ID: 927693047

View in Genome Browser
Species Human (GRCh38)
Location 2:25221916-25221938
Sequence CCTCTTCTCTAGACAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927693047_927693064 25 Left 927693047 2:25221916-25221938 CCCTCCACTGTCTAGAGAAGAGG No data
Right 927693064 2:25221964-25221986 AAAAAGGGGTTTCAGGGAGGCGG No data
927693047_927693062 19 Left 927693047 2:25221916-25221938 CCCTCCACTGTCTAGAGAAGAGG No data
Right 927693062 2:25221958-25221980 CTAGGGAAAAAGGGGTTTCAGGG No data
927693047_927693059 11 Left 927693047 2:25221916-25221938 CCCTCCACTGTCTAGAGAAGAGG No data
Right 927693059 2:25221950-25221972 TAGGAAGCCTAGGGAAAAAGGGG No data
927693047_927693061 18 Left 927693047 2:25221916-25221938 CCCTCCACTGTCTAGAGAAGAGG No data
Right 927693061 2:25221957-25221979 CCTAGGGAAAAAGGGGTTTCAGG No data
927693047_927693057 9 Left 927693047 2:25221916-25221938 CCCTCCACTGTCTAGAGAAGAGG No data
Right 927693057 2:25221948-25221970 GGTAGGAAGCCTAGGGAAAAAGG No data
927693047_927693065 26 Left 927693047 2:25221916-25221938 CCCTCCACTGTCTAGAGAAGAGG No data
Right 927693065 2:25221965-25221987 AAAAGGGGTTTCAGGGAGGCGGG No data
927693047_927693054 -8 Left 927693047 2:25221916-25221938 CCCTCCACTGTCTAGAGAAGAGG No data
Right 927693054 2:25221931-25221953 AGAAGAGGAAAGGGAAAGGTAGG No data
927693047_927693056 2 Left 927693047 2:25221916-25221938 CCCTCCACTGTCTAGAGAAGAGG No data
Right 927693056 2:25221941-25221963 AGGGAAAGGTAGGAAGCCTAGGG No data
927693047_927693058 10 Left 927693047 2:25221916-25221938 CCCTCCACTGTCTAGAGAAGAGG No data
Right 927693058 2:25221949-25221971 GTAGGAAGCCTAGGGAAAAAGGG No data
927693047_927693063 22 Left 927693047 2:25221916-25221938 CCCTCCACTGTCTAGAGAAGAGG No data
Right 927693063 2:25221961-25221983 GGGAAAAAGGGGTTTCAGGGAGG No data
927693047_927693055 1 Left 927693047 2:25221916-25221938 CCCTCCACTGTCTAGAGAAGAGG No data
Right 927693055 2:25221940-25221962 AAGGGAAAGGTAGGAAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927693047 Original CRISPR CCTCTTCTCTAGACAGTGGA GGG (reversed) Intergenic
No off target data available for this crispr