ID: 927689803

View in Genome Browser
Species Human (GRCh38)
Location 2:25200433-25200455
Sequence AACACGAACAGAGCCCCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927689801_927689803 -10 Left 927689801 2:25200420-25200442 CCTCAGGCGTGTTAACACGAACA No data
Right 927689803 2:25200433-25200455 AACACGAACAGAGCCCCAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927689803 Original CRISPR AACACGAACAGAGCCCCAGC GGG Intergenic
No off target data available for this crispr