ID: 927694763

View in Genome Browser
Species Human (GRCh38)
Location 2:25232234-25232256
Sequence TTTTATAATGGGAGGGGGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 1, 2: 5, 3: 39, 4: 400}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927694763_927694772 21 Left 927694763 2:25232234-25232256 CCATCCCCCCTCCCATTATAAAA 0: 1
1: 1
2: 5
3: 39
4: 400
Right 927694772 2:25232278-25232300 TATCTACACCCCATCTACCCAGG 0: 1
1: 0
2: 0
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927694763 Original CRISPR TTTTATAATGGGAGGGGGGA TGG (reversed) Exonic
900278302 1:1847778-1847800 TTTTAAAAGGGTAGGGGGGTGGG + Intronic
901631500 1:10650337-10650359 GTTTAAAAGGGGATGGGGGAGGG - Intronic
902665522 1:17935059-17935081 TTTTAAAAAGGGAAGTGGGAGGG - Intergenic
903646609 1:24899942-24899964 TTTTGTCAGGGGATGGGGGATGG + Exonic
903794157 1:25915793-25915815 TTTTTTAATGAGATGGGGAAAGG + Intergenic
904362589 1:29986498-29986520 TATTATAATGGTAGTAGGGAAGG - Intergenic
904564146 1:31417509-31417531 TTTTTAAAAGGGAGGGGGCAGGG - Intronic
905759339 1:40541197-40541219 TTTTTTTTTTGGAGGGGGGAAGG + Intronic
905941658 1:41867923-41867945 TTTTGGAAGGGGAGGGGGGAGGG - Intronic
906262617 1:44405793-44405815 TTTTATTTGGGGAGGGGGGGAGG + Intronic
907091268 1:51728569-51728591 TTTTAGAGTGGGTAGGGGGAAGG + Intronic
907382327 1:54101646-54101668 TTTTATTTTGGGAGGGGGTCAGG + Intronic
907749674 1:57250476-57250498 TTTTATAATGTGATAGAGGAAGG - Intronic
910164672 1:84313545-84313567 TTTTATCCTGGGATGGGAGAAGG + Intronic
910201809 1:84707729-84707751 TTTTATGGTGGGATGGGAGATGG + Intergenic
910329161 1:86049424-86049446 TCTTATAATGATAGGGGTGAAGG + Intronic
910772426 1:90843590-90843612 ATTAATAATAGGAAGGGGGAAGG + Intergenic
911114516 1:94232937-94232959 TTTTTTTTTTGGAGGGGGGAAGG + Intronic
911749981 1:101485091-101485113 TTTTATTAAGGGAGGGGGATGGG + Intergenic
912198431 1:107427257-107427279 CCTTATAATTGGAGGGTGGAAGG + Intronic
913341324 1:117760429-117760451 TTTTTTACTGGGAGGAGGGAAGG - Intergenic
915067412 1:153237799-153237821 TTTTATAAAAGCAGGGGGAAAGG + Intergenic
915360468 1:155283554-155283576 ATATATAATGGGTGGGGGGAGGG - Intronic
915902836 1:159858537-159858559 TTTTAGAATGGGATGGGAGGAGG + Intronic
916070188 1:161165538-161165560 TTTTAATCGGGGAGGGGGGAGGG + Exonic
916082161 1:161240853-161240875 TTTTTTTTTGGTAGGGGGGACGG - Intergenic
916210563 1:162356574-162356596 TGTTATCATGGTAGGGTGGATGG + Intronic
916277322 1:163008782-163008804 TTTTAGAAAGGGGGAGGGGAAGG + Intergenic
916564286 1:165959587-165959609 TTTTTTTTTGGTAGGGGGGATGG - Intergenic
917653455 1:177102198-177102220 TTAAATAAGGGGAGGGAGGAAGG + Intronic
918419281 1:184346821-184346843 TTTTTTTTTGGGTGGGGGGAGGG - Intergenic
919468312 1:197948748-197948770 TTTTAAAAGGGGAGTTGGGAAGG - Intergenic
920770324 1:208878612-208878634 TTTTATATTGAGAATGGGGAGGG - Intergenic
921540843 1:216413268-216413290 TCTTAGAATGGGAGTGGGGCTGG + Intronic
922110965 1:222554827-222554849 TTTTATGAGGGGAGGTGGGAAGG + Intergenic
922350102 1:224728288-224728310 TCTTTGAATGGGAGGGGGTAGGG + Intronic
923230921 1:231985320-231985342 TTTTTTGGTGGGTGGGGGGATGG - Intronic
923796402 1:237160559-237160581 TTTTTTAATGGAAGGGATGATGG + Intronic
924064683 1:240209253-240209275 TTTTTTTTTTGGAGGGGGGACGG + Intronic
924715370 1:246567844-246567866 TTTTTTAAGGGGAGAGGGGGAGG - Intronic
1063181961 10:3610629-3610651 TTTTATAAAAGGAGGGAGGCAGG - Intergenic
1063199641 10:3775633-3775655 TTTTATAATTGGAGAGGGGATGG - Intergenic
1065309922 10:24405221-24405243 TTATATAATTGGGGGAGGGAGGG + Intronic
1065349038 10:24779005-24779027 TTTTATTTGGGTAGGGGGGAAGG - Intergenic
1065720298 10:28622431-28622453 TTTTAAAACGGGGGGGGGGGGGG - Intronic
1066574472 10:36810557-36810579 TTTTTTTTTGGGAGGGGGGTGGG + Intergenic
1067144987 10:43688394-43688416 TTTTTTTATGGGGGGGGGGGGGG + Intergenic
1067154407 10:43765022-43765044 TGGTATAATGGAAGGGGAGAGGG - Intergenic
1067950054 10:50726915-50726937 TTTTAGATTGGGAGGGTGGGGGG - Intergenic
1068703561 10:60047209-60047231 CTTTATAATGGTTGGGGGGAAGG - Intronic
1068728895 10:60334370-60334392 TTTTATGAGGTGCGGGGGGAAGG - Intronic
1069002755 10:63284028-63284050 TTGTTTTTTGGGAGGGGGGACGG + Intronic
1069105885 10:64382968-64382990 TTTCATGGTGGGAGGGGTGAGGG - Intergenic
1070158605 10:73851742-73851764 TTTTTTTGTGGGGGGGGGGAGGG + Intronic
1072600145 10:96918239-96918261 CTCTATAATGACAGGGGGGATGG + Intronic
1072827581 10:98623328-98623350 GTTTAAGATGGGAGGGGGAAAGG + Intronic
1073205071 10:101764739-101764761 TTTTTTGAGGGGCGGGGGGATGG - Intergenic
1073385529 10:103124646-103124668 TTTTTTAAAAGGTGGGGGGAGGG - Intronic
1073434537 10:103508226-103508248 TTCTGTCATGGGAGGGGAGAGGG - Intronic
1073464798 10:103688316-103688338 TTTTTGAATGGGTGGGTGGATGG - Intronic
1073906941 10:108292819-108292841 GTTTATGGTGGGAGGAGGGAGGG - Intergenic
1074097678 10:110328373-110328395 TTTTTTTTTTGGAGGGGGGATGG - Intergenic
1074252988 10:111772180-111772202 ATTTATTATGGGAAGGGGGTAGG - Intergenic
1074503614 10:114046568-114046590 TTTTTTAAAGGGAGAGGGGCTGG + Exonic
1076142717 10:128092690-128092712 TTTGATGTTGGGAGGGAGGAGGG - Intergenic
1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG + Intergenic
1076499691 10:130927895-130927917 ATTTATAATGTGGGGTGGGAGGG - Intergenic
1076705747 10:132300659-132300681 CTGTATACTGGGAGAGGGGAGGG + Intronic
1079108068 11:17586610-17586632 TTTTTTGCTGGGAGGGGGCATGG + Intronic
1079137148 11:17781954-17781976 TTTTATTTGGGGAGGGGGGGTGG + Exonic
1079231798 11:18655538-18655560 TTTAAAAAAGGGAGGGGGGCTGG - Intergenic
1079313315 11:19386266-19386288 TTTTATAATGAGAGGGGTTCTGG + Intronic
1079513663 11:21240758-21240780 CTTTCTAGTGGGGGGGGGGAGGG + Intronic
1081752915 11:45524823-45524845 TGTGATTATGGGAGGGTGGAGGG - Intergenic
1081803496 11:45876034-45876056 TATTATATTGGGTTGGGGGAGGG + Intronic
1081816729 11:45948799-45948821 TATAATGATGGGAGGAGGGAAGG + Intronic
1082090078 11:48081754-48081776 CTGTAAAATGGGTGGGGGGAAGG + Intronic
1082729088 11:56773136-56773158 TGTAATAATGGAAGGGGAGATGG - Intergenic
1084213795 11:67635941-67635963 TTTTTTAATTGGAGGGGTGAAGG - Intronic
1084292105 11:68179295-68179317 TTCTATTAAGGGAGGGAGGACGG - Intronic
1084955983 11:72691837-72691859 TTTTTCCATGGGTGGGGGGATGG + Intronic
1085777554 11:79380136-79380158 TTTTATAAAAGGAGGTGTGATGG + Intronic
1086427495 11:86700465-86700487 GTTTCTAGTGGGAGGTGGGAGGG + Intergenic
1087945397 11:104154188-104154210 TTTTAGAATGTAATGGGGGATGG - Intronic
1088083664 11:105951682-105951704 TTTAAAAATGGGAGTGGGTATGG + Intronic
1088189912 11:107216962-107216984 TTTTATAGTGGTCAGGGGGAAGG + Intergenic
1088519740 11:110682725-110682747 TTATATAATGGAAGGGAAGAAGG + Intronic
1088919919 11:114253271-114253293 TTTTATGAATGGAGCGGGGAGGG - Intergenic
1089910515 11:122094990-122095012 CTTGATAAAGGAAGGGGGGAGGG + Intergenic
1091092415 11:132784422-132784444 CTTTATAATGGAAAGAGGGAAGG - Intronic
1092599458 12:10043508-10043530 TTTAAGAATGGGAGAGGGGAAGG - Intronic
1094243061 12:28251280-28251302 TTTTAGAAGGGGAGGGGTGCAGG + Intronic
1094586286 12:31780680-31780702 CTTTATAAAGGCAGGGAGGAAGG - Intergenic
1094653937 12:32402773-32402795 TTTTATCATGGTAAGGGGAATGG - Intronic
1094764159 12:33573069-33573091 TTTTATAATGGGTGGTAAGAAGG + Intergenic
1095173627 12:39064151-39064173 TTTTAGAATGTGAGGGGAAAGGG + Intergenic
1095208849 12:39469794-39469816 TGTGATCAGGGGAGGGGGGAGGG - Intergenic
1095300191 12:40575262-40575284 TTGTACAATGGAAGGGGGAAGGG - Intergenic
1095423505 12:42049848-42049870 TTCTCAAATGGCAGGGGGGATGG + Intergenic
1095443560 12:42261726-42261748 TTTGAGAAGGGGTGGGGGGAGGG - Intronic
1095495284 12:42777665-42777687 GTTTATAGTGGGGGTGGGGAGGG - Intergenic
1095594564 12:43944569-43944591 TTTTATATAGGGTGGTGGGAGGG + Intronic
1095875513 12:47076410-47076432 TTTTTTAAAGGGGGAGGGGAAGG - Exonic
1096337386 12:50766647-50766669 TTTTATGGGGGGAGGGGGGAGGG - Intronic
1098685819 12:73419148-73419170 TTTTATAAAGAGATGGGGGTAGG - Intergenic
1098897707 12:76083236-76083258 TTTTAAGATGGGAGGTGGGATGG - Intronic
1099441439 12:82704071-82704093 TTTTTTTATGGGAGGTGGGGAGG + Intronic
1099704481 12:86134387-86134409 TTTTATAATGGGTTTGGGGTGGG - Intronic
1099772170 12:87075237-87075259 TGTTTTAAAGGAAGGGGGGAAGG - Intergenic
1099953752 12:89332391-89332413 TTTTGTAGGGGGAGGGGGCAGGG - Intergenic
1102125217 12:110475108-110475130 GTTTATAATTGGAGGGGAAAAGG + Intronic
1103535213 12:121629307-121629329 TTTTATAATTGGTGGTGGGGAGG + Intronic
1104006423 12:124895994-124896016 TTTTTTTTTGGGGGGGGGGACGG - Intergenic
1104081421 12:125433668-125433690 GTGAATAATGGGTGGGGGGAGGG - Intronic
1105949907 13:25220410-25220432 TTTTTTTTTTGGAGGGGGGACGG - Intergenic
1106407976 13:29490400-29490422 TGTTATAATGAGAGGGAAGAGGG - Intronic
1108653221 13:52502750-52502772 TTTCAAAAGGGGAGGGGGGTAGG - Intergenic
1109169886 13:59082226-59082248 TTTTTTTTTGGGGGGGGGGACGG - Intergenic
1111998225 13:95185979-95186001 TTTTTTAAAGGGAGTGGAGAAGG + Intronic
1112875133 13:104028217-104028239 TTTTATAATTTGAGTGGAGATGG + Intergenic
1113201432 13:107870311-107870333 CTGTATATTGGGAGGGGGTAAGG + Intergenic
1115435281 14:33364997-33365019 TTTTTTTGGGGGAGGGGGGAGGG + Intronic
1116127995 14:40813828-40813850 TTTTAAAATGTGAGGGTGCAAGG + Intergenic
1117193066 14:53312741-53312763 TTTTATAAGGCGGGGGGGGGTGG - Intergenic
1117675822 14:58153524-58153546 ATTTCTAAAGGGAGGGGGAATGG - Intronic
1117725256 14:58666944-58666966 GCTCATAATGTGAGGGGGGAGGG + Intergenic
1118005347 14:61560263-61560285 TTCTATAATAGTAGGTGGGAGGG + Intronic
1118019971 14:61701630-61701652 TTTTATAATGGAAAGGGGGAGGG - Intronic
1119557239 14:75562860-75562882 TTTTATAAAGGGAGAGGCGGGGG - Intergenic
1120089001 14:80309507-80309529 TTTTATACTGACAAGGGGGAAGG + Intronic
1121172108 14:91863316-91863338 TTTTATAGTGGGAGAAGGAAGGG + Intronic
1121484421 14:94303750-94303772 TTTTATTAGGGAAGAGGGGAGGG + Intergenic
1124213822 15:27789200-27789222 TTTTTTTCTGGGCGGGGGGAGGG + Intronic
1124890262 15:33725963-33725985 TTTTTTTTTGGGGGGGGGGATGG - Intronic
1125316151 15:38433768-38433790 TTGTACAATGGGTGGGGGGTGGG + Intergenic
1125467997 15:39973827-39973849 TTTTATTTTGGGAGTGGGGAGGG + Intronic
1126161809 15:45620656-45620678 TCTTATAATAGGAGGTGGGATGG + Intronic
1126506441 15:49409283-49409305 TTTCATAAAGGGGGTGGGGAGGG - Intronic
1127124197 15:55796272-55796294 TTTGAAAATGCCAGGGGGGATGG + Intergenic
1127221556 15:56886285-56886307 TTTTATTTTGGGTGGAGGGAAGG - Intronic
1127249840 15:57221528-57221550 TTCTACATTGGGAGGGGGGTAGG + Intronic
1127348026 15:58120761-58120783 TTTTGTGGGGGGAGGGGGGAGGG - Intronic
1127793572 15:62419638-62419660 TTTTTTTTTGGGTGGGGGGAGGG + Intronic
1127921733 15:63500051-63500073 TTTTGCATTGGTAGGGGGGAAGG + Intergenic
1128737711 15:70062666-70062688 TGTCAGAGTGGGAGGGGGGATGG - Intronic
1129057596 15:72832274-72832296 TTGTAGAATGTAAGGGGGGAGGG + Intergenic
1129261202 15:74368434-74368456 TGATATGATGGGAGGGGGTATGG - Intergenic
1129370308 15:75089357-75089379 TTTTAAAATGTGAGGAGGGATGG + Intronic
1129919168 15:79304983-79305005 TTATATAAAGGTAGAGGGGAGGG + Intergenic
1131344874 15:91637145-91637167 CTTTAAAATGGAAGGAGGGAAGG + Intergenic
1131794811 15:96005027-96005049 TTTTTTAATGGGGGGAGGGAAGG + Intergenic
1132458683 16:38577-38599 TTCTAGAAAGGGAGAGGGGATGG + Intergenic
1134052445 16:11146275-11146297 TTTGATAATGGGATGGGACAGGG - Intronic
1134069401 16:11251473-11251495 TTAAATAGTGGGAGAGGGGATGG - Intronic
1134227514 16:12402879-12402901 GTTTAGGATGGGAGGAGGGAGGG - Intronic
1134257294 16:12622749-12622771 CTTTTTAGGGGGAGGGGGGAAGG + Intergenic
1134610034 16:15600606-15600628 TTTTTTAAGGGGGGAGGGGATGG + Intronic
1135405629 16:22195560-22195582 TTTTTTAATGGAAGGGGGAAGGG - Intergenic
1135464911 16:22676805-22676827 TTTAATCATGGGGTGGGGGAGGG + Intergenic
1135606396 16:23828815-23828837 TCTTATAATGGGAGGGGAACTGG - Intergenic
1137568812 16:49551374-49551396 GTGTATTTTGGGAGGGGGGATGG - Intronic
1137787778 16:51151997-51152019 TTTTTTAATGGGGGTGGGGGTGG - Intergenic
1138450380 16:57090537-57090559 TTTTTTTTTTGGAGGGGGGATGG + Intergenic
1139171659 16:64637755-64637777 TTTTATAAAGGGAGTGGGCTTGG - Intergenic
1140240563 16:73196156-73196178 TTTTTTTTTTGGAGGGGGGATGG + Intergenic
1140770526 16:78199720-78199742 TTTTTTTATGGGAAGGGGGTAGG - Intronic
1140775744 16:78247615-78247637 TTTTATAAGGGGCAGGGGGCAGG - Intronic
1141954851 16:87363959-87363981 TTTACAAATGGGAGGGGGAAGGG + Intronic
1142493133 17:291370-291392 TTTTAAAATGAGATGGGGGGTGG - Intronic
1143159243 17:4858283-4858305 TTTTCATCTGGGAGGGGGGAGGG + Intronic
1143832943 17:9666870-9666892 ATTTATAATGGGAGAGAGAAGGG - Intronic
1143875756 17:9989558-9989580 TTTTCTAATGGGATTGGGGGAGG + Intronic
1144845629 17:18217430-18217452 TTTTTTTTTGGGGGGGGGGACGG - Intergenic
1146626290 17:34437985-34438007 TTAAATAATGGGGGGGGGGTGGG + Intergenic
1147968113 17:44205125-44205147 TTGTATCATGGGAGGTGGGAGGG - Exonic
1148003656 17:44407136-44407158 TTTTAAATTGGGAGGGGGGAAGG + Intronic
1148500131 17:48083818-48083840 TTTTTTTTTTGGAGGGGGGATGG - Intronic
1148624186 17:49056309-49056331 TTGCATATTGGGAGGGGGGCAGG + Intergenic
1148777661 17:50104767-50104789 TTCTAAAATGGCAGGTGGGAAGG - Intronic
1149704534 17:58683366-58683388 TTTTTTTTTGGGGGGGGGGATGG - Intronic
1149772152 17:59331153-59331175 ATTTAAAATGATAGGGGGGAGGG - Intergenic
1149891949 17:60397875-60397897 TTTTACAGTGGGAGTGAGGATGG + Intronic
1150015538 17:61553092-61553114 TTTTATAAAGGGAAGGGAAAGGG - Intergenic
1151730101 17:75905938-75905960 TTTTTTTTTGGGGGGGGGGAGGG - Intronic
1152077398 17:78168208-78168230 TTTTTCAGTGGGATGGGGGAGGG + Intergenic
1152467578 17:80474801-80474823 TTGTAAAAGGGGAGGGGGGGGGG - Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1153475524 18:5494658-5494680 TTTTTTTTTGGGTGGGGGGAGGG - Intronic
1153574524 18:6507329-6507351 TTTTATAAGGTTAGAGGGGAAGG - Intergenic
1154202621 18:12309401-12309423 TTTTAAACTGGGGGGGGGGGGGG - Intronic
1156205556 18:34882296-34882318 TTTTGAAAAGGGAGGGTGGAAGG - Intronic
1156540947 18:37909738-37909760 TTTTATAATGAGAATGGGCAAGG + Intergenic
1158221101 18:55151593-55151615 TTTTAGAAATGGAGTGGGGATGG + Intergenic
1158644919 18:59237446-59237468 TTTTTTTTTGGGCGGGGGGAAGG - Intergenic
1158914986 18:62115655-62115677 TATTAATTTGGGAGGGGGGAGGG + Intronic
1158961174 18:62588716-62588738 TTTACTAATGGTAGGGGTGAAGG + Intergenic
1160803781 19:982653-982675 TTTTATCCTGGGAGGGAGGGAGG - Intergenic
1161690760 19:5732282-5732304 TTTTATAAAGGAAGAGGAGATGG + Intronic
1162418612 19:10553060-10553082 TTTTATAAAGGGAGGGGATGAGG + Exonic
1163567653 19:18060978-18061000 CTTTAAAATGGGAAGGGGTATGG + Intronic
1164533800 19:29068913-29068935 TCTTATGATGGCAGGGGAGAGGG - Intergenic
1166078792 19:40430169-40430191 TTTTTTTTTGGGGGGGGGGATGG + Intergenic
1166207476 19:41281013-41281035 TTTTAAAATAGGGGTGGGGAAGG - Intronic
1166366988 19:42282869-42282891 TTTTTTTCTGGGAGGGGGGGCGG + Intronic
1167389587 19:49185753-49185775 TTTTTTGGGGGGAGGGGGGATGG + Intronic
1168452230 19:56475620-56475642 TTTTTTGTTGGGAGGTGGGAGGG - Intronic
925114417 2:1366548-1366570 TTTTTTATTGGGAGGGGGTAGGG + Intronic
927143663 2:20146304-20146326 TAATAAAATGGGAGGCGGGAAGG - Intergenic
927694763 2:25232234-25232256 TTTTATAATGGGAGGGGGGATGG - Exonic
927983715 2:27392603-27392625 TTTTTTTTTGGGGGGGGGGAGGG + Intronic
928351768 2:30563395-30563417 GTTGATACTGGGAGGGGTGATGG + Intronic
928892397 2:36218989-36219011 TGTTATGGGGGGAGGGGGGAGGG + Intergenic
930988910 2:57626802-57626824 TTTTTTAAAGTGAGGGGTGAGGG + Intergenic
931898461 2:66761025-66761047 TTTTATAACAGAAGGGTGGATGG + Intergenic
931925107 2:67064016-67064038 TTTTATTATGGAAAGGAGGAAGG - Intergenic
932433691 2:71690666-71690688 TTTTATAATGGGGTGGAGGATGG - Intergenic
932842024 2:75092258-75092280 TTTTAAAATTGGGGGAGGGATGG - Intronic
934072432 2:88396858-88396880 TTTTATTTTTGGAGGGAGGATGG - Intergenic
936059888 2:109287618-109287640 TTGTCCAATGGGAGGCGGGAGGG + Intronic
937046636 2:118855390-118855412 TTTTATAAATGGGGGTGGGATGG - Intergenic
937047636 2:118860191-118860213 TTTTTTTTTTGGAGGGGGGAAGG + Intergenic
938574335 2:132589872-132589894 TTTTATTAAGGGAAGGGGGAAGG + Intronic
939139749 2:138340126-138340148 TTTTTTAAGGGGTGGGGGGCAGG - Intergenic
939365628 2:141226851-141226873 TTTGATGATGGGAGTGGGGCAGG - Intronic
939404248 2:141735505-141735527 TTTTTTTTTGGGAGGGGGGAGGG + Intronic
940863613 2:158795272-158795294 CTTTATAAAGGCAGGGGGCAGGG - Intergenic
941341505 2:164310625-164310647 TAGTAGAATGGGTGGGGGGAAGG + Intergenic
941829421 2:169938123-169938145 CTTTATAAATGGAGGTGGGAAGG - Intronic
942194869 2:173507554-173507576 TTTAAATATGGGAGGAGGGAAGG - Intergenic
943536005 2:189151214-189151236 TATTTTAATGGAAGGGGTGAAGG - Intronic
944235142 2:197435447-197435469 TTTTTTAATGGGAGGGGTCTCGG - Intergenic
944258414 2:197649226-197649248 TTTGATCATGGAAGTGGGGATGG + Intronic
944617949 2:201482166-201482188 TTTTACCATGGGGTGGGGGATGG + Intergenic
945169958 2:206985475-206985497 TTTTATAATGGGTAAGGGGTTGG - Intergenic
945201899 2:207290106-207290128 TTTTATTATGGGGGGTTGGAAGG + Intergenic
945219297 2:207467838-207467860 TTTTTTTTTGGGAGGGGTGATGG - Intergenic
945338707 2:208623886-208623908 TTTTTTAATCAGAGGGAGGAAGG + Intronic
946014923 2:216596092-216596114 TTTTACATTGGGAGGAGGTATGG + Intergenic
947605132 2:231481154-231481176 CTTTTTTATGGGTGGGGGGAGGG + Intronic
948207672 2:236171187-236171209 TTTCCTAATTGGAGGGGGGAGGG - Intergenic
1169892357 20:10466737-10466759 TTTTATTTTGGGAGAGGGGAGGG + Intronic
1169971401 20:11272519-11272541 TTTAAGAATGGGGTGGGGGAAGG - Intergenic
1170380706 20:15756688-15756710 TTTTATCATCTGAAGGGGGAAGG + Intronic
1171122035 20:22576700-22576722 TTTTAATGTGGGAGGGGGGCGGG - Intergenic
1172389556 20:34557927-34557949 TTTTTTTGGGGGAGGGGGGAGGG - Intronic
1172436979 20:34936045-34936067 ATTTTTAATGGCAGGGGTGAAGG + Intronic
1174126274 20:48309268-48309290 TTTTATTAGGGCAGGGGGCAAGG - Intergenic
1174638272 20:52020646-52020668 CTTTACAATTGGAGGGGGTAGGG - Intergenic
1175003528 20:55656733-55656755 ATTTAGAGTGGGATGGGGGATGG - Intergenic
1175395649 20:58658828-58658850 TCTTTTAAGGGGAGGGGGAAGGG - Intronic
1176294200 21:5062073-5062095 CTTTTTATTTGGAGGGGGGATGG - Intergenic
1178127470 21:29530590-29530612 TTTCAGAATGGGAGAGGAGAGGG + Intronic
1178938900 21:36888415-36888437 TTTTTAAATGGGAAGGGGGCAGG - Intronic
1179863059 21:44201575-44201597 CTTTTTATTTGGAGGGGGGATGG + Intergenic
1180749373 22:18113750-18113772 TTTTGTGATGGGAGGGGAGGAGG - Intronic
1181873939 22:25925227-25925249 TTTTAAAATGGGGTGGGGGAGGG - Intronic
1182739512 22:32557297-32557319 ATTCACAAGGGGAGGGGGGATGG + Intronic
1182840740 22:33387517-33387539 TTAAAAAATGGGGGGGGGGATGG + Intronic
949373595 3:3362717-3362739 TTTTAAAATGAGAGGGAGGTAGG + Intergenic
949545866 3:5071870-5071892 TTTTTTAATGAGAGGTGGGTTGG + Intergenic
950490068 3:13299227-13299249 TTTTTTGAGGGGTGGGGGGATGG - Intergenic
950586479 3:13895794-13895816 TTATAAAATGAGAGCGGGGAGGG + Intergenic
951544278 3:23809674-23809696 TTTTATAGTGGGAGTTGGGTTGG + Intronic
952642738 3:35617089-35617111 TTTACTAATGGGAGGAGGCAGGG + Intergenic
954362954 3:50132042-50132064 TTTTTTTTTGGGTGGGGGGATGG + Intergenic
954641144 3:52098719-52098741 TTTTCTGATGGGAGTGGGCAAGG - Intronic
955061919 3:55499968-55499990 TTTTTTTTTTGGAGGGGGGATGG - Intergenic
955300854 3:57777099-57777121 TTTTTTGGGGGGAGGGGGGAGGG + Intronic
957303535 3:78425232-78425254 TTTTTTAATGGGAGGACAGAAGG - Intergenic
957708229 3:83817891-83817913 TGTTAAAATGGGGGGGGGCAAGG - Intergenic
957835913 3:85589095-85589117 TTTGATAAAGGGAGTGGTGAGGG + Intronic
957944079 3:87039551-87039573 TGCTAAAATGGGAGGGGGTAGGG + Intergenic
958691404 3:97472143-97472165 TTTTTTGAGGGGAGGGGGAAAGG + Intronic
958949785 3:100403807-100403829 CTTTATAATGTGAGGAGGGGTGG + Intronic
959918365 3:111844216-111844238 TTTCAAAATGGGAGGGAGCAAGG - Intronic
960823186 3:121756230-121756252 TTTTATAGTATGAGGGGGTAGGG + Intergenic
960888927 3:122425705-122425727 TTTTATTTTGTGTGGGGGGAGGG + Exonic
961082734 3:124040393-124040415 TTCTATGATGGGGGGTGGGAGGG - Intergenic
962189643 3:133296942-133296964 TTTCTTAATGGTTGGGGGGATGG + Intronic
963243496 3:143035009-143035031 GTTTTAAATGGGTGGGGGGAGGG + Intronic
964693790 3:159484077-159484099 TTTAAAAATGAGAGTGGGGAGGG + Intronic
964982898 3:162708769-162708791 TTTTATACCTGTAGGGGGGAGGG - Intergenic
965133875 3:164737404-164737426 TTATATAGTGAGAGGGAGGAAGG - Intergenic
966541056 3:181090104-181090126 TTTTTTTATGGTAGGGGGGATGG + Intergenic
966674246 3:182568177-182568199 TTAAATAATGGGATGCGGGAGGG + Intergenic
967500597 3:190193040-190193062 TTTTATAGTGGCAGAGGGGATGG + Intergenic
967694932 3:192519437-192519459 TATCATTATGGCAGGGGGGAGGG + Intronic
969783775 4:9435248-9435270 TGGGGTAATGGGAGGGGGGAGGG - Intergenic
969900767 4:10347078-10347100 TTTTTTTTTGGGGGGGGGGATGG + Intergenic
970138246 4:12950306-12950328 TTGTTTTATGGGAGGGAGGAGGG + Intergenic
970188435 4:13486239-13486261 TTTTTTAAATGGTGGGGGGAGGG - Intergenic
970514063 4:16810164-16810186 TACTATAAAGGGAGAGGGGAGGG + Intronic
970690542 4:18614923-18614945 TTTTATAATTTAAGGAGGGAGGG - Intergenic
971004913 4:22362516-22362538 TTTTTGAAAGGGAGGGAGGAGGG - Intronic
971077130 4:23163070-23163092 TTATATAAGGGAAGGGTGGAAGG - Intergenic
971670628 4:29551531-29551553 TTATATAATGGAAGGGGTGAGGG - Intergenic
972098713 4:35383644-35383666 TTTTAAAATGGAAGAGGAGAAGG - Intergenic
973700984 4:53537090-53537112 TTTTAGAGTGGTAGTGGGGACGG + Intronic
974121070 4:57640000-57640022 TTTTGATATGGGAGGGGGGCAGG + Intergenic
975075277 4:70199369-70199391 TTTTATAATGGGAGTGGATGTGG - Intronic
978703313 4:111675193-111675215 TTTTGATATGGGAGGGGGGCAGG + Intergenic
979192092 4:117874296-117874318 TTTTCAAATGGGAGGAGGGCAGG - Intergenic
980054085 4:128062764-128062786 CTTTATGGGGGGAGGGGGGAGGG + Intronic
981574816 4:146193528-146193550 TTTTATAATGGGATGGATGTTGG + Intronic
982275403 4:153632308-153632330 TTTTTTTTTGGGTGGGGGGAGGG - Intronic
983185309 4:164693856-164693878 TTTTTTTTTGGGAGGTGGGATGG - Intergenic
984563002 4:181292987-181293009 TTTTATACTGCGAGGAGGTACGG - Intergenic
985155337 4:186982216-186982238 TTTTTTTATGGGGGTGGGGATGG - Intergenic
988437085 5:31189293-31189315 TTCTATAATTGGAAGGGGGTTGG + Intergenic
990170272 5:53039991-53040013 TTTTTTAATGGGATGTGGAAAGG + Intronic
990216493 5:53537988-53538010 TTGTATAATGGGAGGAGAGGAGG - Intergenic
990699500 5:58460110-58460132 TTATATACGGGGAGGCGGGAAGG + Exonic
991220683 5:64211916-64211938 TTTTATTATGGGAGTTAGGAAGG + Intronic
991264548 5:64701528-64701550 TTTTAGAAGGGGCTGGGGGAAGG + Intronic
992868348 5:80980695-80980717 TTTTAAAATGGTAAGGGAGAGGG - Intronic
993665099 5:90686154-90686176 TTTTTTTTTGGGGGGGGGGATGG + Intronic
994254219 5:97573622-97573644 TTTTAAAATTGGGGCGGGGAGGG + Intergenic
994726465 5:103442110-103442132 TTTTAAAATGGAAGGGAGGGTGG + Intergenic
994936246 5:106256547-106256569 TTTTTTTTTGGGGGGGGGGAAGG - Intergenic
995728696 5:115212375-115212397 TTTTAGATTGGGAGGGTGGGGGG - Exonic
996207152 5:120755041-120755063 TGTCATTTTGGGAGGGGGGAGGG + Intergenic
996690273 5:126333094-126333116 TTTTATATTGGGAAAGGGAAAGG - Intergenic
996749652 5:126875718-126875740 TTCTATAAAGGGCAGGGGGAGGG + Intronic
997439870 5:133901543-133901565 TTTTATAATTGGAGGGTGGGAGG + Intergenic
997564864 5:134879183-134879205 TTTTACAATGTGCAGGGGGATGG + Intronic
998014966 5:138724746-138724768 TTCTATAATGGGAGGTGGGAGGG - Intronic
998173994 5:139889643-139889665 GTTTGTAATGGGAAGGGGGAGGG - Intronic
998309325 5:141111507-141111529 TTGTGTGGTGGGAGGGGGGAGGG - Intronic
999420492 5:151437996-151438018 TTTTTTAATAGGAGGGAGGCAGG - Intronic
999712581 5:154331824-154331846 TATTATAAAGAGAGGGGTGAAGG - Intronic
999925917 5:156377330-156377352 TTTTATAATGCGATGGGAGTTGG - Intronic
1000242247 5:159419344-159419366 TTGTATAATGGGTTGGGGGTTGG + Intergenic
1000881114 5:166698664-166698686 TTTTTAAAGGGCAGGGGGGATGG - Intergenic
1000925413 5:167187800-167187822 CTTTATAATGGGAAGGAGGGTGG - Intergenic
1001043791 5:168355778-168355800 TTTTATTATGGGGGTGGGTAAGG + Intronic
1001313314 5:170626392-170626414 CTTTCTAATGGGGGTGGGGAAGG + Intronic
1001342464 5:170860482-170860504 TTTTAAAATGGGAGAGGAGGAGG + Intergenic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1003573203 6:7269342-7269364 TTTCTTCATGGGAGGGTGGATGG - Intronic
1004817691 6:19330545-19330567 TTTTAAAATGGGGGTGGGGTGGG + Intergenic
1007048714 6:38803920-38803942 TTTAATCATGGGAGGGGGAATGG - Intronic
1007426397 6:41748839-41748861 CCTTATAATGGGGGAGGGGAGGG + Intronic
1007626601 6:43250043-43250065 TTCCATAATGGGTGGGGGGTGGG + Intronic
1008558832 6:52703460-52703482 ATTTGTAAAGGGAGGAGGGAAGG - Intergenic
1008941925 6:57056552-57056574 TTTTTGGATGGGAGAGGGGAGGG + Intergenic
1009517917 6:64643109-64643131 TTTTTTTTTGGGGGGGGGGATGG - Intronic
1010507566 6:76679034-76679056 TTCTGTAGGGGGAGGGGGGAAGG + Intergenic
1010890504 6:81303674-81303696 TTTAATACTGGGAGGTGGGGTGG + Intergenic
1011083176 6:83511506-83511528 TTTTAGTATGGGGGGGCGGAGGG + Intergenic
1011947015 6:92918187-92918209 TTTAATTATGGAATGGGGGATGG - Intergenic
1011964069 6:93130603-93130625 ATATATATAGGGAGGGGGGAGGG + Intergenic
1012814929 6:104011469-104011491 TTTAATAATGGGTGGCGGGTGGG - Intergenic
1014060451 6:117065352-117065374 TTTTGAAATGTGTGGGGGGAGGG - Intergenic
1014620510 6:123661222-123661244 TATTAATATGGGAGGGGGGCAGG - Intergenic
1015502990 6:133952751-133952773 TTATATAATGGGGGGTGGGGAGG + Intronic
1015799585 6:137046599-137046621 CTTTATAATGGGAGGGGGGAAGG + Intergenic
1016236221 6:141870211-141870233 TATTATGATAGCAGGGGGGAGGG - Intergenic
1021073505 7:16273106-16273128 TTTGATGGGGGGAGGGGGGAGGG - Intronic
1021369923 7:19831954-19831976 TTTGATTATGGGTGGGAGGAGGG - Intergenic
1021644736 7:22777962-22777984 TTTTAGACTGTGTGGGGGGATGG + Intergenic
1021699889 7:23307827-23307849 TTTATTAAAGGGAGAGGGGATGG - Intronic
1023045050 7:36203364-36203386 TGTTAGAAAGGGAGGGGGAAAGG - Intronic
1026163815 7:67892472-67892494 CTTTAGAATGAGAGGGGGGAGGG - Intergenic
1026841769 7:73673309-73673331 TTTTTTTTTGGGTGGGGGGACGG - Intergenic
1027414073 7:77955940-77955962 TTATATAATGGGGGTGGGGTGGG - Exonic
1028112450 7:86958242-86958264 TTTTATAAAGGGAGGGGGAAAGG + Intronic
1028229446 7:88288530-88288552 TTTTATAATCTTAGAGGGGAAGG + Intronic
1028920167 7:96302214-96302236 TTTTAAAAAGGCAGGGGGTAGGG + Intronic
1029318538 7:99736401-99736423 TTTTCTAATGGGAGGAGAGCAGG + Intergenic
1029323463 7:99785387-99785409 TTTTCTAATGGGAGGAGGGCAGG + Intergenic
1030484134 7:110144746-110144768 ATTTATCATGGGAGAGGTGATGG - Intergenic
1030934649 7:115570455-115570477 TTTTAAAAAGGGGAGGGGGATGG - Intergenic
1031611565 7:123833757-123833779 TTGTATAATGTGAGGGATGAGGG + Intronic
1031756947 7:125657035-125657057 GTTTATAATGGGAGAGGTGGAGG + Intergenic
1031924717 7:127628511-127628533 TTTTTTAAAGGGAGGGGGATAGG + Intergenic
1033020056 7:137715476-137715498 TTTCAAAATAGGAGGGGAGAGGG - Intronic
1033099180 7:138456175-138456197 TTTTATTATGGGGGGGGGGCGGG - Intergenic
1033130113 7:138738666-138738688 TTTTATAAGGGCAGGGAGGCGGG + Intronic
1033820607 7:145130264-145130286 TGTCATAATGGAAGGGGGGTTGG - Intergenic
1037685691 8:21137692-21137714 TGGGATAAAGGGAGGGGGGAAGG + Intergenic
1039110236 8:34034042-34034064 TTTTATGAAGGGAGAGAGGATGG + Intergenic
1040782085 8:51121586-51121608 TGTGATAATGGGAGCGGGGCAGG + Intergenic
1041266699 8:56072545-56072567 TTTTTTTTTGGGGGGGGGGACGG - Intronic
1041764715 8:61406610-61406632 TTTTTTTGTGGGGGGGGGGATGG + Intronic
1041966978 8:63689446-63689468 TATTTTAATGGGAGGGGGTATGG - Intergenic
1042745714 8:72103492-72103514 TTTTAGAATCTGAGGGGAGATGG - Intronic
1043579102 8:81691122-81691144 TTTTTTTTTGGGCGGGGGGACGG - Intergenic
1046905340 8:119566359-119566381 TTTAATAAGGGGAGGGAAGAGGG - Intronic
1048707852 8:137174360-137174382 GTTTACCATGGGATGGGGGAAGG - Intergenic
1048792032 8:138112999-138113021 ATTTTTAATGGGCGGGGGGGGGG + Intergenic
1049099075 8:140566610-140566632 TTTTTTTTTGGGGGGGGGGAAGG + Intronic
1051259567 9:15249697-15249719 TTTTAAAAAGGTTGGGGGGAGGG + Intronic
1051387263 9:16522547-16522569 TTTTTTACAGGGATGGGGGAGGG + Intronic
1051576116 9:18617489-18617511 TTTTTTTTTGGCAGGGGGGAGGG + Intronic
1051793621 9:20837545-20837567 TTTTTTTTTGGGAGGGGGGTTGG + Intronic
1051887188 9:21905375-21905397 TTTGATACAGGGAGGGGGGCAGG - Intronic
1052060402 9:23953788-23953810 TATTGTAATGGGTTGGGGGAAGG - Intergenic
1052301851 9:26961093-26961115 TTTTTTTTTGGGTGGGGGGATGG + Intronic
1053101870 9:35377958-35377980 TATTATAAGAGGTGGGGGGAGGG + Intronic
1053313519 9:37034500-37034522 TTTTATAGGGGTTGGGGGGAGGG + Intergenic
1053362205 9:37496440-37496462 TGTTTTAATGGGAAAGGGGAGGG - Intronic
1054948944 9:70826884-70826906 TTTTATTTTGTGAGGCGGGACGG + Intronic
1055030927 9:71770545-71770567 TTTTATAAGGGGAAAGGGGGTGG + Intronic
1055061323 9:72072182-72072204 TTACATAATAGGAGGGGGGCTGG + Intronic
1055503557 9:76925839-76925861 TTTTTTGCGGGGAGGGGGGAGGG - Intergenic
1056177316 9:84048110-84048132 TTTTCTGGGGGGAGGGGGGAGGG + Intergenic
1056320569 9:85431021-85431043 TCTGATAAGGGGTGGGGGGATGG + Intergenic
1057347120 9:94260475-94260497 CTTGATAGTGGGGGGGGGGACGG + Intronic
1058799784 9:108534383-108534405 TCTTCTAATGGGAGGCTGGATGG + Intergenic
1058916721 9:109574177-109574199 TTTGAGAATGGAAGGTGGGAGGG + Intergenic
1061657457 9:132104045-132104067 TTTTTTAAAGGGAGGAGAGAAGG + Intergenic
1061725937 9:132582105-132582127 TTTTTTAAAGGAAGGGGGGGAGG + Intergenic
1062493924 9:136822650-136822672 TTTGAAAATGTGATGGGGGAGGG - Intronic
1185726627 X:2426890-2426912 TTTTATAAAAGAAGGAGGGAAGG - Intronic
1186053801 X:5627669-5627691 TTTCTTCATGGGAGGGTGGAAGG + Intergenic
1186291070 X:8099717-8099739 TATTATAAAGGAAGGGAGGAAGG + Intergenic
1186291846 X:8108830-8108852 TTGTATAATGAGGGGGGTGAAGG - Intergenic
1186386630 X:9116475-9116497 TTTAATGATGGGAGGGAGGAAGG - Intronic
1187416260 X:19095839-19095861 TTTTTTATTGAGATGGGGGAGGG - Intronic
1187441745 X:19327206-19327228 TTTTTTTTTGGGTGGGGGGAGGG + Intergenic
1187627264 X:21129971-21129993 TTTTTTGGGGGGAGGGGGGAGGG - Intergenic
1187828316 X:23355025-23355047 TTTTTTGGGGGGAGGGGGGAGGG + Intronic
1188050850 X:25483944-25483966 TTTAATGATGAGAGGGAGGAGGG + Intergenic
1189063126 X:37776038-37776060 TTTTATAAAGGCGGGGGGGAGGG + Intronic
1189265059 X:39708829-39708851 TTATATAATAGGAGTAGGGAGGG + Intergenic
1189323517 X:40099434-40099456 TTTTATACTGGGAAGGGGGTGGG + Intronic
1190322752 X:49188148-49188170 TTTCATCACGGGAGTGGGGAAGG + Exonic
1191633792 X:63354008-63354030 ATTTATAATTGGAGGGGTGGTGG + Intergenic
1192054854 X:67762808-67762830 TATTATAAGGGAAGGGAGGAAGG + Intergenic
1193222900 X:78947589-78947611 TATTATAATGGGAGAGGGCTTGG + Intronic
1193464787 X:81835178-81835200 TCTTGTAATGGGAGTGTGGATGG + Intergenic
1194317419 X:92397472-92397494 TTTTTTTTTGGGTGGGGGGACGG + Intronic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1194834557 X:98665699-98665721 TTTTTTTGTGGGAGGGGGGGTGG + Intergenic
1195493907 X:105507470-105507492 GTGTATGATGGGAGGGGGAAGGG - Intronic
1195521151 X:105830829-105830851 TTGTGTAGGGGGAGGGGGGAGGG + Intronic
1196207289 X:112955294-112955316 TTTTCTCATGGGAGGGGTGTGGG - Intergenic
1197267809 X:124394565-124394587 TTTTATATTTGGGGGTGGGAGGG - Intronic
1198081749 X:133246635-133246657 TTTCATAATAGAAGGGTGGAGGG + Intergenic
1199199017 X:145065942-145065964 TTTTTTAATTGGAGTGGAGAGGG + Intergenic
1200106184 X:153714180-153714202 TTTAAGAATGGTATGGGGGAGGG - Intronic
1200176513 X:154120932-154120954 TTTTTTAGGGGGAGGGGGGAAGG + Intergenic
1200397513 X:155999811-155999833 TTTTTTAATGGGGGCGGGGAAGG - Intronic
1200689795 Y:6295534-6295556 TTTTTTTTTTGGAGGGGGGATGG + Intergenic
1201045477 Y:9879186-9879208 TTTTTTTTTTGGAGGGGGGATGG - Intergenic
1202594686 Y:26524454-26524476 TTTGGTAGGGGGAGGGGGGAGGG + Intergenic