ID: 927694439

View in Genome Browser
Species Human (GRCh38)
Location 2:25230619-25230641
Sequence GACCCAATACCTGTCCCCAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927694431_927694439 25 Left 927694431 2:25230571-25230593 CCTCTGCCTTATCTACAGCCTGC 0: 1
1: 0
2: 0
3: 19
4: 231
Right 927694439 2:25230619-25230641 GACCCAATACCTGTCCCCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 143
927694436_927694439 -10 Left 927694436 2:25230606-25230628 CCCCTTGGAAGGTGACCCAATAC 0: 1
1: 0
2: 1
3: 11
4: 74
Right 927694439 2:25230619-25230641 GACCCAATACCTGTCCCCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 143
927694433_927694439 7 Left 927694433 2:25230589-25230611 CCTGCTGAAGTTCAGCACCCCTT 0: 1
1: 0
2: 0
3: 7
4: 141
Right 927694439 2:25230619-25230641 GACCCAATACCTGTCCCCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 143
927694432_927694439 19 Left 927694432 2:25230577-25230599 CCTTATCTACAGCCTGCTGAAGT 0: 1
1: 0
2: 1
3: 8
4: 176
Right 927694439 2:25230619-25230641 GACCCAATACCTGTCCCCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927694439 Original CRISPR GACCCAATACCTGTCCCCAG AGG Exonic
900334682 1:2156326-2156348 GACCCAATGCCTGCACTCAGTGG - Intronic
900820041 1:4879571-4879593 GACCCAATGCCTGTCCTGAAAGG - Intergenic
901644690 1:10710072-10710094 AACCCATTTCCTGTCCCCAAAGG - Intronic
903813460 1:26047205-26047227 GAGCCCCTTCCTGTCCCCAGTGG - Intergenic
903848211 1:26290894-26290916 GGCCCAACACCTGGCCCCAGTGG + Intronic
906684847 1:47756655-47756677 GACCCAGGAGCTGTCTCCAGTGG + Intergenic
906685613 1:47761330-47761352 GCCCCACTCCCTGACCCCAGGGG - Exonic
907308755 1:53527704-53527726 GTCCCAGCACCTGCCCCCAGAGG - Intronic
907601560 1:55776287-55776309 GACCCAATGACTGTCCTCATGGG + Intergenic
910159564 1:84258959-84258981 GACCCAAAAACTCTGCCCAGGGG + Intergenic
1068981153 10:63063302-63063324 GCCGCAATACCTGTCCCAAATGG - Intergenic
1070779023 10:79126897-79126919 GACCCAAGGCTTCTCCCCAGTGG + Intronic
1071288066 10:84167018-84167040 GACTCAAGACCTGAGCCCAGGGG - Intergenic
1076001995 10:126919744-126919766 GAGCCACCACCTGCCCCCAGGGG - Intronic
1076859079 10:133131691-133131713 GGCCCAACACCAGTCCCAAGTGG - Intergenic
1080642614 11:34166544-34166566 GACACAATCCCTGCCCTCAGAGG + Intronic
1084890081 11:72232488-72232510 GACCCTAACCTTGTCCCCAGGGG + Intronic
1089448411 11:118572488-118572510 GACCCTACCCCTATCCCCAGTGG + Exonic
1090744635 11:129696136-129696158 GAGCCAACACCTGTCTCCAGAGG - Intergenic
1092128018 12:6088861-6088883 AACCCAATGCCTGTCTCCACTGG - Intronic
1096629223 12:52914962-52914984 GAACCAATCCCTGTGGCCAGGGG + Intronic
1101939489 12:109089387-109089409 CCCCCAATACCTGTCCCCTGGGG - Intronic
1102310726 12:111842493-111842515 GCACAAAGACCTGTCCCCAGGGG + Intronic
1104846491 12:131849796-131849818 CACCCAGTACCTGTCTCCTGGGG - Exonic
1106386116 13:29287854-29287876 GACACGATTCCTGTCCCCACAGG + Intronic
1111689526 13:91544980-91545002 GCCTCAATTCCTTTCCCCAGGGG + Intronic
1112717485 13:102203418-102203440 CACCCAGTGCCTCTCCCCAGAGG - Intronic
1113727317 13:112614905-112614927 CACCCCATCCCTGGCCCCAGTGG + Intergenic
1114051109 14:18920435-18920457 CACCCAACCCCTGCCCCCAGAGG - Intergenic
1114079907 14:19194797-19194819 GTCCCCATACCAGTCCCGAGAGG - Intergenic
1114111450 14:19481487-19481509 CACCCAACCCCTGCCCCCAGAGG + Intergenic
1118894504 14:69934526-69934548 GACCCAACACTTCTCCCCTGTGG - Intronic
1119425148 14:74530232-74530254 GACCCAATCACTGTAACCAGGGG - Intronic
1119529511 14:75349816-75349838 GACCCAAGCCCTTTCCCTAGTGG - Intergenic
1122278377 14:100607097-100607119 TAACCAATCCCTGTACCCAGGGG + Intergenic
1122337216 14:101001609-101001631 GACCCAGTTCCTGGCCCCTGCGG - Intergenic
1123054317 14:105561999-105562021 GCCCCCAGGCCTGTCCCCAGTGG + Intergenic
1123078901 14:105682418-105682440 GCCCCCAGGCCTGTCCCCAGTGG + Intergenic
1124206802 15:27727777-27727799 GCCCCACTACCTCTCCCCTGTGG - Intergenic
1126297714 15:47159547-47159569 GACCCCATTCCTGCCCCCTGTGG - Intergenic
1128605173 15:69031589-69031611 GAGCCACTGCCTGTCCCGAGTGG - Exonic
1129075532 15:72992550-72992572 GACCCCACTCCTGGCCCCAGTGG + Intergenic
1132113637 15:99120249-99120271 GACCTAGTCCCTGTCCTCAGTGG + Intronic
1132614079 16:831758-831780 GCCCCCACACCTGTTCCCAGCGG - Intergenic
1136094326 16:27944065-27944087 TACCAAATCCCTTTCCCCAGGGG - Intronic
1138497842 16:57419109-57419131 GGCCCCATCGCTGTCCCCAGGGG + Intergenic
1139440572 16:66964616-66964638 CACCCAGGTCCTGTCCCCAGTGG + Exonic
1143486951 17:7260598-7260620 GACCCCAGACCTGTCCCCTTAGG + Intronic
1145193549 17:20867851-20867873 CACCCAACACTTGCCCCCAGAGG + Intronic
1145403967 17:22569860-22569882 CACCCAACCCTTGTCCCCAGAGG + Intergenic
1147041434 17:37722373-37722395 GTCCCAATACCTATCCCCTTAGG - Intronic
1151400995 17:73855984-73856006 GACCCACTCCCTGTCCTCAGGGG - Intergenic
1151586724 17:75013135-75013157 GACCAAATTCCAGTCCCAAGGGG + Intronic
1152827796 17:82478630-82478652 GACCCAAAACCCGTCCTCGGTGG - Intronic
1154350902 18:13582570-13582592 GCATCAATACCTGTCCCCACTGG + Intronic
1161397539 19:4052525-4052547 GTCCCAGTTCCTGTCCCCACGGG + Intronic
1165114848 19:33522517-33522539 CACCCAGTACCAGTGCCCAGTGG - Intergenic
1165905163 19:39189302-39189324 GACACCATTCCTGTCCCCACGGG - Intergenic
1166253408 19:41586240-41586262 GACCCAGGATCTGTCCCCACTGG + Intronic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
1166401618 19:42485548-42485570 GAACCACTAGCTGTCCCCATTGG + Intergenic
926276498 2:11407204-11407226 GAGCCAATCACTGTGCCCAGGGG - Intergenic
926974064 2:18495590-18495612 GACTCACTCCCTGTCCCCAAGGG + Intergenic
927062418 2:19436292-19436314 GACCCAATTTCTGACCTCAGGGG - Intergenic
927694439 2:25230619-25230641 GACCCAATACCTGTCCCCAGAGG + Exonic
933776436 2:85773931-85773953 AACCAGATACCTGCCCCCAGAGG - Intronic
934219003 2:90064529-90064551 GTACCAATACCTGTCCCCAAGGG - Intergenic
936629186 2:114182299-114182321 GACCCAATGTCTCTCCCTAGAGG - Intergenic
937006324 2:118520048-118520070 AACCAAAAACGTGTCCCCAGAGG + Intergenic
937919801 2:127121029-127121051 GACCCAGGACCAATCCCCAGGGG - Intergenic
938162249 2:128996448-128996470 GACAGAGTTCCTGTCCCCAGGGG - Intergenic
938312289 2:130301306-130301328 CACCCAACCCCTGCCCCCAGAGG - Intergenic
941880294 2:170474312-170474334 GAGCCAATTACTGTGCCCAGGGG + Intronic
943496718 2:188629696-188629718 CATTCAAGACCTGTCCCCAGGGG - Intergenic
946333305 2:219022275-219022297 GACCAAGTACCTGTTCCAAGTGG - Exonic
948013983 2:234672799-234672821 GACCCCATACCCTTCCCTAGGGG - Intergenic
948223795 2:236293378-236293400 GACCAGAAGCCTGTCCCCAGGGG + Intergenic
948675796 2:239595887-239595909 GACCCAATCCTTGTACCCACGGG + Intergenic
1171959267 20:31482252-31482274 GACCCAAGACCCATCCTCAGAGG - Intronic
1172481038 20:35271563-35271585 CACCCAATACTTGTCACCTGTGG - Exonic
1174386043 20:50189286-50189308 GACCCCAGCCCTGGCCCCAGCGG - Intergenic
1174579176 20:51558946-51558968 GACCCGATCCCTGGCCTCAGGGG + Intronic
1175595744 20:60231178-60231200 GACCAAGTCCCTGTCCTCAGTGG - Intergenic
1178740735 21:35198256-35198278 GACTCAACAAATGTCCCCAGGGG - Intronic
1180469584 22:15642810-15642832 CACCCAACCCCTGCCCCCAGAGG - Intergenic
1180500863 22:15927903-15927925 GTCCCCATACCAGTCCCGAGAGG + Intergenic
1180520048 22:16189560-16189582 CACCCCATAACAGTCCCCAGAGG - Intergenic
1181735692 22:24879759-24879781 AACCAAATCTCTGTCCCCAGGGG - Intronic
1182026313 22:27121975-27121997 GCCCAAATACCAGTCCCCAGAGG + Intergenic
1184631555 22:45784634-45784656 GACCCCCTCCCTGTGCCCAGAGG + Intronic
1185126231 22:49012247-49012269 GACACAAGCCCTGCCCCCAGGGG - Intergenic
1185283055 22:49983781-49983803 GCCCCGATACCTGCCCCCGGCGG - Intergenic
950578849 3:13850123-13850145 GAACCCACACCTGTGCCCAGGGG + Intronic
950904822 3:16528643-16528665 GTCCCAAACCCAGTCCCCAGTGG + Intergenic
952925314 3:38315699-38315721 GACCCCATACCTGAGCACAGTGG - Exonic
955071440 3:55575623-55575645 GGCCCAGTTCCTGGCCCCAGAGG + Intronic
961740773 3:129031996-129032018 GTCCCCATCCCCGTCCCCAGGGG - Intronic
964173930 3:153802780-153802802 GACCCGACAACAGTCCCCAGAGG - Intergenic
966211956 3:177462900-177462922 GGCCCAATACCTGTTCCATGTGG - Intergenic
967014114 3:185466156-185466178 CAGCCAATACATTTCCCCAGGGG - Intronic
969400402 4:6951693-6951715 GATCTAATACATTTCCCCAGGGG + Intronic
969440531 4:7214134-7214156 CACCCACCAGCTGTCCCCAGTGG - Intronic
969575442 4:8033695-8033717 ACCCCAGGACCTGTCCCCAGAGG - Intronic
972855317 4:43098850-43098872 GACCCCACAACAGTCCCCAGAGG - Intergenic
974423021 4:61702712-61702734 GACACAATAACTGTACCCAAAGG - Intronic
975809454 4:78151401-78151423 GACACAATTCCTGCCCTCAGTGG + Intronic
980924098 4:139117136-139117158 GAGCAAAGTCCTGTCCCCAGTGG + Intronic
981288322 4:143045744-143045766 AACACAACTCCTGTCCCCAGTGG + Intergenic
982395834 4:154914879-154914901 GACCCAATTGCTGGACCCAGGGG - Intergenic
986012243 5:3726446-3726468 CACCAAATACTTCTCCCCAGAGG - Intergenic
988417469 5:30963836-30963858 GATCCAATACGAATCCCCAGTGG + Intergenic
991324516 5:65415920-65415942 GACCTCATCCCTGTGCCCAGGGG + Intronic
992217927 5:74543857-74543879 GAGCCATTTCCTGACCCCAGAGG + Intergenic
999175764 5:149630655-149630677 AACCTCATTCCTGTCCCCAGAGG - Intronic
999628409 5:153544310-153544332 GACCCATTGCCTGTTGCCAGAGG - Intronic
1002322444 5:178383735-178383757 GCCCCAAAACCTCACCCCAGGGG - Intronic
1003066345 6:2906438-2906460 GACACAATATCTGGCCCAAGAGG + Intergenic
1004169323 6:13283694-13283716 ACCCCAACACCTTTCCCCAGGGG + Intronic
1006511623 6:34524627-34524649 GCCCAAATACCCGTCCACAGAGG - Intronic
1006725015 6:36192926-36192948 GAGCCAATAACTGTGGCCAGAGG - Intergenic
1007077564 6:39077760-39077782 GACCAACTAACTGTCCGCAGTGG - Intronic
1007629053 6:43262745-43262767 GGCTCAATACCTGGCCCCACTGG - Intronic
1013175707 6:107675018-107675040 GCCTCAATGGCTGTCCCCAGAGG + Intergenic
1015579974 6:134713758-134713780 GACCCTAACCCTGTCCACAGAGG + Intergenic
1016266888 6:142243057-142243079 GACACAATATCTTTTCCCAGGGG + Intergenic
1019151445 6:170008636-170008658 GACCCGAGACATGTCCCCTGGGG - Intergenic
1020979676 7:15052425-15052447 TACCCAATGCCTGTACCCTGTGG - Intergenic
1024059901 7:45690011-45690033 GACCCGATCCCTGTCTCCAAAGG + Intronic
1026776473 7:73234367-73234389 TAGCAAATACCTGTCCCCTGCGG + Intergenic
1026829823 7:73603639-73603661 GACCCTCTTTCTGTCCCCAGGGG + Intronic
1027017324 7:74787737-74787759 TAGCAAATACCTGTCCCCTGCGG + Intronic
1027070698 7:75158195-75158217 TAGCAAATACCTGTCCCCTGCGG - Intergenic
1027799434 7:82733496-82733518 GACCAAATAACTGTCTCCTGGGG - Intergenic
1028423510 7:90660218-90660240 GAGCCAATATTTGACCCCAGGGG - Intronic
1032546887 7:132751292-132751314 GACCCATTGCCTGTCCCCTTTGG - Intergenic
1035613951 8:988756-988778 GACCCAGGGCCTGTCCCCCGGGG + Intergenic
1037408475 8:18568863-18568885 GACCCCACAACAGTCCCCAGAGG + Intronic
1049198721 8:141329587-141329609 GACCCGAGGCCTGACCCCAGAGG + Intergenic
1052762957 9:32611299-32611321 TACCAAATACCTGTTCCCACAGG - Intergenic
1052892882 9:33720152-33720174 GAGCCAACACCTGTCTCCAGAGG - Intergenic
1053857763 9:42355928-42355950 CCCCCACTACCTGTGCCCAGTGG + Intergenic
1056708132 9:88968999-88969021 GAACCAAAGCCTGACCCCAGCGG + Intergenic
1060917008 9:127397625-127397647 GGCCCGATGCCTGTCCCGAGGGG - Intronic
1061550540 9:131331983-131332005 GACCCAGTCACTGTCCCCAGGGG + Intergenic
1061747858 9:132753355-132753377 GACCCTCTGCCTGGCCCCAGTGG + Intronic
1061957683 9:133972049-133972071 GCCCCAATTCCTGTCCCCAAAGG + Intronic
1062004827 9:134233883-134233905 GACCCAATTCCTGGGCACAGTGG - Intergenic
1062268741 9:135699347-135699369 GGCCCAAGGCCTGTACCCAGGGG - Intronic
1062342377 9:136099540-136099562 GACCCAACGCCTGGCCTCAGAGG + Intergenic
1192194081 X:69016989-69017011 GACTCCTGACCTGTCCCCAGAGG - Intergenic
1195021543 X:100833377-100833399 GGCCCAGTGCCTGGCCCCAGAGG + Exonic
1200258188 X:154596970-154596992 GACCCAAAACCTTCCTCCAGTGG - Intergenic
1201264461 Y:12192748-12192770 GACCCAACACCAGGCCACAGGGG + Intergenic