ID: 927695173

View in Genome Browser
Species Human (GRCh38)
Location 2:25235006-25235028
Sequence ACACCCTGATTTGATGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927695173_927695177 10 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 927695173 2:25235006-25235028 CCATTTGCATCAAATCAGGGTGT 0: 1
1: 0
2: 0
3: 6
4: 134
Right 927695177 2:25235039-25235061 AGGTCTGCCTGGCCCTATGCTGG 0: 1
1: 0
2: 1
3: 11
4: 204
927695173_927695178 15 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 927695173 2:25235006-25235028 CCATTTGCATCAAATCAGGGTGT 0: 1
1: 0
2: 0
3: 6
4: 134
Right 927695178 2:25235044-25235066 TGCCTGGCCCTATGCTGGCTTGG 0: 1
1: 0
2: 1
3: 24
4: 221
927695173_927695175 -10 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 927695173 2:25235006-25235028 CCATTTGCATCAAATCAGGGTGT 0: 1
1: 0
2: 0
3: 6
4: 134
Right 927695175 2:25235019-25235041 ATCAGGGTGTTGAGGCTGCGAGG 0: 1
1: 0
2: 2
3: 13
4: 145
927695173_927695176 -1 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 927695173 2:25235006-25235028 CCATTTGCATCAAATCAGGGTGT 0: 1
1: 0
2: 0
3: 6
4: 134
Right 927695176 2:25235028-25235050 TTGAGGCTGCGAGGTCTGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927695173 Original CRISPR ACACCCTGATTTGATGCAAA TGG (reversed) Intronic
900918462 1:5655344-5655366 ACACCCTGATTTTATAGGAATGG - Intergenic
902855251 1:19198627-19198649 AAGCCCTGAGTTGAGGCAAAAGG - Exonic
904204281 1:28842734-28842756 ACCCCCTGATTGGATCCAAAGGG + Intronic
909777191 1:79496185-79496207 AAACCTTGACTTGATGCTAATGG - Intergenic
910376043 1:86571829-86571851 ACACACAGATGTGATGAAAATGG + Intronic
916286862 1:163116037-163116059 ACAACCTAATCTGATGTAAATGG - Intronic
916767911 1:167879667-167879689 AAACCCTGATAGGATGGAAAAGG + Intronic
916875977 1:168969711-168969733 ACAACCCCATTTGAGGCAAATGG - Intergenic
920084482 1:203405284-203405306 ACACCCTGATTTCCTGCTATGGG - Intergenic
1067897227 10:50196684-50196706 ACAGCATGATTAGAGGCAAATGG + Intronic
1067951745 10:50745341-50745363 ACAGCATGATTAGAGGCAAATGG - Intronic
1068297897 10:55098638-55098660 CCACCCTAATCTTATGCAAATGG - Intronic
1068359150 10:55953334-55953356 CCAGCCTGATTTGTTGTAAATGG - Intergenic
1069759484 10:70798802-70798824 CCACCCTAATCTTATGCAAATGG - Intergenic
1070269090 10:74934527-74934549 ACAGCCAGAGTAGATGCAAAAGG - Intronic
1075882967 10:125870334-125870356 ACACCCTCATTTGATGCATGAGG + Intronic
1077656724 11:4026814-4026836 ACACTCTGATGTGCTGGAAATGG - Intronic
1078664835 11:13315843-13315865 CCACCCTCCTGTGATGCAAAAGG - Intronic
1079485079 11:20927663-20927685 ACACCCTAATTTGATTTAATAGG + Intronic
1080857603 11:36125894-36125916 TCAACCTGATCTGCTGCAAAAGG + Intronic
1082177850 11:49082425-49082447 ACACCCTGATTTAGTCCAGAAGG + Intergenic
1082796446 11:57381349-57381371 ACACCCTGGTTTGCTTCAGAAGG + Intergenic
1086687866 11:89753435-89753457 ACACCCTGATTTAGTCCAGAAGG - Intergenic
1086717985 11:90086459-90086481 ACACCCTGATTTAGTCCAGAAGG + Intergenic
1087783800 11:102331614-102331636 CCACCCTGATTTACTCCAAAGGG - Intronic
1087832418 11:102833432-102833454 AAACTCTGATTTTAAGCAAAGGG - Intergenic
1090555208 11:127867230-127867252 ACACCCTGATGGGCTGCAGAAGG + Intergenic
1091676894 12:2498062-2498084 TCAACCTGCTTGGATGCAAAAGG - Intronic
1093942886 12:25073835-25073857 AAACCTTGTTTTGAAGCAAATGG - Intronic
1096896244 12:54823031-54823053 CCACCCTAATATTATGCAAATGG - Intergenic
1099938867 12:89161006-89161028 TCACCCTGATTTAATTCAGATGG + Intergenic
1101709387 12:107250658-107250680 ACAACCTGAATTACTGCAAAGGG + Intergenic
1106041552 13:26098165-26098187 GCTCCCTGTTTGGATGCAAACGG - Intergenic
1106565941 13:30884764-30884786 CCACCCTAATCTTATGCAAATGG + Intergenic
1107219590 13:37966493-37966515 ATACCTTGATATGATGCAATGGG - Intergenic
1109379521 13:61541558-61541580 ACACATTGATTTGGTGCAACAGG - Intergenic
1110183996 13:72651748-72651770 ACAACTTGAGTTAATGCAAACGG - Intergenic
1110341100 13:74391135-74391157 ACACCCTGATATGATGCACTGGG - Intergenic
1115539404 14:34405208-34405230 TCACCCTGCCTTGATGCACATGG + Intronic
1119186033 14:72643292-72643314 TCACCCTTATGTGGTGCAAATGG - Intronic
1122821755 14:104350195-104350217 GCGCCCTGATGTGATGCAGAAGG + Intergenic
1123540543 15:21285366-21285388 CCACCCTAATCTTATGCAAATGG + Intergenic
1131329607 15:91484899-91484921 TCACCCTAATCTAATGCAAATGG + Intergenic
1202948857 15_KI270727v1_random:12508-12530 CCACCCTAATCTTATGCAAATGG + Intergenic
1133478948 16:6150848-6150870 ACAACCTGACATGCTGCAAATGG - Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1133948927 16:10373508-10373530 AAAGCCTGATTTTTTGCAAATGG - Intronic
1137501978 16:49018839-49018861 ACACCCTCATTGGATGCATGGGG + Intergenic
1138594205 16:58021011-58021033 ACACTCTGATCTGAGGCCAATGG - Exonic
1139827323 16:69767462-69767484 ACTCACTGATTTGATTCCAAAGG - Intronic
1140141506 16:72262479-72262501 ACAGCCAGAATTGCTGCAAAAGG - Intergenic
1140165022 16:72542266-72542288 CCACCCTAATCTTATGCAAATGG - Intergenic
1141313314 16:82936041-82936063 CCACCCTAATCTTATGCAAATGG + Intronic
1141899695 16:86983164-86983186 TCACCCAGATGTGATGCAGACGG - Intergenic
1143342936 17:6227272-6227294 ACCTCCTGATATGATGCAACAGG + Intergenic
1146596556 17:34174213-34174235 CCACCCTAATCTTATGCAAATGG + Intronic
1146839125 17:36137538-36137560 ACACCCTGCTTGGATTCGAATGG + Intergenic
1151029217 17:70716440-70716462 ACACCCTGTGTTGTAGCAAAGGG + Intergenic
1154461532 18:14594360-14594382 ACACACTGGATTGATGCAATAGG - Intergenic
1156881646 18:42087385-42087407 CCACCCTAATCTTATGCAAATGG + Exonic
1158016863 18:52793183-52793205 CCACCCTAATCTTATGCAAATGG + Intronic
1158872702 18:61703708-61703730 ACATCATGATGTGATGCAACTGG + Intergenic
1161729311 19:5949390-5949412 ACACCCTGACTGGTTGCTAAGGG - Intronic
1165778770 19:38420225-38420247 ACACCCTGAGGTGATGCACCAGG - Exonic
925502092 2:4516292-4516314 ACAATCTGTTTTGATGGAAAAGG + Intergenic
925956069 2:8966095-8966117 AGACCCTGCATTGATGGAAAGGG + Intronic
927695173 2:25235006-25235028 ACACCCTGATTTGATGCAAATGG - Intronic
928265896 2:29811610-29811632 ACAAACTGATTTCATGCCAAAGG + Intronic
928777603 2:34784734-34784756 ACATCTTTATTTGATGCTAATGG + Intergenic
930682834 2:54275529-54275551 ATTCCCTGATTTTATGGAAAAGG - Intronic
930877632 2:56237043-56237065 AAATGCTGATTTGATGCGAAAGG + Intronic
930881150 2:56271970-56271992 ACACCCTGATTGGGAGCTAAAGG + Intronic
932197706 2:69798479-69798501 ACACCCTGGTGTTATTCAAAAGG - Intronic
935315764 2:101832030-101832052 ACACAGTCATGTGATGCAAATGG - Intronic
940499062 2:154471771-154471793 ACACAATGCTTTGATTCAAAAGG + Intergenic
940904152 2:159153696-159153718 ACACCCTGTATTGATTTAAAAGG - Intronic
941397745 2:164993818-164993840 CCACCCTAATCTTATGCAAATGG + Intergenic
943359792 2:186903989-186904011 ACATACTGATGTGATGAAAAAGG - Intergenic
944499744 2:200347228-200347250 ACATTCTGATTTTATTCAAAGGG + Intronic
947268634 2:228308409-228308431 ACACCGTGGTGTGATTCAAAGGG - Intergenic
1171543971 20:25986940-25986962 ACACCATGATTTGAGGCCCATGG + Intergenic
1172049872 20:32109371-32109393 AGACCTTGATTTGAGGGAAAGGG - Intergenic
1172195287 20:33087363-33087385 CCACCCTCCTTTTATGCAAAGGG + Intronic
1174715116 20:52749328-52749350 ATGCCCTGAATTGATGCACAGGG - Intergenic
1175695949 20:61102623-61102645 ACACCCTGAGTTAAGGCAGATGG + Intergenic
1178611878 21:34089782-34089804 AAACCCTGATTGGACTCAAATGG - Intronic
1184873233 22:47255009-47255031 GCACCCTAAATAGATGCAAAAGG + Intergenic
950166684 3:10806193-10806215 ACAGCTTGATGTGAAGCAAATGG + Intergenic
950516755 3:13471512-13471534 AGACACAGATTTGATGCAAATGG - Intergenic
952765623 3:36951395-36951417 GCCTCCTGATGTGATGCAAAAGG + Intergenic
960909310 3:122633006-122633028 ACACCCTGTTCTGATACACATGG - Intronic
964811295 3:160667575-160667597 TCACCCTGATTGGGGGCAAAGGG - Intergenic
966689201 3:182725992-182726014 ACACCCTGGTGTTATTCAAAAGG - Intergenic
968262035 3:197333255-197333277 AAACCAGGATTTGAAGCAAAGGG + Intergenic
969108705 4:4828031-4828053 ACACCTTGATTTGAGGCATCTGG + Intergenic
970396799 4:15676217-15676239 ACCTCCTGATATGATGCAATAGG + Intronic
972175978 4:36407126-36407148 TCACCCTGTTTTGTTGCCAAGGG + Intergenic
975549759 4:75600297-75600319 ACACCATGATTTCTTTCAAATGG - Exonic
976084152 4:81390016-81390038 ACCTCCTGATGTGATGCAATAGG + Intergenic
976756563 4:88504674-88504696 ACACTATGATCTGTTGCAAATGG - Intronic
982779953 4:159480340-159480362 CTACCCTGATTTGATGAAACTGG - Intergenic
983885879 4:172980003-172980025 TCACCCTCATTTTATGCACAAGG - Intronic
984394314 4:179175270-179175292 ACACAATGATTCAATGCAAAAGG - Intergenic
991970555 5:72136696-72136718 ACACCCTAATTGGAGGGAAAGGG - Intronic
994633237 5:102312177-102312199 ACTCCATGATATGATACAAAGGG + Intergenic
994998968 5:107103061-107103083 ACACCATGATTAGTTACAAAAGG + Intergenic
996219099 5:120907602-120907624 ACACCCAGAAATGAAGCAAATGG - Intergenic
1002862324 6:1091227-1091249 ACACCCAGATTTTAGGCAACTGG + Intergenic
1004643861 6:17540929-17540951 ACACATTTATTTTATGCAAAGGG - Intronic
1011621003 6:89242599-89242621 CTACCATGATTTGATGGAAAAGG + Intergenic
1014916669 6:127159135-127159157 GCACCTGCATTTGATGCAAAAGG + Intronic
1015073450 6:129125606-129125628 AGACCTTGATGTGATGCATAGGG + Intronic
1015748108 6:136532666-136532688 ATTCCATGACTTGATGCAAATGG + Intronic
1016234731 6:141850043-141850065 ACACAATTATGTGATGCAAAAGG + Intergenic
1016973267 6:149785214-149785236 ACCTCCTGATATGATGCAACAGG - Intronic
1018081377 6:160262006-160262028 CCACCCTGCTGTGATGCAAGTGG - Intronic
1021370759 7:19843352-19843374 ACACCAAGAATTGATGCCAAAGG + Intergenic
1031410535 7:121436021-121436043 ACACCATGAATTAATGGAAATGG - Intergenic
1032296560 7:130644293-130644315 ACAAAGTGATTAGATGCAAAAGG - Intronic
1032374013 7:131391674-131391696 ACATCCTCATTTTATACAAAAGG - Intronic
1032934354 7:136711711-136711733 AAGCCCTGATTTGCAGCAAAGGG + Intergenic
1033434951 7:141324842-141324864 AGGCCCTGTTTTTATGCAAAGGG - Intronic
1035046637 7:155972094-155972116 ACACCCTTCTTGGATACAAATGG - Intergenic
1039183294 8:34890400-34890422 CCACCCTAATTTTATGCAAATGG - Intergenic
1039198170 8:35055899-35055921 ACAGCATGATTAGATTCAAATGG - Intergenic
1040525912 8:48225216-48225238 CCACCCTAATCTTATGCAAATGG - Intergenic
1040952439 8:52950960-52950982 ACAGCCTGCTTTTAAGCAAATGG - Intergenic
1040957577 8:52995443-52995465 CCACCCTAATATTATGCAAATGG - Intergenic
1041371859 8:57170092-57170114 AGACCCTGCTTTGATGGGAAGGG - Intergenic
1042257850 8:66824601-66824623 ACATCAGGAATTGATGCAAATGG + Intronic
1044047464 8:87454553-87454575 ACACCCAGATTTCATTGAAATGG - Intronic
1045792173 8:105996306-105996328 CCACCCTAATATTATGCAAATGG + Intergenic
1046315859 8:112500895-112500917 CCACCCTAATCTTATGCAAAAGG - Intronic
1046977607 8:120299383-120299405 ACACCTTGATGTTATGCTAAAGG + Intronic
1047729115 8:127711646-127711668 ACCCCCTGATGTGATGAAAAGGG + Intergenic
1048530015 8:135239427-135239449 ACATTCTGCTGTGATGCAAAAGG + Intergenic
1055069372 9:72150364-72150386 ACTGCTTGCTTTGATGCAAATGG - Intronic
1056467821 9:86876158-86876180 AATCCTTGATTTGATCCAAATGG + Intergenic
1187771641 X:22705356-22705378 ATATCCTGATTTGTTCCAAAAGG - Intergenic
1195625588 X:107003057-107003079 ATTCCCTGATGTGATGCAATGGG - Intergenic
1197654317 X:129099765-129099787 ACACCCAGATCCCATGCAAAGGG - Intergenic