ID: 927694577

View in Genome Browser
Species Human (GRCh38)
Location 2:25231192-25231214
Sequence CACTCCAGGAGGGCTGGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 597}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927694577_927694588 -5 Left 927694577 2:25231192-25231214 CCTCCCCCAGCCCTCCTGGAGTG 0: 1
1: 0
2: 5
3: 57
4: 597
Right 927694588 2:25231210-25231232 GAGTGGCGCTGGTGGACTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 162
927694577_927694595 25 Left 927694577 2:25231192-25231214 CCTCCCCCAGCCCTCCTGGAGTG 0: 1
1: 0
2: 5
3: 57
4: 597
Right 927694595 2:25231240-25231262 GACAGAGCCCCGCGGGAGCAAGG 0: 1
1: 0
2: 1
3: 14
4: 160
927694577_927694593 18 Left 927694577 2:25231192-25231214 CCTCCCCCAGCCCTCCTGGAGTG 0: 1
1: 0
2: 5
3: 57
4: 597
Right 927694593 2:25231233-25231255 CCCGAAGGACAGAGCCCCGCGGG 0: 1
1: 0
2: 0
3: 14
4: 134
927694577_927694596 28 Left 927694577 2:25231192-25231214 CCTCCCCCAGCCCTCCTGGAGTG 0: 1
1: 0
2: 5
3: 57
4: 597
Right 927694596 2:25231243-25231265 AGAGCCCCGCGGGAGCAAGGAGG 0: 1
1: 0
2: 1
3: 12
4: 122
927694577_927694591 17 Left 927694577 2:25231192-25231214 CCTCCCCCAGCCCTCCTGGAGTG 0: 1
1: 0
2: 5
3: 57
4: 597
Right 927694591 2:25231232-25231254 GCCCGAAGGACAGAGCCCCGCGG 0: 1
1: 0
2: 1
3: 13
4: 142
927694577_927694589 3 Left 927694577 2:25231192-25231214 CCTCCCCCAGCCCTCCTGGAGTG 0: 1
1: 0
2: 5
3: 57
4: 597
Right 927694589 2:25231218-25231240 CTGGTGGACTCCAGGCCCGAAGG 0: 1
1: 0
2: 0
3: 17
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927694577 Original CRISPR CACTCCAGGAGGGCTGGGGG AGG (reversed) Exonic
900357194 1:2270674-2270696 CTCTCCAGAGGGGCTGGAGGTGG + Intronic
900488990 1:2936978-2937000 TACCCCACGGGGGCTGGGGGAGG - Intergenic
900643385 1:3697866-3697888 CGGTCCAGGACGGCTGTGGGGGG - Intronic
900644335 1:3702266-3702288 CCCTCCAGGAGGGCTGTGGAGGG - Intronic
901789992 1:11648998-11649020 CAGCCCAGGAGCGCTGTGGGCGG + Intronic
902037499 1:13468260-13468282 GACCCCAAGAGGGCTGGTGGAGG + Intergenic
902077676 1:13800783-13800805 CACTGAAGGAGGGTTGGGGGGGG + Intronic
902224561 1:14988450-14988472 CCCTCCAGCAGGGCTGGGCCGGG - Intronic
902237395 1:15066331-15066353 CACACCAGGGGGGCGGGAGGGGG - Intronic
902323527 1:15684165-15684187 GACTTGAGGAGGGCTGGGGGCGG + Intergenic
902534385 1:17110920-17110942 TGCTGCAGGAGGGCTGGAGGAGG + Intronic
902546937 1:17195981-17196003 CTGTCCAGGAGGGCTGCTGGGGG + Intergenic
902685384 1:18073386-18073408 TTCACCAGGAAGGCTGGGGGAGG - Intergenic
903696437 1:25210801-25210823 CCCTCCCTGAGGTCTGGGGGTGG + Intergenic
904286490 1:29456008-29456030 CAGTGCATGAGGGCTGTGGGAGG + Intergenic
904585704 1:31579515-31579537 CAAGCCAGGAGGGGTGGGGAAGG - Intronic
905914663 1:41676366-41676388 CACTCCCTGAGGCCTGGGTGAGG + Intronic
906181643 1:43825560-43825582 AACTCCAGGAGACCTGAGGGTGG + Intronic
906399909 1:45497347-45497369 CACTCCTGCAGTGCTGTGGGAGG - Exonic
906607262 1:47181177-47181199 CCCTCCCTCAGGGCTGGGGGTGG + Intergenic
906813052 1:48849016-48849038 GGCTCCAGGTGGGCTGGGAGGGG + Intronic
906919380 1:50048008-50048030 CCCTCGAGGTGGGCAGGGGGTGG + Intronic
907165415 1:52406235-52406257 CACTCTGGGAGGCCCGGGGGGGG - Intronic
907323556 1:53620664-53620686 TAAACAAGGAGGGCTGGGGGTGG + Intronic
907418193 1:54328916-54328938 CTGTCCAGGAGGGCAGGGGCTGG + Intronic
907502417 1:54891205-54891227 CACTTTGGGAGGCCTGGGGGAGG + Intergenic
912609122 1:111025263-111025285 CTCTGCAGGAGGAGTGGGGGAGG - Intergenic
914086770 1:144461197-144461219 CGCCCAAGGAGGGCTGCGGGCGG + Intronic
915347885 1:155207364-155207386 CTCTCCCGGAGGTCTGGTGGTGG - Intronic
915727144 1:158025899-158025921 CCCAGCAGAAGGGCTGGGGGAGG + Intronic
916148310 1:161761311-161761333 TACTCCAGGAAGGCTGGGCAAGG + Intergenic
916748252 1:167701005-167701027 AACTCCAGGAGCTCTGGGGCAGG + Intronic
917178564 1:172266716-172266738 CACTCCAAGGGGGGTGTGGGTGG - Intronic
918042287 1:180920692-180920714 CACAGCAGGCAGGCTGGGGGCGG + Intronic
918066449 1:181105140-181105162 GAGGTCAGGAGGGCTGGGGGCGG + Intergenic
919536071 1:198789283-198789305 CCCTCCAGGCCTGCTGGGGGTGG + Intergenic
920182833 1:204143129-204143151 AACTCCAGGAAGCATGGGGGAGG - Intronic
922237260 1:223731473-223731495 GACTGTAGGAGGGCTGGGGTGGG - Intronic
922504638 1:226119425-226119447 CTCTCCAGTAGGGGTGAGGGCGG - Intergenic
922867655 1:228873865-228873887 CACTGAAGGAGGGCTGGGATGGG + Intergenic
923268767 1:232336005-232336027 CTCCCCAGCAGGCCTGGGGGTGG + Intergenic
1064266240 10:13827803-13827825 CACGCCAGGAGGAGTGGGAGAGG + Intronic
1066299680 10:34085851-34085873 CACTCCAGGAAAGCTGGGGTTGG + Intergenic
1066688421 10:38003089-38003111 CACCCCAGAGTGGCTGGGGGTGG - Intergenic
1067093955 10:43286213-43286235 CCCTCAAGGAGGGCTGGCGAGGG - Intergenic
1067173042 10:43923139-43923161 CAGTTCAGTAGGGCTGGGGAAGG - Intergenic
1067712073 10:48657346-48657368 CTCTCCAGGCTTGCTGGGGGAGG + Intergenic
1068132829 10:52916088-52916110 CACTCCTGGAGGGGTGGGAGTGG + Intergenic
1069381816 10:67849550-67849572 CACTTACGGAGGGCGGGGGGCGG - Intergenic
1069873222 10:71545890-71545912 CACTCCCTGGGGGGTGGGGGTGG - Intronic
1070150281 10:73800999-73801021 CACTCCTGGGGGGCAGGGGGAGG - Exonic
1070509894 10:77151470-77151492 CACTTCAGAAGGGCAAGGGGGGG - Intronic
1071854818 10:89613434-89613456 CAATTCAGGAGGGCTGAGGGAGG + Intronic
1071935815 10:90529010-90529032 CACTATAAGAGGGATGGGGGAGG - Intergenic
1072426207 10:95332928-95332950 CACTCATGCAGGGGTGGGGGAGG + Intronic
1074859532 10:117499769-117499791 CTCTCCAGTGGGTCTGGGGGTGG + Intergenic
1074939771 10:118223305-118223327 CACTCCAGTGGGGATGGGGGTGG - Intergenic
1074976768 10:118587468-118587490 CACCCCACCAGGGCTGGGGCAGG - Intergenic
1075055933 10:119218305-119218327 CACTCCAGGAAGGGAAGGGGAGG + Intronic
1075059192 10:119242856-119242878 CAGTTCAGCATGGCTGGGGGCGG - Intronic
1075129071 10:119723145-119723167 GCCTCCAGGCAGGCTGGGGGAGG + Intergenic
1075315941 10:121453691-121453713 CACTTCATCAGGCCTGGGGGTGG - Intergenic
1076425821 10:130366944-130366966 GCCACCAGGAAGGCTGGGGGAGG + Intergenic
1076490807 10:130860083-130860105 CTCTCCAGGAGAGCTTGGGGAGG + Intergenic
1076566710 10:131404118-131404140 CGCCCCAGGATGGCTGGTGGGGG - Intergenic
1077014290 11:393077-393099 AAGCCTAGGAGGGCTGGGGGTGG - Intronic
1077101367 11:823988-824010 GCCTCCAGCAGGGCTGCGGGTGG - Exonic
1077128649 11:957527-957549 CACGACAGAAAGGCTGGGGGTGG + Intronic
1077353784 11:2105308-2105330 GGCTCCCGCAGGGCTGGGGGTGG - Intergenic
1077407004 11:2387138-2387160 CAGCCAGGGAGGGCTGGGGGTGG + Intronic
1077508900 11:2945219-2945241 AACTGCAGGAGGGGTGGGAGAGG + Exonic
1077529442 11:3088275-3088297 CTCTGCAGGAGGCCTGGGGTCGG + Exonic
1078177196 11:8978883-8978905 CCGTCCGGGAGGGTTGGGGGGGG + Intergenic
1078581861 11:12545027-12545049 CACTAAAGGAGGACTGGGGAAGG + Intergenic
1078710862 11:13789621-13789643 CACTCCATGGGGTATGGGGGAGG + Intergenic
1078850781 11:15161251-15161273 AACTCCAGGGGTCCTGGGGGAGG - Intronic
1079283982 11:19112784-19112806 CAAGCCAGAGGGGCTGGGGGGGG - Intergenic
1079368624 11:19831207-19831229 CATTCCAGGAGTGTTGCGGGGGG + Intronic
1079729668 11:23924110-23924132 CACTCAAGGTTGGCTTGGGGTGG - Intergenic
1081304676 11:41497371-41497393 CACCCCAGGAGGGATGGAGCAGG - Intergenic
1081627467 11:44663981-44664003 CCCTCCAGGAGGGAGGTGGGGGG + Intergenic
1081671601 11:44945629-44945651 GACTCCAGCAGGACTTGGGGAGG + Intronic
1081998289 11:47378210-47378232 CAAGCCAGGAGGGCAGTGGGTGG + Intronic
1083306219 11:61763151-61763173 CGCTCCAGGTGGGGTGGGGAAGG + Intronic
1083510831 11:63208372-63208394 CAACCCAGAATGGCTGGGGGTGG + Intronic
1083999717 11:66289475-66289497 TACTCCAGGAGGGAACGGGGCGG + Intergenic
1084190193 11:67495206-67495228 CAGTCCTGGAGCGCTGGTGGGGG - Exonic
1084353191 11:68618391-68618413 CACTTCAGGAGGGCTGAAGGGGG + Intergenic
1084424344 11:69076583-69076605 CACGGCAGGAGGGCAGGTGGAGG - Intronic
1084424353 11:69076608-69076630 CACCGCAGGAGGGCAGGTGGAGG - Intronic
1084424360 11:69076633-69076655 CACGGCAGGAGGGCAGGTGGAGG - Intronic
1084424368 11:69076658-69076680 CACGGCAGGAGGGCAGGTGGAGG - Intronic
1084424376 11:69076683-69076705 CACGGCAGGAGGGCAGGTGGAGG - Intronic
1084424384 11:69076708-69076730 CACAGCAGGAGGGCAGGTGGAGG - Intronic
1084424391 11:69076733-69076755 CACAGCAGGAGGGCAGGTGGAGG - Intronic
1084424398 11:69076758-69076780 CACGGCAGGAGGGCAGGTGGAGG - Intronic
1084424451 11:69076932-69076954 CACAGCAGGAGGGCAGGTGGAGG - Intronic
1084424512 11:69077131-69077153 CACGGCAGGAGGGCAGGTGGAGG - Intronic
1084424520 11:69077156-69077178 CACGGCAGGAGGGCAGGTGGAGG - Intronic
1084424569 11:69077314-69077336 CACAGCAGGAGGGCAGGTGGAGG - Intronic
1084538720 11:69774115-69774137 AGCTCCAGCAGGCCTGGGGGCGG + Exonic
1084657340 11:70527236-70527258 AACTACAGGAGTCCTGGGGGTGG - Intronic
1084785174 11:71437968-71437990 GGCCCCAGGAGGGCCGGGGGTGG - Intronic
1084945116 11:72634193-72634215 CACGACAGGAGGGCCCGGGGAGG + Intronic
1085455452 11:76662879-76662901 CACTGCATGTGGGCTGGGGTGGG - Intronic
1085603423 11:77876048-77876070 CACTTAAGGAGGGCTGATGGTGG + Intronic
1085745626 11:79111993-79112015 CACTGCAGGAGGGCAAGGTGGGG + Intronic
1087181409 11:95145996-95146018 CATGCCAGGAGGTCTGGTGGTGG - Intergenic
1087293276 11:96341847-96341869 CCCCGCAGGAGGGCTAGGGGGGG - Exonic
1088581897 11:111324751-111324773 CATCCCAGGAGGGCTGGGTGAGG + Intergenic
1089168034 11:116492841-116492863 CACTCCAGAAGGACTGGGGGAGG + Intergenic
1089326940 11:117663766-117663788 GAGTACAGGGGGGCTGGGGGAGG + Intronic
1089392707 11:118113017-118113039 ACCTCAAGGAGGGCTGGGGAAGG - Intronic
1089603854 11:119630377-119630399 CACGCCGGGAGGGCAGGGGCTGG + Intronic
1089631496 11:119787272-119787294 CCTCCCAGGAGGGCTGGGAGCGG - Intergenic
1090458253 11:126868043-126868065 CTCTCAAGGAAGACTGGGGGTGG + Intronic
1090832487 11:130428797-130428819 CACTTCAGGGGGGCGGGTGGCGG - Exonic
1091130326 11:133141283-133141305 AACTCCAGGAGGGCTGGATCTGG - Intronic
1091286892 11:134412651-134412673 TGCTGCAGGAGGGCGGGGGGCGG + Intergenic
1091440530 12:509199-509221 CTCTCAAAGGGGGCTGGGGGTGG - Intronic
1091704026 12:2681626-2681648 AGCTCCAGGAGGACTGGGAGGGG - Intronic
1093576067 12:20731209-20731231 CCCTCTTGGAAGGCTGGGGGTGG - Intronic
1093938969 12:25031950-25031972 CACACAAGGACGGCTGGGCGTGG - Intronic
1095670096 12:44848544-44848566 CTGTCCAGGTGGGATGGGGGTGG - Intronic
1095948459 12:47767175-47767197 AACTCCACAAGGGCTGGGGTGGG + Intronic
1096409887 12:51369367-51369389 CTGTCCAGTAGGTCTGGGGGTGG - Intronic
1096526411 12:52212765-52212787 TACCCCAGGAGGGCAGGTGGGGG - Intergenic
1096532020 12:52248389-52248411 CACTACAAGAGGGCAGGGTGGGG + Intronic
1097031591 12:56093913-56093935 CAGTCAAGGATGGGTGGGGGTGG + Intronic
1097182797 12:57180606-57180628 CCCTTCAGGAGAGCTGGGTGTGG + Intronic
1097469165 12:59967318-59967340 CAGTTCAGCAGGGCTGGGGAAGG + Intergenic
1098921733 12:76308764-76308786 CATTCCATGAAGGCTGGGAGAGG - Intergenic
1099116030 12:78625121-78625143 CACTCCATGAAGGCTGGCAGTGG - Intergenic
1100180401 12:92079246-92079268 AACTCCATGAGGGGAGGGGGAGG + Intronic
1100192646 12:92209317-92209339 CAATTCAGGAGGTCTGGGGTGGG + Intergenic
1100390956 12:94146517-94146539 CATTCCAGGAGGGCAGGGAGTGG + Intergenic
1101443347 12:104719777-104719799 CACTCAGGGAGGGGTGGCGGGGG + Intronic
1101521377 12:105485424-105485446 CATTCCAGCACTGCTGGGGGTGG - Intergenic
1102258355 12:111428924-111428946 CACACCCGGAGGCATGGGGGTGG - Intronic
1102490945 12:113289143-113289165 CACTCCAGGAGAGAAGTGGGAGG - Intronic
1103791087 12:123471657-123471679 CAATGCAGGAGGGCAGGTGGGGG - Exonic
1103863129 12:124030011-124030033 GACTCCAGGAGGACTCGGGTGGG - Intronic
1104711327 12:130988913-130988935 CATTTCAGGGGGGCTGGGGATGG - Intronic
1104858482 12:131912872-131912894 AACTCCAGGATGGGCGGGGGAGG - Intronic
1105249563 13:18685731-18685753 CAGTCCTGTAGGGATGGGGGAGG - Intergenic
1105271170 13:18875959-18875981 CACTGCAGGTGGGTGGGGGGCGG - Intergenic
1105320397 13:19314502-19314524 CACTCCAGAGGGGCTGCTGGGGG + Intergenic
1105654874 13:22425471-22425493 CAATCCAGGAGGGTTGATGGAGG + Intergenic
1106550327 13:30765511-30765533 AACTGGAGGAGAGCTGGGGGAGG - Intergenic
1106812667 13:33375523-33375545 CAGTTCAACAGGGCTGGGGGAGG + Intergenic
1107120172 13:36787489-36787511 CACTCCAGGGGGACTGAGGCTGG + Intergenic
1107428396 13:40316701-40316723 CTCTCTAGGGGGGCCGGGGGGGG + Intergenic
1108095223 13:46894150-46894172 CACGCCCCGTGGGCTGGGGGAGG + Intronic
1108285942 13:48907934-48907956 GACTCTAGGTGGGGTGGGGGCGG + Intergenic
1108327561 13:49348653-49348675 CACTTGGGGTGGGCTGGGGGTGG - Intronic
1109182603 13:59231689-59231711 TAATCCACGAGGGGTGGGGGGGG + Intergenic
1110295815 13:73863815-73863837 CCCGCCAGGAGGGCTTGGGGTGG + Intronic
1111418324 13:87976644-87976666 CAGTCCAGGAGGGAGGTGGGGGG - Intergenic
1111991733 13:95123649-95123671 CACTCAGAGAGGGCTGGGTGTGG - Intronic
1112374986 13:98830752-98830774 CACTCCATGAGGGCTGGGAGAGG + Intronic
1113552646 13:111205031-111205053 CACTCCAGAGGGGCAGGGGCGGG + Intronic
1114199330 14:20506649-20506671 CAGTCCAGGAGGGAGGTGGGGGG + Intronic
1114262947 14:21051908-21051930 TACCCCAGGAGGGCTGAGCGAGG - Intronic
1118315169 14:64721703-64721725 ATCTCCAGGAGGGATGGGAGGGG + Intronic
1119545747 14:75470040-75470062 AACTCCAGCAGGGCTGGCGAGGG - Exonic
1121108070 14:91293614-91293636 TACCCCAGGGGGTCTGGGGGAGG - Intronic
1121508363 14:94493473-94493495 CAGTCCCAGAGGGATGGGGGAGG + Intronic
1121846685 14:97178214-97178236 CAGGCCAGGTGGGCTGGGGGTGG - Intergenic
1121916164 14:97838532-97838554 CCCTCCCGGGGGCCTGGGGGTGG - Intergenic
1122053110 14:99073616-99073638 CACAGCAGGGAGGCTGGGGGCGG + Intergenic
1122377780 14:101277786-101277808 CACTTCAGTAGGGATGGGGAGGG - Intergenic
1122481230 14:102048806-102048828 CCCTCAAGGTGGGCGGGGGGAGG + Intronic
1122795811 14:104205678-104205700 CTGTCCGGGAGGGCTGGGGCTGG + Intergenic
1122886672 14:104713378-104713400 CCCACCTAGAGGGCTGGGGGTGG - Intronic
1124031911 15:26019491-26019513 CACTGCTGGAAGGCTGGTGGTGG + Intergenic
1124154255 15:27211172-27211194 CACTCCTGGAGGGCCTTGGGTGG - Intronic
1124595938 15:31091543-31091565 CACTCCTGAAGGGCTGGGCTTGG + Intronic
1124655021 15:31500571-31500593 CTCTGGCGGAGGGCTGGGGGAGG + Intronic
1125328210 15:38558578-38558600 TACTCCAGTAGGTCTGGGGTGGG - Intronic
1125665439 15:41426712-41426734 CACTTCAGGAGGCCGGCGGGGGG - Intronic
1125722598 15:41852393-41852415 CTGACCGGGAGGGCTGGGGGAGG - Intronic
1125833736 15:42733518-42733540 CACTTCAGGAGGCCGAGGGGCGG - Intronic
1125933579 15:43616604-43616626 CAGTGAAGGAGGGCAGGGGGTGG + Exonic
1125946677 15:43716066-43716088 CAGTGAAGGAGGGCAGGGGGTGG + Intergenic
1127975878 15:63996972-63996994 CAAGCCTGGAGGGCTGGGTGGGG + Intronic
1128355354 15:66922711-66922733 CCCTCCAGCTGGGCTGGAGGAGG + Intergenic
1128640387 15:69331690-69331712 CACTCCAGGTGGGGAGGGGAGGG - Intronic
1129458083 15:75686386-75686408 GCCTCCAGGAGGGGTGGGGCGGG - Intronic
1129687640 15:77695695-77695717 CACTCCAGCCAGGCTGGGGCAGG - Intronic
1129760431 15:78126087-78126109 CAGCCCAGGAGGGCTGGGAATGG + Intronic
1129978208 15:79840769-79840791 CACTCCAGCTGGGGTTGGGGGGG + Intronic
1130012788 15:80165100-80165122 CAGTACAGTAGGGCTGGGCGCGG + Intronic
1130651985 15:85767343-85767365 CACTTTAGGAGGGCTGAGGTGGG - Intronic
1130676683 15:85958956-85958978 CACTCCAGGATGGTTGAGGTTGG + Intergenic
1131323641 15:91421601-91421623 CACTCCAGGGGGTGTGGTGGGGG - Intergenic
1132558461 16:582942-582964 CGCCCCAGGAGTGCTTGGGGTGG - Exonic
1132610239 16:812246-812268 CACTCCACGAGGGCAGGTGCAGG + Intronic
1132687643 16:1168941-1168963 CACCCCAGGCGGGCAGGGGGCGG - Intronic
1132856487 16:2047391-2047413 CACTGCAGGAGGGCGGGGATGGG + Intronic
1132871026 16:2115823-2115845 CATTCCAGGTGTCCTGGGGGTGG - Intronic
1133648261 16:7784778-7784800 GATTCCAGGAGGCCTGGGGTTGG + Intergenic
1134242018 16:12513277-12513299 CAAGGCAGGAGGGCTGGGGAGGG - Intronic
1134521502 16:14921058-14921080 CATTCCAGGTGTCCTGGGGGTGG + Intronic
1134709173 16:16319709-16319731 CATTCCAGGTGTCCTGGGGGTGG + Intergenic
1134716382 16:16359738-16359760 CATTCCAGGTGTCCTGGGGGTGG + Intergenic
1134950432 16:18348936-18348958 CATTCCAGGTGTCCTGGGGGTGG - Intergenic
1134958368 16:18392421-18392443 CATTCCAGGTGTCCTGGGGGTGG - Intergenic
1135510315 16:23077404-23077426 CCTTCCAGGAGGGCCGGGGTTGG - Intronic
1136025328 16:27464823-27464845 TGCTCCAGGAGGGCCTGGGGAGG + Exonic
1136383289 16:29907017-29907039 GCCTCCAGGAGGGCTGGGTCTGG + Exonic
1136546052 16:30955457-30955479 CACTCAGGGAGGGCTGGGTGTGG - Intronic
1136578953 16:31140605-31140627 AGCTCCAGGAGGGCCAGGGGGGG + Exonic
1137412303 16:48239270-48239292 AACTCTAGAAGGGCTGGGCGAGG + Intronic
1137592538 16:49702576-49702598 CTCTCCTTGAGGGCTGGGGGTGG - Intronic
1137613628 16:49834880-49834902 GGGCCCAGGAGGGCTGGGGGAGG + Intronic
1137768636 16:50996817-50996839 TGCTCCAGTGGGGCTGGGGGAGG - Intergenic
1138388421 16:56652326-56652348 CAGTCCAGGAAGACTGGGGCTGG - Intronic
1138555203 16:57766849-57766871 GACTGCAGGAGGGCTGGGGGTGG - Intronic
1138588714 16:57987662-57987684 AACTCCTGGAGGACTGGTGGGGG + Intronic
1139367461 16:66442199-66442221 CTCTTCAGGAAGGCTGGAGGTGG + Intronic
1140236748 16:73166033-73166055 TACTCCTGGAGGGCTTGGGATGG + Intergenic
1140663924 16:77212210-77212232 CGCGCCAGGTGGGCGGGGGGAGG + Intronic
1141049119 16:80744859-80744881 CACTGCAGGAGGACTGTGGGTGG - Intronic
1141348313 16:83269257-83269279 CTCTCCAGGAGTTCTGGGGAGGG - Intronic
1141517999 16:84559303-84559325 CACACCAGGAAGTCTGGGGCAGG - Intergenic
1141858442 16:86700787-86700809 CACTCAAGGAGGGCTGGACGGGG - Intergenic
1142065484 16:88059947-88059969 CACCCCAGGAGGGCTGAGGTTGG + Intronic
1142095159 16:88235379-88235401 CGCTCCAGGTGTGTTGGGGGAGG - Intergenic
1142369150 16:89668562-89668584 CACTCCAGGAAGGGGGCGGGCGG + Intronic
1142369162 16:89668609-89668631 CACTCCAGGAAGGGGGCGGGCGG + Intronic
1142636424 17:1260335-1260357 CACTCCTGGAGAGGCGGGGGGGG + Intergenic
1143009393 17:3857598-3857620 CTCTCCAGGAGGGGTGCTGGTGG - Intergenic
1143125108 17:4636862-4636884 CAGCCCAGGAGGGATTGGGGAGG - Intronic
1143345184 17:6244026-6244048 CACTGGAGGAGGGATGGGAGGGG + Intergenic
1143473545 17:7190802-7190824 CCCTCCACGATGGCTGGGAGTGG + Exonic
1143954465 17:10657578-10657600 CACTCCAGGAGGAGTTGCGGGGG + Intergenic
1144350353 17:14389158-14389180 CACTACCAGAGGGCAGGGGGAGG - Intergenic
1144876001 17:18397574-18397596 CACTCCAGGAGGGGCTGGAGTGG + Intergenic
1145156227 17:20546846-20546868 CACTCCAGGAGGGGCTGGAGTGG - Intergenic
1146180278 17:30693768-30693790 CCCTCCAGGAGGGATGGGTAGGG + Intergenic
1146652187 17:34613722-34613744 TACCCATGGAGGGCTGGGGGAGG - Intronic
1146972191 17:37082344-37082366 TAATCAGGGAGGGCTGGGGGTGG - Intergenic
1147184468 17:38705841-38705863 CCCTTCAGGTGGGGTGGGGGAGG - Intronic
1147225190 17:38971102-38971124 TACTCCAGCAGGGGTGGAGGCGG + Intergenic
1147225463 17:38973410-38973432 AACTCCAGGGAGGCTGGGCGCGG + Intergenic
1147447872 17:40485985-40486007 GACTCCAGAGGGGGTGGGGGTGG - Intronic
1147591774 17:41688676-41688698 GACTCTAGGAGAGCTGGGAGGGG - Intergenic
1147848771 17:43425114-43425136 CACATCTAGAGGGCTGGGGGTGG - Intergenic
1148232914 17:45948293-45948315 GAGCCCAGGAGGGCTGGGTGCGG - Intronic
1148351897 17:46947173-46947195 GAAACCAGGAGGGCTGGGGAAGG + Intronic
1148787234 17:50151222-50151244 CTCTCCGCGAGGGCTGGGGAGGG - Intergenic
1148869218 17:50646202-50646224 GACTTCAGGATGTCTGGGGGAGG + Intronic
1149363060 17:55914072-55914094 CAGTGCAGGAAGGCTGTGGGTGG + Intergenic
1149433272 17:56611727-56611749 CTCTCCATGAGAGCTGGGGTTGG - Intergenic
1149602604 17:57903077-57903099 TCCTCCAGGATGGCTGGAGGTGG - Intronic
1149625064 17:58074345-58074367 CCCTCCAGGAGGGAGGTGGGGGG - Intergenic
1150158694 17:62875497-62875519 GAGTCCAGGCGGGCTGGGGAGGG + Intergenic
1151353122 17:73543209-73543231 GACTCCAGAAGGGCTGGGGAGGG + Intronic
1151473591 17:74332651-74332673 TAGGCCAGGAGGGCTGGGTGAGG + Intronic
1151547310 17:74801043-74801065 GACTCCAGGACGCCTGGAGGGGG + Intronic
1151572306 17:74932917-74932939 AGCTCAAGGAGGGCTGGGGTGGG + Intronic
1151683184 17:75632590-75632612 CACCCCAGGAGGGCTGCAGCAGG - Intronic
1151930597 17:77229507-77229529 AACTGCGGGAGGGCTGGGTGCGG - Intergenic
1152403505 17:80083326-80083348 CACTCCAGGTGGGCAGGGTCTGG + Intronic
1152513059 17:80803370-80803392 CACAGCAGGACGGGTGGGGGCGG - Intronic
1152612743 17:81323553-81323575 GGCCCCAGGAGGGGTGGGGGCGG + Intronic
1152642012 17:81453151-81453173 CACTCCAGGGGGGCCGGGCGGGG - Intronic
1152663292 17:81552776-81552798 CACTCCAGCCGGGGTCGGGGTGG + Intronic
1152689218 17:81710375-81710397 CACTCCAGGAAGGAGGGGGGCGG - Intergenic
1153238690 18:3012635-3012657 CCCTCCCGCAGGGCCGGGGGCGG + Intronic
1153591242 18:6675863-6675885 CACACCAGGAGGCTTGGGGCAGG - Intergenic
1154079050 18:11236137-11236159 GACTCCAGGAGGGATGGGAATGG - Intergenic
1154439266 18:14373160-14373182 CAGTCCTGTAGGGATGGGGGAGG + Intergenic
1156083907 18:33376256-33376278 CACTCCTGGTGTGTTGGGGGAGG + Intronic
1156479411 18:37426665-37426687 CGGTGCGGGAGGGCTGGGGGCGG + Intronic
1157426857 18:47591615-47591637 CACCACAGCAGGGCTGGGGCAGG - Intergenic
1157496550 18:48161270-48161292 TTCTCCAGGAGGGCTGGGAGTGG + Intronic
1157821650 18:50775779-50775801 AAGTCCAGGAGCGATGGGGGTGG - Intergenic
1158395791 18:57077508-57077530 CAGTGCGGGAGGGGTGGGGGCGG + Intergenic
1158439461 18:57461761-57461783 CAGGCCAGAAGGGCTGGGGAAGG - Intronic
1158465026 18:57682292-57682314 CCTTCCAGCAGGGCTGGGCGCGG - Intronic
1160550322 18:79690790-79690812 CACTACAGGAGTCCTGGGGTGGG + Intronic
1160680242 19:408920-408942 GAGTCGGGGAGGGCTGGGGGCGG - Intronic
1160731418 19:643225-643247 ATCTCCAGGATGCCTGGGGGAGG - Exonic
1160831654 19:1107266-1107288 CCCTCCGTGAGGGCTGGGGATGG + Intergenic
1160935459 19:1592581-1592603 CGCTCCCGCAGGGCTGGGAGAGG - Exonic
1160970381 19:1765282-1765304 GACGCCAGCAGTGCTGGGGGCGG - Intronic
1161119365 19:2516939-2516961 CACCCCAGCAGGGCTGGGGCTGG + Intronic
1161196174 19:2987817-2987839 GACTCCAGGCGGGATGGGGTGGG + Intronic
1161277396 19:3426367-3426389 CGCCCCATGAGGGCTGGGTGTGG - Intronic
1161285206 19:3464860-3464882 CTCTCCGGGAGGGCGGGCGGGGG + Intronic
1161343558 19:3755546-3755568 CACTTTAGGAGGCCGGGGGGGGG + Intronic
1161620688 19:5295433-5295455 CACCCCCGAGGGGCTGGGGGAGG + Intronic
1161648588 19:5470040-5470062 CACATCTGGAGGGCTGGGGTGGG - Intergenic
1161773348 19:6243242-6243264 CACCCCGGGAAGGCTCGGGGAGG + Intronic
1161935015 19:7366190-7366212 CACTTCAGGAGGCCTGAGGCGGG - Intronic
1161960552 19:7520693-7520715 CACAGGAGTAGGGCTGGGGGTGG - Exonic
1162246870 19:9408352-9408374 CTCTCTAGGAGAGCTGGTGGAGG - Intergenic
1162688816 19:12412101-12412123 CAGTCCATGTGGGCTGTGGGGGG - Intronic
1162720229 19:12657666-12657688 AACTCGAGGACGGCTGGGGGCGG + Intronic
1162978322 19:14221772-14221794 CCCTCCAGGAGGGATGGGTAGGG - Intergenic
1163231116 19:16002996-16003018 CAACCCAGAAGGGCTGGGGGTGG - Intergenic
1163566003 19:18051872-18051894 CCCGCCGGGCGGGCTGGGGGTGG - Intergenic
1163665911 19:18604078-18604100 CACTCTAGAAGGGCTGAGAGGGG - Intronic
1163712378 19:18854361-18854383 AACTCCAGGCTGGCTGGGGGTGG + Intronic
1163842193 19:19618393-19618415 CGCTTGAGGAGGGCTGGAGGGGG - Intronic
1164591729 19:29511201-29511223 CACGCCAGGCAGGCTTGGGGTGG - Intergenic
1164792284 19:30997436-30997458 CACTCCACGTGGGTTGGGTGAGG - Intergenic
1165092619 19:33394888-33394910 GACTCCAGGAGGGGTGGGGCAGG - Intronic
1165156739 19:33793268-33793290 CACCCCAGGAAGCCTGGGGGTGG + Intergenic
1165434740 19:35789675-35789697 GACTCCTGGAGGGCGGGCGGAGG + Intergenic
1165777813 19:38415110-38415132 AGCTCCAGGAGGGCCTGGGGAGG + Exonic
1165903192 19:39178301-39178323 CTGTGCAGGAGGGCAGGGGGCGG - Intronic
1165955133 19:39497877-39497899 CACCCCAGAAGAACTGGGGGGGG - Intergenic
1166094108 19:40529137-40529159 AACTCCAGGTGTGCTGGGGACGG + Intronic
1166130885 19:40744835-40744857 CAGGGCTGGAGGGCTGGGGGTGG + Intronic
1166142452 19:40812244-40812266 AGCTCCACTAGGGCTGGGGGCGG - Intronic
1166317317 19:41996421-41996443 CTCTCCAGCTGGGCCGGGGGAGG + Intronic
1166380207 19:42351627-42351649 CACTGCAGGATGGCAGGGGTGGG - Exonic
1166531977 19:43548139-43548161 CCCTCCAGGAGGGAGGTGGGGGG + Intronic
1166834575 19:45659360-45659382 CATTGCTGGAGGGCCGGGGGAGG + Intergenic
1166834828 19:45660932-45660954 GACCCCAGGAGGGCTGAGGTGGG + Intergenic
1166908480 19:46133026-46133048 GCCTGCAGGAGGGATGGGGGAGG + Intergenic
1167037828 19:47004401-47004423 CGCCACGGGAGGGCTGGGGGAGG - Exonic
1167148803 19:47697272-47697294 CACTCATGGTGGGCTGGGCGTGG - Intronic
1167213514 19:48148875-48148897 CACATCACGAGGGCTGGGGCAGG + Intronic
1167530135 19:50010620-50010642 CTCTCCAAGAAGGCTGGGCGTGG + Intronic
1167575479 19:50315630-50315652 AACTCCAGGAGCAGTGGGGGGGG + Exonic
1167635627 19:50653526-50653548 GAATCCAGTAGGTCTGGGGGTGG + Intronic
1168097653 19:54124679-54124701 GGCTCCAGGGGGGCCGGGGGAGG - Intronic
1168278049 19:55287806-55287828 CCCGCCAGGAAGGATGGGGGTGG + Intronic
1168292598 19:55363836-55363858 GACTCCAGGCTGGCTGGGCGCGG - Intergenic
1168610737 19:57797599-57797621 CACTTCAGGAGGCCTGAGGTCGG + Intronic
1168652510 19:58100662-58100684 CACTCTAGGAGGCCAGCGGGCGG + Intronic
925164141 2:1705278-1705300 CCCTCCATGAAGGCTGGGGTTGG + Intronic
925201040 2:1967979-1968001 CACCCCAGGAGGGGAGGAGGGGG + Intronic
925285691 2:2714288-2714310 CACCACAGGAGGACTGGGGATGG - Intergenic
926152693 2:10433833-10433855 CATTCCAGGAGGGCCAGGTGGGG + Intergenic
926311694 2:11680106-11680128 CAGTCCAGGAATGCTGAGGGGGG + Intronic
926348154 2:11968370-11968392 ATCCCCAGGAGGCCTGGGGGTGG + Intergenic
926890772 2:17637321-17637343 TACACCAGGAGGGGTGGAGGAGG + Intronic
927445449 2:23156968-23156990 CAAAACAGGAGGGCAGGGGGAGG + Intergenic
927694577 2:25231192-25231214 CACTCCAGGAGGGCTGGGGGAGG - Exonic
928182743 2:29080920-29080942 GAGGCCAGGAGGGCTGAGGGAGG - Intergenic
928389101 2:30895426-30895448 CCCAGCAGGAGGGCTGTGGGAGG - Intergenic
928392697 2:30921497-30921519 TACTCCAGTAGGGCAGGGGAGGG - Intronic
929120034 2:38476823-38476845 GACTTGAGGAGGGCTGGGAGGGG + Intergenic
929824274 2:45298227-45298249 CAGTCCACGAGGGATGTGGGTGG - Intergenic
929997236 2:46836382-46836404 CTCTCCTGGGGAGCTGGGGGTGG - Intronic
932209595 2:69915635-69915657 CACTCGTGAAGGGCTGGGGAAGG - Intronic
932331307 2:70899993-70900015 TCTTCCAGGAGGGCCGGGGGAGG + Intergenic
932716880 2:74107172-74107194 CACTCCGCGAGTGCGGGGGGAGG + Exonic
932864315 2:75325486-75325508 CAATCCAGGACGTGTGGGGGTGG - Intergenic
934073792 2:88409999-88410021 GGCTCCAGGAAGGCTGGGCGCGG + Intergenic
934301682 2:91780402-91780424 CTCCCCAGGAGGGCTGTCGGTGG + Intergenic
935191113 2:100779586-100779608 CACTGGAGGGGGGCGGGGGGCGG - Intergenic
935617718 2:105103059-105103081 GGCTGCAGGAGAGCTGGGGGCGG + Intergenic
936522094 2:113217832-113217854 CACTGCAGGAGGACCTGGGGTGG + Exonic
937221279 2:120344484-120344506 CGCCCCGGGAGGGCCGGGGGCGG + Intergenic
937928354 2:127185108-127185130 AACTCCATGGGGGCTGGGCGTGG - Exonic
938064794 2:128275863-128275885 CACACCAGGAGGTGTTGGGGAGG + Intronic
938862209 2:135381283-135381305 CACAGCAGCAAGGCTGGGGGAGG + Intronic
939830295 2:147063449-147063471 CAGTTCTGCAGGGCTGGGGGAGG - Intergenic
941404691 2:165074322-165074344 CACTCCGGGAGAGCTGGTGGGGG + Intergenic
941597303 2:167493661-167493683 CAGTGCAGGAGGGTTGGGTGGGG + Intergenic
941681170 2:168401223-168401245 CACTCCAGTGGGGCAGGGTGGGG + Intergenic
943479781 2:188404403-188404425 CACACCAAGAGGGCTGGGGTTGG - Intronic
944488778 2:200235399-200235421 AAGTCAAGGAGGGCTGGGTGTGG - Intergenic
944668028 2:201972909-201972931 GACTGGAGGAGGGGTGGGGGTGG - Intergenic
944673362 2:202014957-202014979 CAATAAAGAAGGGCTGGGGGAGG + Intergenic
945279891 2:208026077-208026099 CACTGCAGGTGGGATGTGGGCGG - Intergenic
946522579 2:220482700-220482722 GAGTCCACGAGGGATGGGGGTGG - Intergenic
947629028 2:231639870-231639892 CACTTTGGGAGGCCTGGGGGGGG - Intergenic
947630043 2:231646475-231646497 AACTCCGGGAGGGCTGAGGTGGG - Intergenic
947655090 2:231820032-231820054 CTCTTCTGGAAGGCTGGGGGTGG + Intergenic
947753228 2:232543494-232543516 CAATTCAGGAGGCCTGAGGGGGG + Intronic
948641643 2:239379132-239379154 CACTCCAGGAAGGCAGGAGCTGG + Intronic
948831903 2:240602408-240602430 GGGTCCAGGAGGGCTGAGGGTGG - Intronic
948858159 2:240740239-240740261 CACACCTGGTGGGGTGGGGGAGG + Intronic
1168850547 20:973752-973774 CACTCTATGAGGCCTGGGAGGGG - Intronic
1169316172 20:4592664-4592686 CACTCCAGGCTGCCTTGGGGAGG - Intergenic
1169341422 20:4799376-4799398 CACTCCAGGTGGGATGAGAGGGG + Intronic
1170279910 20:14634539-14634561 AACTCCAGTTGGGCGGGGGGAGG - Intronic
1171202720 20:23255029-23255051 AACTCCAGCAGGGAGGGGGGTGG - Intergenic
1171267719 20:23785863-23785885 CACACAGAGAGGGCTGGGGGAGG - Intergenic
1171435387 20:25118145-25118167 CACTTCCCGACGGCTGGGGGAGG - Intergenic
1171448207 20:25219318-25219340 CAGCACAGGAGGGCTGTGGGGGG + Intronic
1171861396 20:30405390-30405412 CCCTCCAGGAGGGAGGTGGGGGG + Intergenic
1171996509 20:31735819-31735841 CACTTCAGGAGGCCGGGGGTGGG - Intergenic
1172032060 20:31989278-31989300 CACTCCAGATGCGCTGGGGGGGG - Intronic
1172092782 20:32445870-32445892 CCCCCAAGGAGGGATGGGGGGGG - Exonic
1172301985 20:33856804-33856826 CTCTCCTGTAGGGCTAGGGGTGG + Intergenic
1172736038 20:37126512-37126534 CCCTCCAGGAGGGAGGAGGGTGG + Intronic
1172957515 20:38771510-38771532 CACTCCTGGAGCCCTGGTGGAGG + Intronic
1173229151 20:41180691-41180713 CACACCAGGAGGGGTGGGGCAGG - Exonic
1173450485 20:43159253-43159275 CATGCCATGAGAGCTGGGGGTGG + Intronic
1173453019 20:43181877-43181899 CTCTCAAGGAGGTCTGGAGGTGG + Intronic
1175735676 20:61385453-61385475 CAATCCAAGGGGGCGGGGGGCGG - Intronic
1175915429 20:62423742-62423764 CACTCTAGGAGTGCTGCAGGTGG - Intronic
1175990553 20:62786408-62786430 GACTCCAGGAGCCCTGGGGGTGG - Intergenic
1176089388 20:63312242-63312264 AACTGCAGGACGGCTGGGGTGGG - Intronic
1176141353 20:63546482-63546504 CGCTCCAGGAGCTCTGGGTGAGG - Intronic
1176217719 20:63956135-63956157 CACTCCCGGAGGCCAGGCGGCGG - Intronic
1176456414 21:6916248-6916270 CAGTCCTGTAGGGATGGGGGAGG - Intergenic
1176834589 21:13781308-13781330 CAGTCCTGTAGGGATGGGGGAGG - Intergenic
1176856924 21:13981198-13981220 CACTGCAGGTGGGGGGGGGGCGG - Intergenic
1176999147 21:15590368-15590390 CACTCCAGGAGGCCAAGGTGGGG - Intergenic
1177076998 21:16588485-16588507 CAGTCCAGCAGGTCTGGGAGAGG + Intergenic
1177547482 21:22578241-22578263 CACTCCTGGTTGGCGGGGGGCGG - Intergenic
1177734392 21:25070797-25070819 CACACCAGGAAGGCTGAGGCAGG - Intergenic
1177782879 21:25639448-25639470 CAATCCCGGAGGCGTGGGGGCGG + Exonic
1178637060 21:34313334-34313356 CACTCCTGCAGTGCTTGGGGAGG - Intergenic
1178919719 21:36730674-36730696 CACTCTTGGAGGGCTTCGGGGGG - Intronic
1178967877 21:37141414-37141436 CATTCTAAGATGGCTGGGGGGGG - Intronic
1178968521 21:37148013-37148035 AAGTCCAGGAAGGCTGGGCGTGG - Intronic
1179025564 21:37676075-37676097 AACTGCAGGAGTGCTGGCGGAGG + Intronic
1179558415 21:42195243-42195265 CCCCTCAGGAGAGCTGGGGGTGG + Intergenic
1179822529 21:43944917-43944939 GTCTCCAGGCGGGCTGGGGAGGG - Intronic
1180058825 21:45374453-45374475 CACACCAGGAGCTCTGGTGGAGG + Intergenic
1180814752 22:18782317-18782339 CTCCCCAGGAGGGCTGTCGGTGG - Intergenic
1181200939 22:21216653-21216675 CTCCCCAGGAGGGCTGTCGGTGG - Exonic
1181307796 22:21926878-21926900 CACTGCGGGAGGCCTGGGGGAGG + Intronic
1181514836 22:23404595-23404617 TGCTCCAGGAGGGGTGGGAGGGG - Intergenic
1181591699 22:23889406-23889428 CACTCTGGGAGGGCGGGGTGGGG + Intronic
1182370456 22:29806737-29806759 CGCTCCTGAAGGGCTTGGGGAGG + Intronic
1182423573 22:30260272-30260294 CCCTCCAGGAGGGCAGAGGTTGG - Intergenic
1182508209 22:30800545-30800567 CATTCCAGGCAGGTTGGGGGTGG + Intronic
1183354601 22:37351425-37351447 CACTCGAGGAGAGGTGAGGGAGG - Intergenic
1183366961 22:37411945-37411967 CAGTCCCTGAGGGCTGGGAGTGG - Intronic
1183543152 22:38441420-38441442 CACTCCAGCATGGGTGGGGCTGG + Intronic
1183739536 22:39662291-39662313 CCCTCCAGGCGGCCCGGGGGTGG - Exonic
1183929928 22:41230077-41230099 AACTCTGGGAGGGGTGGGGGCGG - Intronic
1184775244 22:46619831-46619853 CACTGCAGTGGGGGTGGGGGAGG + Intronic
1184793815 22:46719424-46719446 CACTCCAGGAGGCCAAGGTGGGG + Intronic
1184793868 22:46719838-46719860 CTGGCCAGGAGGCCTGGGGGCGG - Intronic
1184864690 22:47195652-47195674 CACACCAGGAGGACGGTGGGGGG - Intergenic
1185011866 22:48319047-48319069 CAGTGCAGGAGAGCTGGGCGTGG - Intergenic
1185220500 22:49627120-49627142 CCCACCAGGAGGGCAGGGGTGGG + Intronic
1203225978 22_KI270731v1_random:78782-78804 CTCCCCAGGAGGGCTGTCGGTGG + Intergenic
1203264849 22_KI270734v1_random:8004-8026 CTCCCCAGGAGGGCTGTCGGTGG - Intergenic
949118254 3:355365-355387 CACTCCAAATGGGCTGGGCGGGG + Intronic
949477559 3:4463199-4463221 CACTACATTAGGGCTGGGCGCGG + Intronic
949877516 3:8635794-8635816 CTCTCCAGGAGCTCTGTGGGGGG + Exonic
950320524 3:12048422-12048444 CACTCCAGGAGGCCTTTGGGAGG - Intronic
950518308 3:13481167-13481189 CAGTCCAGGCGGGCTCGGGAGGG + Intronic
950565672 3:13768296-13768318 AACCCCAGCTGGGCTGGGGGAGG + Intergenic
950578367 3:13846754-13846776 CAGTCCCTGAGGACTGGGGGTGG - Intronic
951978974 3:28545028-28545050 AAGTCCAGCATGGCTGGGGGCGG - Intergenic
953027133 3:39151792-39151814 CTCTGAAGGAGAGCTGGGGGAGG + Intronic
953151599 3:40330118-40330140 CACTCCTGGAAGGCAGGGAGTGG + Intergenic
953385547 3:42503845-42503867 CACTCCAAGTTGGCTGGGGGAGG + Intronic
953549892 3:43894032-43894054 GAGTCCAGGGGGGCGGGGGGGGG + Intergenic
953563633 3:44013364-44013386 CACTCCAGGCTGGCTGGGCCGGG + Intergenic
953848753 3:46449446-46449468 CTCTACTGGGGGGCTGGGGGTGG - Intronic
954153892 3:48674194-48674216 CAGACCAGGAGGGGTGGGGATGG + Exonic
954435577 3:50494076-50494098 CACTCCAGCAAGCCTGGCGGGGG + Intronic
956669491 3:71672923-71672945 CACTCCACAAGGCATGGGGGTGG + Intergenic
957040129 3:75329892-75329914 CACTGCAGGAGGGCTTTGGCAGG + Intergenic
958654623 3:96984761-96984783 CAAGGCAGCAGGGCTGGGGGAGG - Intronic
958658733 3:97038309-97038331 CAGTCCAGGAAGCATGGGGGGGG - Intronic
958839189 3:99182953-99182975 AACATCAGGAGGGCTGGGGGCGG - Intergenic
959062221 3:101626006-101626028 CTCCCCAGGAGGTCAGGGGGTGG + Intergenic
959526343 3:107381681-107381703 CAAGCCAGGAGGGATGGAGGTGG - Intergenic
960906315 3:122605188-122605210 CACTGGATGAGGGCTGGTGGTGG + Intronic
960997121 3:123347625-123347647 CACACCTGGAGGGGTGGGGCTGG + Intronic
961382198 3:126503111-126503133 CACTCCAGGTGTGCTGTGAGGGG - Intronic
961645953 3:128392896-128392918 CACTGAAGGAGGTCTGGGGAGGG - Intronic
962079059 3:132117699-132117721 CACTCCAGTAGGGTGGGGTGGGG + Intronic
962971167 3:140403422-140403444 CAGTTCAGGAGGTCTGGGTGGGG + Intronic
962996807 3:140636885-140636907 CACTCCAGCAGGGCAGGGTCAGG - Intergenic
963171722 3:142257784-142257806 TACTGCAGAGGGGCTGGGGGTGG + Intergenic
964720500 3:159764301-159764323 CCCCCAAGGAGGCCTGGGGGCGG - Intronic
967718390 3:192789308-192789330 GAGCCCAGGAGGGTTGGGGGAGG - Intergenic
968523771 4:1046184-1046206 GGCTCGGGGAGGGCTGGGGGAGG - Intergenic
968523820 4:1046301-1046323 GGCTCGGGGAGGGCTGGGGGAGG - Intergenic
968698113 4:2042447-2042469 CACTCCCGGCGGGCTCGGCGCGG - Exonic
968755976 4:2416980-2417002 CATTCCAGGAAGGCGGGAGGTGG - Intronic
968799391 4:2732274-2732296 CACCCTAGGCGGGCTGGGCGGGG + Exonic
969111007 4:4844258-4844280 CATTCCACGAGGGGTTGGGGTGG - Intergenic
969445329 4:7241573-7241595 CACCCCAGAAGGGCAGGGAGGGG - Intronic
972581594 4:40400071-40400093 CAGTCCAGGATGGCAGAGGGAGG + Intergenic
974188840 4:58476121-58476143 CACTTTGGGAGGCCTGGGGGGGG + Intergenic
974770333 4:66403611-66403633 CACTCCACCTGGGCTGGTGGTGG - Intergenic
975026032 4:69549985-69550007 CACTACAGGGGTGCTGGGGAGGG - Intergenic
975560675 4:75705563-75705585 CCCTACAGGAGGCCTGGAGGAGG + Intronic
976356720 4:84127202-84127224 GGCCCCAGGAGGGCTGGGGGAGG + Intergenic
976431295 4:84966164-84966186 CTCTCCGGGAGCGCGGGGGGCGG + Intronic
976524927 4:86075982-86076004 GGCCCCAGGAGGGCTGGGGGAGG - Intronic
977609148 4:99014795-99014817 CACTCAAGGATGGCTGATGGAGG + Intronic
978605601 4:110476093-110476115 CAGTGCAGGAGGGGTAGGGGTGG + Exonic
979867260 4:125772015-125772037 CACTCTGGGAGGGCGGTGGGCGG - Intergenic
980895264 4:138854498-138854520 CAGTCCAGGAGGGAGGTGGGGGG + Intergenic
982171878 4:152670214-152670236 TTCTCCAGGAAGGCTGGCGGGGG + Intronic
983261265 4:165459656-165459678 CACTTTGGGAGGGCTGGGTGGGG + Intronic
984708128 4:182862732-182862754 CACCCAGGGAAGGCTGGGGGTGG - Intergenic
985619500 5:946742-946764 AGCCCCAGGAGGGCTGAGGGCGG - Intergenic
986000448 5:3627024-3627046 CACTGGAGCAGGGCTGGGTGGGG + Intergenic
986024903 5:3841545-3841567 CTCTCATGGAGGGCTGGGGCGGG + Intergenic
986448553 5:7844770-7844792 CACTCCAAGGGGGCTGTGTGGGG - Intronic
986636483 5:9827165-9827187 AACTCCAGGAAGACTGGAGGAGG - Intergenic
986826959 5:11532301-11532323 TACTGGAGGAGGGGTGGGGGTGG - Intronic
986988115 5:13522094-13522116 CGCTGCAGGAGGGCTGGGCTGGG - Intergenic
988718171 5:33848270-33848292 CACTCCAAGGTGGCTGGTGGTGG - Intronic
988930400 5:36031120-36031142 TACTCCAGAAGGTGTGGGGGTGG + Intergenic
995429257 5:112055812-112055834 CAGTTCAGCATGGCTGGGGGAGG - Intergenic
995477175 5:112560089-112560111 CATTCCTGGTGGGGTGGGGGTGG + Intergenic
996413568 5:123185440-123185462 CACTCCAGGAGCTCTGGAGAGGG + Intronic
996552793 5:124747631-124747653 CACTGCGGGGGGGCGGGGGGAGG - Intronic
997025420 5:130054930-130054952 TACTCCAGCAGGGCTAGGTGGGG + Intronic
997293553 5:132755049-132755071 CTCTCCAGGAAGCCAGGGGGAGG - Intronic
997619013 5:135272769-135272791 CACACCACAAGGGCTTGGGGAGG - Intronic
997661339 5:135591526-135591548 CACTCCAGGTGGGTTGAGGCAGG - Intergenic
997852921 5:137348459-137348481 CAATCCCAGAGGGGTGGGGGTGG + Intronic
998165871 5:139843267-139843289 CGCTCTAGGAGGGAAGGGGGAGG + Exonic
999832897 5:155337573-155337595 CATTCCAGGACAGTTGGGGGAGG + Intergenic
1000288090 5:159845312-159845334 CATTCCAGGAGGCCTTGAGGTGG - Intergenic
1000612348 5:163388088-163388110 CAGTTCAGCATGGCTGGGGGAGG + Intergenic
1001401909 5:171450998-171451020 GACCCCAGGAGGGCTGCGCGGGG + Intronic
1001825613 5:174742805-174742827 CTCTCCTGGAGGGGTTGGGGCGG - Intergenic
1002319386 5:178365969-178365991 CACTTGAGGAGGGCTGGAGTGGG - Intronic
1002346900 5:178554467-178554489 CACACCAGGAGGGCTGGGCGTGG - Intronic
1002469182 5:179424764-179424786 CACCCAAGGAGAGCTGGGGTGGG + Intergenic
1002567482 5:180119968-180119990 CAGCCCAGGATGGCTGGGGAAGG - Intronic
1003533654 6:6957531-6957553 CACATCATGAGGGCTGGGCGCGG + Intergenic
1003871297 6:10404955-10404977 CAGGCCAGGCTGGCTGGGGGAGG - Intronic
1005063533 6:21797427-21797449 CAGTCCAGGAGGGAGGTGGGGGG - Intergenic
1005869811 6:29966344-29966366 GACCCCAGGAGGTCTTGGGGAGG - Intergenic
1006136422 6:31898862-31898884 AACTGGTGGAGGGCTGGGGGTGG + Intronic
1006149028 6:31976267-31976289 CCCTCCAGGAGGGAGGTGGGGGG - Intronic
1006745471 6:36338873-36338895 GACTCCATGAGGGCTGGGCCAGG - Intergenic
1006906939 6:37539055-37539077 CACACCAGGATGGATGGGGATGG - Intergenic
1006960840 6:37928411-37928433 CACTCCAGGAGGTCTTTGGAAGG + Intronic
1007147560 6:39651395-39651417 CACTGCAGGATGGCGGGGGAGGG + Intronic
1007262990 6:40576817-40576839 AACCACAGGAGAGCTGGGGGTGG - Intronic
1007294452 6:40811345-40811367 CACTCCAGGAGGAGATGGGGAGG + Intergenic
1007310020 6:40937970-40937992 TACTCCAGGAGGGGAGGGGTAGG - Intergenic
1007390051 6:41545846-41545868 CACTGCGTGGGGGCTGGGGGTGG - Intergenic
1007788720 6:44297136-44297158 CACCCCAGGTAGGATGGGGGAGG - Intronic
1010991607 6:82485736-82485758 CACTGCAGGAGGCTAGGGGGTGG - Intergenic
1013431790 6:110062660-110062682 AACTCCTGCAGGGCTGTGGGAGG - Intergenic
1017086351 6:150716643-150716665 CTGTCTAGGAGGGCTGGGGTGGG - Intronic
1017919147 6:158856339-158856361 CTCTCATGGAGGGCTGGGGCAGG - Intergenic
1018315636 6:162553935-162553957 CATGGCAGGAGGGCTGGGGAAGG + Intronic
1018752808 6:166822055-166822077 AGCTCCAGGAGGGATGGTGGTGG - Intronic
1018950211 6:168374138-168374160 CAATCCAGGAGCGGTGGGGATGG + Intergenic
1019499912 7:1359736-1359758 CAGTCCAGGATCCCTGGGGGTGG - Intergenic
1019521749 7:1463791-1463813 CACACCCGGAGGGGTGGGGCAGG + Intergenic
1019749926 7:2722724-2722746 CACTTCAGGAAGGCTGAGGTGGG + Intronic
1020014771 7:4824491-4824513 CAGCCGAGCAGGGCTGGGGGAGG + Intronic
1020106150 7:5423252-5423274 CGCCCCGGGAGGGGTGGGGGTGG - Intronic
1020116298 7:5478287-5478309 CAGCCCAGGGGGGCTGGGTGAGG - Intronic
1020131761 7:5562819-5562841 TACTCCAGACGGGCTGGGGGAGG + Intronic
1020813648 7:12876776-12876798 CACACATGGAGGGCTGAGGGAGG - Intergenic
1021749344 7:23779680-23779702 CACTCCAGCTTGGTTGGGGGAGG - Intronic
1022500347 7:30878632-30878654 CAGTCCAGGAGGGATGGGGTGGG + Intronic
1022804480 7:33807879-33807901 AACTCCAGTGGGGCGGGGGGTGG + Intergenic
1023505749 7:40898467-40898489 CACTCCGGGAGGTCGGGGGGGGG + Intergenic
1023798336 7:43811940-43811962 CCCACAAGGAGGGGTGGGGGAGG + Intergenic
1024051105 7:45623977-45623999 CACTCCAGGTGGTCAGGGAGGGG + Intronic
1024632831 7:51263272-51263294 CAGGCCAGGAGGCCTGGGGAGGG + Intronic
1025212974 7:57031584-57031606 CACTGCTGGGGGGCCGGGGGTGG - Intergenic
1025658979 7:63545240-63545262 CACTGCTGGGGGGCCGGGGGTGG + Intergenic
1026299962 7:69089330-69089352 CACTCCATGAGGCCTGGGCAGGG + Intergenic
1027053269 7:75032779-75032801 TACCACAGGAGGGCTGGGTGCGG + Intronic
1027139996 7:75650155-75650177 CTCTCCAGGCAGGCTGCGGGAGG + Intronic
1027495960 7:78888162-78888184 GGCTGCAGGAAGGCTGGGGGAGG + Intronic
1027520250 7:79197954-79197976 CATAGCAAGAGGGCTGGGGGTGG + Intronic
1027978336 7:85186300-85186322 CAGACCAGGAGGGGTGGTGGGGG + Intronic
1029175647 7:98662561-98662583 CACTCCAGAAGGGGCGAGGGAGG + Intergenic
1029337537 7:99915194-99915216 CAGTCCAGTTGGGCTGAGGGTGG - Intronic
1029460617 7:100692106-100692128 CCCTCCAGCAGGCCTGGGGCTGG - Intergenic
1029496274 7:100896817-100896839 AACTCCTGGAGGGCGGGGCGGGG - Intronic
1031604218 7:123749019-123749041 CGCTGCGGGAGGGTTGGGGGAGG - Exonic
1032115169 7:129110817-129110839 CACTGCATCAGAGCTGGGGGTGG + Intergenic
1033244539 7:139707073-139707095 CACTCCTGGAGGCCTCGGGCAGG + Intronic
1033656823 7:143380820-143380842 CACCCCAGGCGGACTCGGGGTGG + Intergenic
1034192902 7:149224900-149224922 CACTCGAGGAGGTGTGAGGGCGG - Exonic
1034252222 7:149701664-149701686 CACACCACGGGGACTGGGGGCGG - Intergenic
1035372322 7:158387343-158387365 CACCACAGGAGGGCTGAGGTGGG + Intronic
1035447578 7:158953119-158953141 CACTTCAGGAGAGGTGGGCGAGG - Intronic
1035557443 8:577643-577665 CACTCAGGGAGGGCTGAGGAGGG - Intergenic
1035559032 8:591286-591308 CACTCCAGGAGGCCTAGAGGAGG - Intergenic
1036060032 8:5306707-5306729 AACTCCAAGAGGGCCGGGCGCGG + Intergenic
1036868746 8:12421407-12421429 TCCTCCAGGAGGGCTGGGCCTGG + Intergenic
1037755008 8:21704929-21704951 GACTCCAGGAGGGGTGGGAGGGG + Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1037891955 8:22628252-22628274 CCCTGCAGGGAGGCTGGGGGCGG + Intronic
1038425624 8:27462192-27462214 GACCCCAGGCAGGCTGGGGGTGG + Intronic
1039020899 8:33204962-33204984 CACTTCCTGAGGGATGGGGGAGG + Intergenic
1039144990 8:34437673-34437695 GACTGCATGAGGGCTGGAGGAGG + Intergenic
1040020431 8:42736110-42736132 CACTTTGGGAGGCCTGGGGGTGG - Intronic
1040034963 8:42861006-42861028 AATTCCAGGTTGGCTGGGGGCGG - Intronic
1040593847 8:48819367-48819389 CACTCGGGGAGGGCTGGGCTCGG + Intergenic
1041308254 8:56485902-56485924 CACTCCAACAGGGCAAGGGGAGG - Intergenic
1041834984 8:62201588-62201610 CAGTCCTGGAGGGGTGGTGGTGG + Intergenic
1042627158 8:70770757-70770779 CACTCCAGGTTGGTGGGGGGAGG - Intronic
1044645316 8:94436268-94436290 AACTACAGGAGGGAAGGGGGAGG + Intronic
1046094306 8:109539657-109539679 CCTTCAAGGAGGGCTGGGGGCGG + Intergenic
1046380218 8:113439765-113439787 TTCTCCAGAAGGGGTGGGGGCGG + Intergenic
1047681345 8:127257559-127257581 AACTGCAGAAGGGCTGGGAGAGG + Intergenic
1048317863 8:133375393-133375415 GGCTCCAGGAGGGCTGGGGCAGG + Intergenic
1048337391 8:133513183-133513205 CTCTTCAGCAGGGCTGGGGTGGG - Intronic
1048576553 8:135694948-135694970 CACTGAAGGAGGGCTGTGGTTGG + Intergenic
1048788477 8:138077713-138077735 CACTCTAGGAGGGGTGAGTGGGG - Intergenic
1048808686 8:138264964-138264986 CACTTCAGTGAGGCTGGGGGAGG + Intronic
1049236679 8:141515613-141515635 CACTAAAGGAGTGCTGGGGCTGG - Intronic
1049497851 8:142945076-142945098 CTCAGCAGGAGGGCAGGGGGTGG - Intergenic
1049540605 8:143207168-143207190 CATTCCTGGAGGGCTGGGTGAGG + Intergenic
1049583116 8:143421649-143421671 CACACCAGGAGTGCTGAGGCCGG + Intronic
1049591594 8:143465295-143465317 CTCCCCAGGAAGGCAGGGGGTGG - Intronic
1049742820 8:144249178-144249200 CACCCGAGGAGGGCTGGGCAGGG - Intronic
1049832875 8:144713411-144713433 CAGTCCCGGAGCGGTGGGGGAGG + Intergenic
1050090684 9:2015112-2015134 GACTCCGGGAGCGCGGGGGGAGG - Intergenic
1051181698 9:14418430-14418452 GACTCCTGGAGAGATGGGGGTGG - Intergenic
1051629326 9:19127627-19127649 CACTCTAGGAGGGCCGGCGTTGG - Intronic
1052985722 9:34485926-34485948 TTCTCCAGTGGGGCTGGGGGTGG - Intronic
1055584680 9:77745898-77745920 GGCCCCAGAAGGGCTGGGGGTGG + Intronic
1056565556 9:87769850-87769872 CACTGCTGCAGGGCTGGGCGTGG - Intergenic
1056717690 9:89046074-89046096 CACTTCGGGAGGGGTGGGGGGGG - Intronic
1056753629 9:89368746-89368768 CATTCCAGAAGCGCTGGGGCTGG - Intronic
1057218553 9:93243297-93243319 CCCTGCAGGAGGGCGGGGGCAGG - Intronic
1057673596 9:97118620-97118642 CACTTTAGGAGGCCTGGCGGAGG + Intergenic
1057701528 9:97366368-97366390 CACTCCAGGTGGGCCCAGGGAGG + Intronic
1059305314 9:113349493-113349515 CGCACCGGGAGGGCCGGGGGCGG + Intergenic
1059346249 9:113630971-113630993 AACTCCAGGAAGGGTTGGGGGGG - Intergenic
1059571875 9:115446473-115446495 CACTTCAGGAGGCCAAGGGGGGG - Intergenic
1059656847 9:116365252-116365274 CTCCCCAGGTGGCCTGGGGGAGG - Intronic
1060117882 9:120959076-120959098 AACTTCATGAGGGCTGGGTGCGG - Intronic
1060207886 9:121693314-121693336 CACTAGAAAAGGGCTGGGGGTGG - Intronic
1060743367 9:126113976-126113998 CACTCCAAGAGGGCTGTGTGCGG - Intergenic
1061002689 9:127911195-127911217 CAGGCCAGGAGTGGTGGGGGCGG + Intronic
1061015442 9:127978582-127978604 CACTCTAGAAGGCCAGGGGGCGG + Intronic
1061094954 9:128451138-128451160 CACTTCAGGAGCGCAGGGGCTGG - Intergenic
1061248164 9:129412106-129412128 CACTCCACAAGCGCTGGGGTGGG + Intergenic
1061484653 9:130914217-130914239 CCCCTCGGGAGGGCTGGGGGAGG - Intronic
1061492268 9:130952223-130952245 AACTCCAGAGGGGGTGGGGGAGG + Intergenic
1062063712 9:134514644-134514666 CACTCGAGGAGGCCAGTGGGAGG - Intergenic
1062071625 9:134558395-134558417 CACTCCAGGCTGGGTGGGGCAGG - Intergenic
1062431275 9:136527823-136527845 GACTCCAGGAGGGCTGCGGGGGG + Intronic
1062555756 9:137112791-137112813 CACTCCAGGTGGGCTGTGATCGG - Exonic
1062581405 9:137230704-137230726 CACTCCAGGAGGGTTGGGCTGGG + Intergenic
1062607070 9:137353187-137353209 GAGGCCAGGAGGGCTGGTGGAGG - Intronic
1062640229 9:137514995-137515017 CACGTCAGCAGGGCTGGGGAAGG + Intronic
1185642581 X:1596832-1596854 CACGGCAGGAGGGATGGAGGAGG - Intronic
1186245008 X:7609164-7609186 CAGTCCAGGAGGGAGGTGGGGGG - Intergenic
1186245055 X:7609291-7609313 CAGTCCAGGAGGGAGGTGGGGGG - Intergenic
1186245098 X:7609418-7609440 CAGTCCAGGAGGGAGGTGGGGGG - Intergenic
1186826112 X:13341450-13341472 CATTCCAAGGGGGCTGGGCGCGG - Intergenic
1187772282 X:22713213-22713235 CACTGCTGGAGGGCTGGCAGTGG + Intergenic
1190597262 X:52062185-52062207 CTCTGCAGGAGGGCTGCGGAGGG - Intronic
1190611562 X:52191888-52191910 CTCTGCAGGAGGGCTGCGGAGGG + Intronic
1190927796 X:54924329-54924351 CACTACAGCAAGGCTGAGGGAGG + Intronic
1193475532 X:81960198-81960220 CACTCCAGGAGGCCTGCTGATGG - Intergenic
1197590441 X:128402766-128402788 CACTGCTGGAGGGCAGGGGGTGG + Intergenic
1197596492 X:128470303-128470325 CACTATAGGAAAGCTGGGGGAGG - Intergenic
1198089259 X:133311679-133311701 GACTCCAGGAGGGAAGGGGGTGG - Intronic
1199485024 X:148338092-148338114 CACTGCCTGAGGGCTGGGGGAGG - Intergenic
1200092039 X:153640503-153640525 GACACCAGGAGGGCTGGGAGTGG + Intergenic
1200327813 X:155260881-155260903 CAATCCAGGAGGGCTGGGAAGGG - Exonic
1202195586 Y:22296212-22296234 CCCTCCAGTAGTGCTGTGGGGGG - Intergenic