTGG - Intronic
1061924067 9:133797394-133797416 TGCTGACTCCAGGGAGCCCCAGG - Intronic
1062306185 9:135908036-135908058 CGAGGTCCCCAGGGCGCCGGCGG - Intergenic
1062413946 9:136438793-136438815 TGCTGTCCTCAGGGAGTCGGAGG + Exonic
1062433557 9:136536215-136536237 CCCTGTCTGCAGGCAGCTGGGGG - Intronic
1062539473 9:137035240-137035262 CGCTGTCTGCAGGGGGCAGCTGG - Exonic
1062552885 9:137098192-137098214 AGCAGTCTCCAGGGATCCCGTGG - Intronic
1185725981 X:2422344-2422366 CGCTTGAGCCAGGGAGCCGGAGG - Intronic
1185880911 X:3740070-3740092 CGCTGGAACCAGGGAGGCGGAGG + Intergenic
1187181533 X:16947213-16947235 GGCTGCCCCCAGGGACCCGGAGG + Intronic
1187281510 X:17861112-17861134 CGCCGCCTCCAGGAAGCCGCGGG + Exonic
1189217216 X:39336484-39336506 CGTTAGCTCCAGGGAGCCTGTGG + Intergenic
1189272282 X:39759959-39759981 GGCTGTCTGGAGGGTGCCGGGGG - Intergenic
1190129245 X:47731843-47731865 CACTGGCACCAGGGAGGCGGAGG + Intergenic
1190274512 X:48891522-48891544 CGCAGTCTCCAGGCTGCGGGCGG - Intergenic
1190285920 X:48961431-48961453 CACTGTCCCCATGGAGCTGGTGG - Exonic
1190483915 X:50905205-50905227 CGCTTGAACCAGGGAGCCGGAGG + Intergenic
1192755995 X:74047457-74047479 CGCTTGAACCAGGGAGCCGGGGG + Intergenic
1194268139 X:91779603-91779625 CGCAGTCTCCGTGGAGCGGGCGG + Intronic
1200073562 X:153540547-153540569 AGCAGTCTCCAGGGTGCCTGTGG - Intronic
1200585340 Y:5000524-5000546 CGCAGTCTCCGTGGAGCGGGCGG + Intronic